ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl38c04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC007807.8|AC007807 Drosophila melanogaster, chromosome 3R, r... 46 0.100
2gb|AC007824.5|AC007824 Drosophila melanogaster, chromosome 3R, r... 46 0.100
3gb|AF183178.1|AF183178S1 Drosophila melanogaster filamin isoform... 46 0.100
4gb|AE003716.5| Drosophila melanogaster chromosome 3R, section 54... 46 0.100
5gb|AC066595.5| Homo sapiens chromosome 3 clone RP11-385A18 map 3... 42 1.6
6gb|AC026187.4| Homo sapiens chromosome 3 clone RP11-306H5 map 3p... 42 1.6
7ref|NM_129886.2| Arabidopsis thaliana nucleotide-sugar transport... 40 6.1
8gb|AC132366.4| Mus musculus BAC clone RP23-461N12 from chromosom... 40 6.1
9gb|AC122047.4| Mus musculus BAC clone RP24-456A9 from chromosome... 40 6.1
10emb|AL161772.17| Human DNA sequence from clone RP11-172H24 on ch... 40 6.1
11gb|AC158365.2| Mus musculus BAC clone RP23-182N12 from chromosom... 40 6.1
12emb|AL670399.4| Mouse DNA sequence from clone RP23-263M10 on chr... 40 6.1
13gb|AC104441.2| Homo sapiens chromosome 3 clone RP11-901H12, comp... 40 6.1
14gb|AC104183.2| Homo sapiens chromosome 3 clone RP11-180N14, comp... 40 6.1
15dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003 40 6.1
16gb|AC004450.3| Arabidopsis thaliana chromosome 2 clone F14B2 map... 40 6.1
17dbj|AK221504.1| Arabidopsis thaliana mRNA for hypothetical prote... 40 6.1
18emb|BX820117.1|CNS0AA1I Arabidopsis thaliana Full-length cDNA Co... 40 6.1
19emb|BX820748.1|CNS0A9NX Arabidopsis thaliana Full-length cDNA Co... 40 6.1
20gb|AC007756.5|AC007756 Drosophila melanogaster, chromosome 3R, r... 40 6.1
21gb|AC007757.5|AC007757 Drosophila melanogaster, chromosome 3R, r... 40 6.1
22gb|AC069019.8|AC069019 Mus musculus BAC RP23-455N13 (Roswell Pa... 40 6.1
23gb|AC013430.5|AC013430 Genomic sequence for Arabidopsis thaliana... 40 6.1
24gb|AE003730.3| Drosophila melanogaster chromosome 3R, section 68... 40 6.1
25emb|BX284626.3| Mouse DNA sequence from clone RP23-76P19 on chro... 40 6.1
26emb|AL928635.5| Mouse DNA sequence from clone RP23-410E7 on chro... 40 6.1

>gb|AC007807.8|AC007807 Drosophila melanogaster, chromosome 3R, region 89E-89E, BAC clone
              BACR01E04, complete sequence
          Length = 172674

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 68     aataaaacaagagcgcattttgtttctcttt 98
              ||||||||||||| ||||||| |||||||||
Sbjct: 104407 aataaaacaagagagcattttctttctcttt 104437



to top

>gb|AC007824.5|AC007824 Drosophila melanogaster, chromosome 3R, region 89E-90A, BAC clone
             BACR02L16, complete sequence
          Length = 190866

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 68    aataaaacaagagcgcattttgtttctcttt 98
             ||||||||||||| ||||||| |||||||||
Sbjct: 44937 aataaaacaagagagcattttctttctcttt 44967



to top

>gb|AF183178.1|AF183178S1 Drosophila melanogaster filamin isoforms A and B (Filamin) gene,
            exons 1 and 2
          Length = 5153

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 68   aataaaacaagagcgcattttgtttctcttt 98
            ||||||||||||| ||||||| |||||||||
Sbjct: 1587 aataaaacaagagagcattttctttctcttt 1557



to top

>gb|AE003716.5| Drosophila melanogaster chromosome 3R, section 54 of 118 of the
             complete sequence
          Length = 220035

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 68    aataaaacaagagcgcattttgtttctcttt 98
             ||||||||||||| ||||||| |||||||||
Sbjct: 90982 aataaaacaagagagcattttctttctcttt 91012



to top

>gb|AC066595.5| Homo sapiens chromosome 3 clone RP11-385A18 map 3p, complete sequence
          Length = 172123

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 218   cctcttctctacctccctgct 238
             |||||||||||||||||||||
Sbjct: 38534 cctcttctctacctccctgct 38514



to top

>gb|AC026187.4| Homo sapiens chromosome 3 clone RP11-306H5 map 3p, complete sequence
          Length = 184087

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 218    cctcttctctacctccctgct 238
              |||||||||||||||||||||
Sbjct: 163662 cctcttctctacctccctgct 163642



to top

>ref|NM_129886.2| Arabidopsis thaliana nucleotide-sugar transporter/ sugar porter
            AT2G43240 mRNA, complete cds
          Length = 2576

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 321  gatgaagaagaacacgaagt 340
            ||||||||||||||||||||
Sbjct: 1340 gatgaagaagaacacgaagt 1321



to top

>gb|AC132366.4| Mus musculus BAC clone RP23-461N12 from chromosome 7, complete sequence
          Length = 183964

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 317   tgtggatgaagaagaacacg 336
             ||||||||||||||||||||
Sbjct: 44091 tgtggatgaagaagaacacg 44110



to top

>gb|AC122047.4| Mus musculus BAC clone RP24-456A9 from chromosome 2, complete sequence
          Length = 172110

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 154    gtgtgcagccgagcattttt 173
              ||||||||||||||||||||
Sbjct: 110194 gtgtgcagccgagcattttt 110213



to top

>emb|AL161772.17| Human DNA sequence from clone RP11-172H24 on chromosome 13 Contains the
             3' end of the gene for polycystic kidney disease,
             autosomal recessive (Probe hTg737) (TG737), a novel
             pseudogene (FLJ124251 and FLJ14793), the 5' end of the
             IL17D gene for interleukin 17D and a CpG island, complete
             sequence
          Length = 125579

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 218   cctcttctctacctccctgc 237
             ||||||||||||||||||||
Sbjct: 90700 cctcttctctacctccctgc 90681



to top

>gb|AC158365.2| Mus musculus BAC clone RP23-182N12 from chromosome 12, complete sequence
          Length = 220129

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 143    aatctatcaatgtgtgcagc 162
              ||||||||||||||||||||
Sbjct: 102824 aatctatcaatgtgtgcagc 102805



to top

>emb|AL670399.4| Mouse DNA sequence from clone RP23-263M10 on chromosome 11 Contains the
             3' end of the Atp2a3 gene for ubiquitous Ca++ transporting
             ATPase, the P2rx1 and P2rx5 genes for purinergic receptor
             P2X ligand-gated ion channel 1 and 5, 111 novel genes, the
             Camkk1 gene for calcium/calmodulin-dependent protein
             kinase kinase 1 alpha, the Itgae gene for
             epithelial-associated integrin alpha E, the Gsg2 gene for
             germ cell-specific gene 2 protein, the gene for a novel
             protein similar to human tax interacting protein 1, the
             Ctns gene for nephropathic cystinosis protein and five CpG
             islands, complete sequence
          Length = 224037

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 204   ttcctccacagcagcctctt 223
             ||||||||||||||||||||
Sbjct: 30251 ttcctccacagcagcctctt 30270



to top

>gb|AC104441.2| Homo sapiens chromosome 3 clone RP11-901H12, complete sequence
          Length = 177320

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 217  gcctcttctctacctccctgctgt 240
            ||||||||||||||| ||||||||
Sbjct: 9422 gcctcttctctacctgcctgctgt 9445



to top

>gb|AC104183.2| Homo sapiens chromosome 3 clone RP11-180N14, complete sequence
          Length = 169709

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 217  gcctcttctctacctccctgctgt 240
            ||||||||||||||| ||||||||
Sbjct: 3166 gcctcttctctacctgcctgctgt 3143



to top

>dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003
          Length = 4170692

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 215     cagcctcttctctacctccc 234
               ||||||||||||||||||||
Sbjct: 1793550 cagcctcttctctacctccc 1793569



to top

>gb|AC004450.3| Arabidopsis thaliana chromosome 2 clone F14B2 map CIC10F02, complete
             sequence
          Length = 90283

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 321   gatgaagaagaacacgaagt 340
             ||||||||||||||||||||
Sbjct: 59857 gatgaagaagaacacgaagt 59876



to top

>dbj|AK221504.1| Arabidopsis thaliana mRNA for hypothetical protein, complete cds,
           clone: RAFL07-56-D23
          Length = 1423

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 321 gatgaagaagaacacgaagt 340
           ||||||||||||||||||||
Sbjct: 42  gatgaagaagaacacgaagt 23



to top

>emb|BX820117.1|CNS0AA1I Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS75ZF06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1624

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 321 gatgaagaagaacacgaagt 340
           ||||||||||||||||||||
Sbjct: 23  gatgaagaagaacacgaagt 4



to top

>emb|BX820748.1|CNS0A9NX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH66ZB05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1453

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 321 gatgaagaagaacacgaagt 340
           ||||||||||||||||||||
Sbjct: 31  gatgaagaagaacacgaagt 12



to top

>gb|AC007756.5|AC007756 Drosophila melanogaster, chromosome 3R, region 92E-92E, BAC clone
             BACR10P06, complete sequence
          Length = 170105

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 110   gagcacatgcatcaacctca 129
             ||||||||||||||||||||
Sbjct: 95042 gagcacatgcatcaacctca 95023



to top

>gb|AC007757.5|AC007757 Drosophila melanogaster, chromosome 3R, region 92E-92F, BAC clone
             BACR13J19, complete sequence
          Length = 170939

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 110   gagcacatgcatcaacctca 129
             ||||||||||||||||||||
Sbjct: 11845 gagcacatgcatcaacctca 11826



to top

>gb|AC069019.8|AC069019 Mus musculus  BAC RP23-455N13 (Roswell Park Cancer Institute Mouse BAC
             Library) complete sequence
          Length = 196175

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 215   cagcctcttctctacctccc 234
             ||||||||||||||||||||
Sbjct: 77651 cagcctcttctctacctccc 77670



to top

>gb|AC013430.5|AC013430 Genomic sequence for Arabidopsis thaliana BAC F3F9 from chromosome I,
             complete sequence
          Length = 95769

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 313   gcgctgtggatgaagaagaa 332
             ||||||||||||||||||||
Sbjct: 54414 gcgctgtggatgaagaagaa 54395



to top

>gb|AE003730.3| Drosophila melanogaster chromosome 3R, section 68 of 118 of the complete
              sequence
          Length = 221402

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 110    gagcacatgcatcaacctca 129
              ||||||||||||||||||||
Sbjct: 187426 gagcacatgcatcaacctca 187407



to top

>emb|BX284626.3| Mouse DNA sequence from clone RP23-76P19 on chromosome 11, complete
              sequence
          Length = 182810

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 215    cagcctcttctctacctccc 234
              ||||||||||||||||||||
Sbjct: 137447 cagcctcttctctacctccc 137428



to top

>emb|AL928635.5| Mouse DNA sequence from clone RP23-410E7 on chromosome 2, complete
              sequence
          Length = 175392

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 154    gtgtgcagccgagcattttt 173
              ||||||||||||||||||||
Sbjct: 114413 gtgtgcagccgagcattttt 114394


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,398,194
Number of Sequences: 3902068
Number of extensions: 4398194
Number of successful extensions: 96750
Number of sequences better than 10.0: 26
Number of HSP's better than 10.0 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 96680
Number of HSP's gapped (non-prelim): 70
length of query: 456
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 434
effective length of database: 17,147,199,772
effective search space: 7441884701048
effective search space used: 7441884701048
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top