ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbastl38a09 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY107171.1| Zea mays PCO069619 mRNA sequence Length = 1102 Score = 97.6 bits (49), Expect = 3e-17 Identities = 76/85 (89%) Strand = Plus / Minus Query: 321 gtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacg 380 |||||||||||||||||||||||||||||||| ||||| ||||| || || |||||||| Sbjct: 854 gtgtaggactgctggatggtctcgatgtcgagtcccttcagcttcacaacagactccaca 795 Query: 381 tgccctttgagcgtatgaagctccc 405 ||||| ||||| || |||||||||| Sbjct: 794 tgccccttgagtgtgtgaagctccc 770
>gb|AY104577.1| Zea mays PCO137756 mRNA sequence Length = 1308 Score = 89.7 bits (45), Expect = 7e-15 Identities = 78/89 (87%) Strand = Plus / Minus Query: 318 acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 377 ||||||||| |||||| ||||| || |||||||| ||||||||||||||||||||||| Sbjct: 1231 acggtgtagctctgctgaatggtgtcaatgtcgaggcccttgagcttgacgacggactcg 1172 Query: 378 acgtgccctttgagcgtatgaagctccct 406 ||||| || |||||||| || |||||||| Sbjct: 1171 acgtgtcccttgagcgtgtgcagctccct 1143
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 83.8 bits (42), Expect = 4e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 313 atcagacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgg 372 |||| |||||||| ||||||||||||||||| |||||||| || |||||||| || || | Sbjct: 27429483 atcacacggtgtaagactgctggatggtctcaatgtcgaggcctttgagcttcacaaccg 27429424 Query: 373 actccacgtgccctttgagcgtatgaagctccct 406 | || || ||||| ||||||||||| |||||||| Sbjct: 27429423 attctacatgccccttgagcgtatggagctccct 27429390
>emb|AL928743.1|CNS08CBG Oryza sativa chromosome 12, . BAC OSJNBb0011N16 of library OSJNBb from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 55237 Score = 83.8 bits (42), Expect = 4e-13 Identities = 81/94 (86%) Strand = Plus / Plus Query: 313 atcagacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgg 372 |||| |||||||| ||||||||||||||||| |||||||| || |||||||| || || | Sbjct: 52335 atcacacggtgtaagactgctggatggtctcaatgtcgaggcctttgagcttcacaaccg 52394 Query: 373 actccacgtgccctttgagcgtatgaagctccct 406 | || || ||||| ||||||||||| |||||||| Sbjct: 52395 attctacatgccccttgagcgtatggagctccct 52428
>dbj|AK071252.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023088D22, full insert sequence Length = 1702 Score = 83.8 bits (42), Expect = 4e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 313 atcagacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgg 372 |||| |||||||| ||||||||||||||||| |||||||| || |||||||| || || | Sbjct: 1287 atcacacggtgtaagactgctggatggtctcaatgtcgaggcctttgagcttcacaaccg 1228 Query: 373 actccacgtgccctttgagcgtatgaagctccct 406 | || || ||||| ||||||||||| |||||||| Sbjct: 1227 attctacatgccccttgagcgtatggagctccct 1194
>dbj|AK067535.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013109J17, full insert sequence Length = 3286 Score = 83.8 bits (42), Expect = 4e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 313 atcagacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgg 372 |||| |||||||| ||||||||||||||||| |||||||| || |||||||| || || | Sbjct: 2929 atcacacggtgtaagactgctggatggtctcaatgtcgaggcctttgagcttcacaaccg 2870 Query: 373 actccacgtgccctttgagcgtatgaagctccct 406 | || || ||||| ||||||||||| |||||||| Sbjct: 2869 attctacatgccccttgagcgtatggagctccct 2836
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 83.8 bits (42), Expect = 4e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 313 atcagacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgg 372 |||| |||||||| ||||||||||||||||| |||||||| || |||||||| || || | Sbjct: 27355083 atcacacggtgtaagactgctggatggtctcaatgtcgaggcctttgagcttcacaaccg 27355024 Query: 373 actccacgtgccctttgagcgtatgaagctccct 406 | || || ||||| ||||||||||| |||||||| Sbjct: 27355023 attctacatgccccttgagcgtatggagctccct 27354990
>emb|AL732378.3|CNS08C91 Oryza sativa chromosome 12, . BAC OSJNBa0063N15 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 109222 Score = 83.8 bits (42), Expect = 4e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 313 atcagacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgg 372 |||| |||||||| ||||||||||||||||| |||||||| || |||||||| || || | Sbjct: 5397 atcacacggtgtaagactgctggatggtctcaatgtcgaggcctttgagcttcacaaccg 5338 Query: 373 actccacgtgccctttgagcgtatgaagctccct 406 | || || ||||| ||||||||||| |||||||| Sbjct: 5337 attctacatgccccttgagcgtatggagctccct 5304
>emb|AL731762.2|CNS07YPW Oryza sativa chromosome 12, . BAC OJ1119_E02 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 124605 Score = 83.8 bits (42), Expect = 4e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 313 atcagacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgg 372 |||| |||||||| ||||||||||||||||| |||||||| || |||||||| || || | Sbjct: 97803 atcacacggtgtaagactgctggatggtctcaatgtcgaggcctttgagcttcacaaccg 97744 Query: 373 actccacgtgccctttgagcgtatgaagctccct 406 | || || ||||| ||||||||||| |||||||| Sbjct: 97743 attctacatgccccttgagcgtatggagctccct 97710
>emb|AJ440001.1|OSA440001 Oryza sativa (japonica cultivar-group) a3 gene for plasma membrane H+ ATPase, exons 1-21 Length = 6072 Score = 81.8 bits (41), Expect = 2e-12 Identities = 77/89 (86%) Strand = Plus / Minus Query: 318 acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 377 |||||||| ||||||||||||||||| |||||||| || |||||||| || || || || Sbjct: 6068 acggtgtaagactgctggatggtctcaatgtcgaggcctttgagcttcacaaccgattct 6009 Query: 378 acgtgccctttgagcgtatgaagctccct 406 || ||||| ||||||||||| |||||||| Sbjct: 6008 acatgccccttgagcgtatggagctccct 5980
>gb|AF029256.2|AF029256 Kosteletzkya virginica KVATP1 plasma membrane proton ATPase (ATP1) mRNA, complete cds Length = 3175 Score = 77.8 bits (39), Expect = 3e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 ||||||||| || |||||||| || ||||| ||||| ||||| ||||| ||||| ||||| Sbjct: 2872 ctgctggatcgtatcgatgtccagccccttcagctttacgacagactcgacgtgaccttt 2813 Query: 389 gagcgtatgaagctc 403 ||||||||||||||| Sbjct: 2812 gagcgtatgaagctc 2798
>gb|AC134344.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0059K16, complete sequence Length = 139615 Score = 75.8 bits (38), Expect = 1e-10 Identities = 77/90 (85%) Strand = Plus / Plus Query: 316 agacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggact 375 ||||||||||| | ||||||||| ||||||||||| |||||||||||||| || |||| Sbjct: 131563 agacggtgtagtggttctggatggtgtcgatgtcgaggcccttgagcttgaccaccgact 131622 Query: 376 ccacgtgccctttgagcgtatgaagctccc 405 | ||||| || |||||||| || ||||||| Sbjct: 131623 cgacgtggcccttgagcgtgtgcagctccc 131652
>gb|AC136224.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0006B22, complete sequence Length = 166052 Score = 75.8 bits (38), Expect = 1e-10 Identities = 77/90 (85%) Strand = Plus / Plus Query: 316 agacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggact 375 ||||||||||| | ||||||||| ||||||||||| |||||||||||||| || |||| Sbjct: 50683 agacggtgtagtggttctggatggtgtcgatgtcgaggcccttgagcttgaccaccgact 50742 Query: 376 ccacgtgccctttgagcgtatgaagctccc 405 | ||||| || |||||||| || ||||||| Sbjct: 50743 cgacgtggcccttgagcgtgtgcagctccc 50772
>emb|AJ440002.1|OSA440002 Oryza sativa (japonica cultivar-group) a4 gene for plasma membrane H+ ATPase, exons 1-12 Length = 3894 Score = 75.8 bits (38), Expect = 1e-10 Identities = 77/90 (85%) Strand = Plus / Minus Query: 316 agacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggact 375 ||||||||||| | ||||||||| ||||||||||| |||||||||||||| || |||| Sbjct: 3892 agacggtgtagtggttctggatggtgtcgatgtcgaggcccttgagcttgaccaccgact 3833 Query: 376 ccacgtgccctttgagcgtatgaagctccc 405 | ||||| || |||||||| || ||||||| Sbjct: 3832 cgacgtggcccttgagcgtgtgcagctccc 3803
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 75.8 bits (38), Expect = 1e-10 Identities = 77/90 (85%) Strand = Plus / Plus Query: 316 agacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggact 375 ||||||||||| | ||||||||| ||||||||||| |||||||||||||| || |||| Sbjct: 14715269 agacggtgtagtggttctggatggtgtcgatgtcgaggcccttgagcttgaccaccgact 14715328 Query: 376 ccacgtgccctttgagcgtatgaagctccc 405 | ||||| || |||||||| || ||||||| Sbjct: 14715329 cgacgtggcccttgagcgtgtgcagctccc 14715358
>dbj|AK100483.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023097B04, full insert sequence Length = 3538 Score = 75.8 bits (38), Expect = 1e-10 Identities = 65/74 (87%) Strand = Plus / Minus Query: 332 ctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgag 391 ||||||||| ||||||||||| |||||||||||||| || ||||| ||||| || ||||| Sbjct: 3135 ctggatggtgtcgatgtcgaggcccttgagcttgaccaccgactcgacgtggcccttgag 3076 Query: 392 cgtatgaagctccc 405 ||| || ||||||| Sbjct: 3075 cgtgtgcagctccc 3062
>dbj|AK099106.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023028O04, full insert sequence Length = 1472 Score = 75.8 bits (38), Expect = 1e-10 Identities = 65/74 (87%) Strand = Plus / Minus Query: 332 ctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgag 391 ||||||||| ||||||||||| |||||||||||||| || ||||| ||||| || ||||| Sbjct: 1187 ctggatggtgtcgatgtcgaggcccttgagcttgaccaccgactcgacgtggcccttgag 1128 Query: 392 cgtatgaagctccc 405 ||| || ||||||| Sbjct: 1127 cgtgtgcagctccc 1114
>dbj|AK069666.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023028O05, full insert sequence Length = 1472 Score = 75.8 bits (38), Expect = 1e-10 Identities = 65/74 (87%) Strand = Plus / Minus Query: 332 ctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgag 391 ||||||||| ||||||||||| |||||||||||||| || ||||| ||||| || ||||| Sbjct: 1187 ctggatggtgtcgatgtcgaggcccttgagcttgaccaccgactcgacgtggcccttgag 1128 Query: 392 cgtatgaagctccc 405 ||| || ||||||| Sbjct: 1127 cgtgtgcagctccc 1114
>gb|AY103963.1| Zea mays PCO106203 mRNA sequence Length = 1358 Score = 73.8 bits (37), Expect = 4e-10 Identities = 40/41 (97%) Strand = Plus / Minus Query: 318 acggtgtaggactgctggatggtctcgatgtcgagaccctt 358 |||||||||||||||||||||||||||||||| |||||||| Sbjct: 971 acggtgtaggactgctggatggtctcgatgtccagaccctt 931
>gb|AF480431.1| Zea mays plasma membrane H+ ATPase-like gene, partial sequence Length = 6539 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Plus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 2510 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 2569 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 2570 gagggtgttgagctccctca 2589
>gb|AF498616.1| Zea mays cultivar C_9 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 408 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 138 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 79 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 78 gagggtgttgagctccctca 59
>gb|AF498615.1| Zea mays cultivar D_9 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctca 64
>gb|AF498614.1| Zea mays cultivar D_6 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctca 64
>gb|AF498613.1| Zea mays cultivar F_1 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctca 64
>gb|AF498612.1| Zea mays cultivar Mo17 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtgaccctt 84 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctca 64
>gb|AF498611.1| Zea mays cultivar D_7 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 410 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 140 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 81 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 80 gagggtgttgagctccctca 61
>gb|AF498610.1| Zea mays cultivar TX601 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 395 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 138 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtgaccctt 79 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 78 gagggtgttgagctccctca 59
>gb|AF498609.1| Zea mays cultivar B84 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctca 64
>gb|AF498608.1| Zea mays cultivar DE811 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctca 64
>gb|AF498607.1| Zea mays cultivar 684 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctca 64
>gb|AF498606.1| Zea mays cultivar D71-4HT plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctca 64
>gb|AF498605.1| Zea mays cultivar H99 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 264 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 140 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 81 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 80 gagggtgttgagctccctca 61
>gb|AF498604.1| Zea mays cultivar IVANA plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 414 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 144 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 85 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 84 gagggtgttgagctccctca 65
>gb|AF498603.1| Zea mays cultivar CO109 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 412 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 142 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 83 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 82 gagggtgttgagctccctca 63
>gb|AF498602.1| Zea mays cultivar I_1 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctca 64
>gb|AF498601.1| Zea mays cultivar B73 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 335 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 141 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 82 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 81 gagggtgttgagctccctca 62
>gb|AF498600.1| Zea mays cultivar F_2 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 411 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 141 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 82 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 81 gagggtgttgagctccctca 62
>gb|AF498599.1| Zea mays cultivar G_1 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 406 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtgaccctt 84 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctca 64
>gb|AF498598.1| Zea mays cultivar B_6 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctca 64
>gb|AF498597.1| Zea mays cultivar H_4 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 412 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 140 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 81 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 80 gagggtgttgagctccctca 61
>gb|AF498596.1| Zea mays cultivar F_4 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctca 64
>gb|AF498595.1| Zea mays cultivar F_3 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 410 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 140 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 81 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 80 gagggtgttgagctccctca 61
>gb|AF498594.1| Zea mays cultivar F_5 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctca 64
>gb|AF498593.1| Zea mays cultivar H_5 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctca 64
>gb|AF498592.1| Zea mays cultivar H_3 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctca 64
>gb|AF498591.1| Zea mays cultivar J40 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 397 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtgaccctt 84 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctca 64
>gb|AF498590.1| Zea mays cultivar 647 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctca 64
>gb|AF498589.1| Zea mays cultivar B_1 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctca 64
>gb|AF498588.1| Zea mays cultivar F_6 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctca 64
>gb|AF498587.1| Zea mays cultivar C_5 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 413 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 83 gagggtgttgagctccctca 64
>gb|AF498586.1| Zea mays cultivar H_1 plasma membrane H+-transporting ATPase-like protein gene, 3'UTR and partial cds Length = 404 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 141 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtgaccctt 82 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 81 gagggtgttgagctccctca 62
>emb|AJ441084.1|ZMA441084 Zea mays partial mRNA for proton-exporting ATPase (mha3 gene) Length = 1259 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 924 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 865 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 864 gagggtgttgagctccctca 845
>ref|XM_468274.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2853 Score = 69.9 bits (35), Expect = 6e-09 Identities = 77/91 (84%) Strand = Plus / Minus Query: 318 acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 377 ||||||||| ||| ||||| || ||||||||||| ||||||||||| || || ||||| Sbjct: 2849 acggtgtagctctgttggattgtgtcgatgtcgagccccttgagcttcaccaccgactct 2790 Query: 378 acgtgccctttgagcgtatgaagctccctca 408 |||||||| |||||||| || | |||||||| Sbjct: 2789 acgtgccccttgagcgtgtgcaactccctca 2759
>emb|AJ440217.1|OSA440217 Oryza sativa a6 gene for plasma membrane H+-ATPase Length = 4058 Score = 69.9 bits (35), Expect = 6e-09 Identities = 77/91 (84%) Strand = Plus / Minus Query: 318 acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 377 ||||||||| ||| ||||| || ||||||||||| ||||||||||| || || ||||| Sbjct: 4054 acggtgtagctctgttggattgtgtcgatgtcgagccccttgagcttcaccaccgactct 3995 Query: 378 acgtgccctttgagcgtatgaagctccctca 408 |||||||| |||||||| || | |||||||| Sbjct: 3994 acgtgccccttgagcgtgtgcaactccctca 3964
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 69.9 bits (35), Expect = 6e-09 Identities = 77/91 (84%) Strand = Plus / Minus Query: 318 acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 377 ||||||||| ||| ||||| || ||||||||||| ||||||||||| || || ||||| Sbjct: 33954341 acggtgtagctctgttggattgtgtcgatgtcgagccccttgagcttcaccaccgactct 33954282 Query: 378 acgtgccctttgagcgtatgaagctccctca 408 |||||||| |||||||| || | |||||||| Sbjct: 33954281 acgtgccccttgagcgtgtgcaactccctca 33954251
>dbj|AP003975.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1004_E04 Length = 133621 Score = 69.9 bits (35), Expect = 6e-09 Identities = 77/91 (84%) Strand = Plus / Minus Query: 318 acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 377 ||||||||| ||| ||||| || ||||||||||| ||||||||||| || || ||||| Sbjct: 113304 acggtgtagctctgttggattgtgtcgatgtcgagccccttgagcttcaccaccgactct 113245 Query: 378 acgtgccctttgagcgtatgaagctccctca 408 |||||||| |||||||| || | |||||||| Sbjct: 113244 acgtgccccttgagcgtgtgcaactccctca 113214
>emb|AJ539534.1|ZMA539534 Zea mays partial mRNA for proton-exporting ATPase (mha4 gene) Length = 1359 Score = 69.9 bits (35), Expect = 6e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 924 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 865 Query: 389 gag 391 ||| Sbjct: 864 gag 862
>gb|AC097277.6| Oryza sativa chromosome 3 BAC OSJNBa0022C08 genomic sequence, complete sequence Length = 150155 Score = 67.9 bits (34), Expect = 2e-08 Identities = 73/86 (84%) Strand = Plus / Plus Query: 321 gtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacg 380 ||||||||||| || ||||| || ||||| || ||||| ||||| || || |||||||| Sbjct: 78620 gtgtaggactggtgaatggtatcaatgtccaggcccttcagcttcacaactgactccaca 78679 Query: 381 tgccctttgagcgtatgaagctccct 406 ||||| || ||||||||||||||||| Sbjct: 78680 tgccccttcagcgtatgaagctccct 78705
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 67.9 bits (34), Expect = 2e-08 Identities = 73/86 (84%) Strand = Plus / Minus Query: 321 gtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacg 380 ||||||||||| || ||||| || ||||| || ||||| ||||| || || |||||||| Sbjct: 27225775 gtgtaggactggtgaatggtatcaatgtccaggcccttcagcttcacaactgactccaca 27225716 Query: 381 tgccctttgagcgtatgaagctccct 406 ||||| || ||||||||||||||||| Sbjct: 27225715 tgccccttcagcgtatgaagctccct 27225690
>gb|AY136627.1| Hordeum vulgare subsp. vulgare plasma membrane P-type proton pump ATPase (Ha1) mRNA, complete cds Length = 3446 Score = 67.9 bits (34), Expect = 2e-08 Identities = 67/78 (85%) Strand = Plus / Minus Query: 335 gatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgagcgt 394 |||||| |||||||| || ||||||||||| || |||||||| |||||||| ||||| || Sbjct: 3031 gatggtgtcgatgtcaaggcccttgagcttcaccacggactcaacgtgccccttgagtgt 2972 Query: 395 atgaagctccctcaacct 412 | |||||||||||||| Sbjct: 2971 gttgagctccctcaacct 2954
>emb|AJ439999.1|OSA439999 Oryza sativa (japonica cultivar-group) a1 gene for plasma membrane H+ ATPase, exons 1-21 Length = 6701 Score = 67.9 bits (34), Expect = 2e-08 Identities = 73/86 (84%) Strand = Plus / Minus Query: 321 gtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacg 380 ||||||||||| || ||||| || ||||| || ||||| ||||| || || |||||||| Sbjct: 6694 gtgtaggactggtgaatggtatcaatgtccaggcccttcagcttcacaactgactccaca 6635 Query: 381 tgccctttgagcgtatgaagctccct 406 ||||| || ||||||||||||||||| Sbjct: 6634 tgccccttcagcgtatgaagctccct 6609
>emb|AJ344078.1|HVU344078 Hordeum vulgare partial mRNA for plasma membrane H+-ATPase (ha1 gene) Length = 2280 Score = 67.9 bits (34), Expect = 2e-08 Identities = 67/78 (85%) Strand = Plus / Minus Query: 335 gatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgagcgt 394 |||||| |||||||| || ||||||||||| || |||||||| |||||||| ||||| || Sbjct: 1888 gatggtgtcgatgtcaaggcccttgagcttcaccacggactcaacgtgccccttgagtgt 1829 Query: 395 atgaagctccctcaacct 412 | |||||||||||||| Sbjct: 1828 gttgagctccctcaacct 1811
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 67.9 bits (34), Expect = 2e-08 Identities = 73/86 (84%) Strand = Plus / Minus Query: 321 gtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacg 380 ||||||||||| || ||||| || ||||| || ||||| ||||| || || |||||||| Sbjct: 27317098 gtgtaggactggtgaatggtatcaatgtccaggcccttcagcttcacaactgactccaca 27317039 Query: 381 tgccctttgagcgtatgaagctccct 406 ||||| || ||||||||||||||||| Sbjct: 27317038 tgccccttcagcgtatgaagctccct 27317013
>dbj|D10207.1|RICOSA1 Oryza sativa OSA1 mRNA for H-ATPase, complete cds Length = 3053 Score = 67.9 bits (34), Expect = 2e-08 Identities = 73/86 (84%) Strand = Plus / Minus Query: 321 gtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacg 380 ||||||||||| || ||||| || ||||| || ||||| ||||| || || |||||||| Sbjct: 2894 gtgtaggactggtgaatggtatcaatgtccaggcccttcagcttcacaactgactccaca 2835 Query: 381 tgccctttgagcgtatgaagctccct 406 ||||| || ||||||||||||||||| Sbjct: 2834 tgccccttcagcgtatgaagctccct 2809
>dbj|AK068765.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013162E15, full insert sequence Length = 3307 Score = 67.9 bits (34), Expect = 2e-08 Identities = 73/86 (84%) Strand = Plus / Minus Query: 321 gtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacg 380 ||||||||||| || ||||| || ||||| || ||||| ||||| || || |||||||| Sbjct: 3143 gtgtaggactggtgaatggtatcaatgtccaggcccttcagcttcacaactgactccaca 3084 Query: 381 tgccctttgagcgtatgaagctccct 406 ||||| || ||||||||||||||||| Sbjct: 3083 tgccccttcagcgtatgaagctccct 3058
>dbj|AK121272.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023107A16, full insert sequence Length = 3134 Score = 63.9 bits (32), Expect = 4e-07 Identities = 65/76 (85%) Strand = Plus / Minus Query: 333 tggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgagc 392 ||||| || ||||||||||| ||||||||||| || || ||||| |||||||| |||||| Sbjct: 2811 tggattgtgtcgatgtcgagccccttgagcttcaccaccgactctacgtgccccttgagc 2752 Query: 393 gtatgaagctccctca 408 || || | |||||||| Sbjct: 2751 gtgtgcaactccctca 2736
>gb|AY109425.1| Zea mays CL1965_1 mRNA sequence Length = 3431 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 ||||||||||| |||||||| || |||||||||||||| || ||||||||||| || || Sbjct: 3046 ctgctggatggggtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 2987 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 2986 gagggtgttgagctccctca 2967
>emb|X85805.1|ZMPMHATP Z.mays mRNA for plasma membrane H+ ATPase Length = 3369 Score = 56.0 bits (28), Expect = 9e-05 Identities = 67/80 (83%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 |||||||||||| |||||||| || ||||||||||| | || ||||||||||| || || Sbjct: 3037 ctgctggatggtgtcgatgtccaggcccttgagcttagccaccgactccacgtggccctt 2978 Query: 389 gagcgtatgaagctccctca 408 ||| || | |||||||||| Sbjct: 2977 gagggtgttgagctccctca 2958
>gb|AY543630.1| Triticum aestivum plasma membrane H+-ATPase (ha1) mRNA, complete cds Length = 2856 Score = 54.0 bits (27), Expect = 4e-04 Identities = 78/95 (82%) Strand = Plus / Minus Query: 318 acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 377 ||||||||| ||| | |||||| |||||||| || ||||||||||| || ||||| || Sbjct: 2852 acggtgtagttctggttgatggtgtcgatgtcaaggcccttgagcttcaccacggattca 2793 Query: 378 acgtgccctttgagcgtatgaagctccctcaacct 412 ||||| || ||||| || | |||||||||||||| Sbjct: 2792 acgtggcccttgagtgtgttgagctccctcaacct 2758
>gb|AY989894.1| Lupinus albus plasma membrane H+ ATPase (LHA3) mRNA, complete cds Length = 3332 Score = 52.0 bits (26), Expect = 0.001 Identities = 65/78 (83%) Strand = Plus / Minus Query: 329 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 388 ||||||||| || || ||||| || ||||| ||||| || || || ||||| |||||||| Sbjct: 3032 ctgctggattgtatcaatgtctagtcccttcagcttcaccactgattccacatgcccttt 2973 Query: 389 gagcgtatgaagctccct 406 || |||||||||||||| Sbjct: 2972 tagagtatgaagctccct 2955
>gb|M60166.1|TOMLHA1 Tomato (L.esculentum) H+-ATPase (LHA1) mRNA, complete cds Length = 3229 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Minus Query: 318 acggtgtaggactgctggatggtctcgatgtcgagaccctt 358 |||||||| |||||||| || ||||| |||||||||||||| Sbjct: 2987 acggtgtatgactgctgaattgtctcaatgtcgagaccctt 2947
>gb|AY829002.2| Triticum aestivum plasma membrane H+-ATPase gene, promoter region and complete cds Length = 6132 Score = 46.1 bits (23), Expect = 0.089 Identities = 77/95 (81%) Strand = Plus / Minus Query: 318 acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 377 ||||||||| ||| | |||||| |||||||| || ||||||||||| || ||||| || Sbjct: 6120 acggtgtagttctggttgatggtgtcgatgtcaaggcccttgagcttcaccacggattca 6061 Query: 378 acgtgccctttgagcgtatgaagctccctcaacct 412 ||||| | ||||| || | |||||||||||||| Sbjct: 6060 acgtggctcttgagtgtgttgagctccctcaacct 6026
>ref|NM_126721.2| Arabidopsis thaliana ATPase AT2G07560 mRNA, complete cds Length = 3332 Score = 46.1 bits (23), Expect = 0.089 Identities = 41/47 (87%) Strand = Plus / Minus Query: 345 atgtcgagacccttgagcttgacgacggactccacgtgccctttgag 391 ||||| |||||||||||||| || || ||||| ||||| |||||||| Sbjct: 2879 atgtcaagacccttgagcttcactaccgactcaacgtggcctttgag 2833
>emb|AL133340.27| Human DNA sequence from clone RP11-204H22 on chromosome 20 Contains part of a novel gene, ESTs, STSs and GSSs, complete sequence Length = 138442 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 48 aagctaaaaatgaaggggggaaa 70 ||||||||||||||||||||||| Sbjct: 107233 aagctaaaaatgaaggggggaaa 107211
>emb|AJ222786.1|HVJ222786 Hordeum vulgare mRNA for H(+)-transporting ATPase-like protein, clone RG135 Length = 350 Score = 46.1 bits (23), Expect = 0.089 Identities = 50/59 (84%) Strand = Plus / Minus Query: 354 cccttgagcttgacgacggactccacgtgccctttgagcgtatgaagctccctcaacct 412 ||||||||||| || |||||||| |||||||| | ||| || | |||||||||||||| Sbjct: 349 cccttgagcttcaccacggactcaacgtgcccctggagtgtgttgagctccctcaacct 291
>gb|AC007662.3| Arabidopsis thaliana chromosome 2 BAC F9A16 genomic sequence, complete sequence Length = 102249 Score = 46.1 bits (23), Expect = 0.089 Identities = 41/47 (87%) Strand = Plus / Minus Query: 345 atgtcgagacccttgagcttgacgacggactccacgtgccctttgag 391 ||||| |||||||||||||| || || ||||| ||||| |||||||| Sbjct: 43890 atgtcaagacccttgagcttcactaccgactcaacgtggcctttgag 43844
>gb|AF384148.1|AF384148 Triticum aestivum H+-ATPase mRNA, partial cds Length = 437 Score = 46.1 bits (23), Expect = 0.089 Identities = 77/95 (81%) Strand = Plus / Minus Query: 318 acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 377 ||||||||| ||| | |||||| |||||||| || ||||||||||| || ||||| || Sbjct: 407 acggtgtagttctggttgatggtgtcgatgtcaaggcccttgagcttcaccacggattca 348 Query: 378 acgtgccctttgagcgtatgaagctccctcaacct 412 ||||| || ||||| || | |||| ||||||||| Sbjct: 347 acgtggcccttgagtgtgttgagcttcctcaacct 313
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 46.1 bits (23), Expect = 0.089 Identities = 29/31 (93%) Strand = Plus / Minus Query: 313 atcagacggtgtaggactgctggatggtctc 343 |||| |||||||| ||||||||||||||||| Sbjct: 4952558 atcacacggtgtatgactgctggatggtctc 4952528
>gb|BT002855.1| Arabidopsis thaliana clone RAFL15-05-H02 (R20351) putative plasma membrane proton ATPase (At2g07560) mRNA, partial cds Length = 1444 Score = 46.1 bits (23), Expect = 0.089 Identities = 41/47 (87%) Strand = Plus / Minus Query: 345 atgtcgagacccttgagcttgacgacggactccacgtgccctttgag 391 ||||| |||||||||||||| || || ||||| ||||| |||||||| Sbjct: 975 atgtcaagacccttgagcttcactaccgactcaacgtggcctttgag 929
>dbj|AP005173.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBb0003E08 Length = 161095 Score = 46.1 bits (23), Expect = 0.089 Identities = 29/31 (93%) Strand = Plus / Minus Query: 313 atcagacggtgtaggactgctggatggtctc 343 |||| |||||||| ||||||||||||||||| Sbjct: 138042 atcacacggtgtatgactgctggatggtctc 138012
>dbj|AK121402.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023131O20, full insert sequence Length = 3388 Score = 46.1 bits (23), Expect = 0.089 Identities = 29/31 (93%) Strand = Plus / Minus Query: 313 atcagacggtgtaggactgctggatggtctc 343 |||| |||||||| ||||||||||||||||| Sbjct: 3006 atcacacggtgtatgactgctggatggtctc 2976
>dbj|AK072909.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023148A19, full insert sequence Length = 2685 Score = 46.1 bits (23), Expect = 0.089 Identities = 29/31 (93%) Strand = Plus / Minus Query: 313 atcagacggtgtaggactgctggatggtctc 343 |||| |||||||| ||||||||||||||||| Sbjct: 2439 atcacacggtgtatgactgctggatggtctc 2409
>dbj|D31843.1|RICOSA2 Oryza sativa (japonica cultivar-group) mRNA for plasma membrane H+-ATPase, complete cds Length = 3264 Score = 46.1 bits (23), Expect = 0.089 Identities = 29/31 (93%) Strand = Plus / Minus Query: 313 atcagacggtgtaggactgctggatggtctc 343 |||| |||||||| ||||||||||||||||| Sbjct: 3005 atcacacggtgtatgactgctggatggtctc 2975
>ref|XM_476966.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2874 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Minus Query: 318 acggtgtaggactgctggatggtctc 343 |||||||| ||||||||||||||||| Sbjct: 2870 acggtgtatgactgctggatggtctc 2845
>emb|AJ440000.1|OSA440000 Oryza sativa (japonica cultivar-group) a2 gene for plasma membrane H+ ATPase, exons 1-21 Length = 5622 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Minus Query: 318 acggtgtaggactgctggatggtctc 343 |||||||| ||||||||||||||||| Sbjct: 5618 acggtgtatgactgctggatggtctc 5593
>dbj|D45189.1|ZMUZHA1 Zostera marina mRNA for putative plasma membrane H+-ATPase, complete cds Length = 3250 Score = 44.1 bits (22), Expect = 0.35 Identities = 52/62 (83%) Strand = Plus / Minus Query: 318 acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 377 ||||||||| |||||||||||| || ||||| ||||| || ||||| || || |||||| Sbjct: 3002 acggtgtagttctgctggatggtttcaatgtcaagacctttaagcttcaccaccgactcc 2943 Query: 378 ac 379 || Sbjct: 2942 ac 2941
>gb|AC117247.4| Mus musculus BAC clone RP24-323L24 from chromosome 5, complete sequence Length = 162677 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 66 ggaaacataatgtacatactg 86 ||||||||||||||||||||| Sbjct: 5493 ggaaacataatgtacatactg 5513
>gb|AC132270.3| Mus musculus BAC clone RP24-338C23 from chromosome 5, complete sequence Length = 145471 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 66 ggaaacataatgtacatactg 86 ||||||||||||||||||||| Sbjct: 8193 ggaaacataatgtacatactg 8173
>gb|AY029190.1| Lilium longiflorum plasma membrane H+ ATPase mRNA, complete cds Length = 3167 Score = 42.1 bits (21), Expect = 1.4 Identities = 45/53 (84%) Strand = Plus / Minus Query: 354 cccttgagcttgacgacggactccacgtgccctttgagcgtatgaagctccct 406 ||||||||||| || || ||||| |||||||| ||||| || || |||||||| Sbjct: 2903 cccttgagcttcacaaccgactcgacgtgccccttgagagtgtggagctccct 2851
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 42.1 bits (21), Expect = 1.4 Identities = 54/65 (83%) Strand = Plus / Plus Query: 314 tcagacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgga 373 ||||||||||||| ||||||| | | || |||||||| ||||||||| ||||| ||| Sbjct: 8607790 tcagacggtgtagtggtgctggacgttgtccatgtcgaggcccttgagcctgacggtgga 8607849 Query: 374 ctcca 378 ||||| Sbjct: 8607850 ctcca 8607854
>dbj|AP005249.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBa0087F21 Length = 187401 Score = 42.1 bits (21), Expect = 1.4 Identities = 54/65 (83%) Strand = Plus / Plus Query: 314 tcagacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgga 373 ||||||||||||| ||||||| | | || |||||||| ||||||||| ||||| ||| Sbjct: 119701 tcagacggtgtagtggtgctggacgttgtccatgtcgaggcccttgagcctgacggtgga 119760 Query: 374 ctcca 378 ||||| Sbjct: 119761 ctcca 119765
>dbj|AP004657.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0031C02 Length = 138843 Score = 42.1 bits (21), Expect = 1.4 Identities = 54/65 (83%) Strand = Plus / Plus Query: 314 tcagacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgga 373 ||||||||||||| ||||||| | | || |||||||| ||||||||| ||||| ||| Sbjct: 137333 tcagacggtgtagtggtgctggacgttgtccatgtcgaggcccttgagcctgacggtgga 137392 Query: 374 ctcca 378 ||||| Sbjct: 137393 ctcca 137397
>dbj|AK108449.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-143-C07, full insert sequence Length = 1439 Score = 42.1 bits (21), Expect = 1.4 Identities = 54/65 (83%) Strand = Plus / Minus Query: 314 tcagacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgga 373 ||||||||||||| ||||||| | | || |||||||| ||||||||| ||||| ||| Sbjct: 1051 tcagacggtgtagtggtgctggacgttgtccatgtcgaggcccttgagcctgacggtgga 992 Query: 374 ctcca 378 ||||| Sbjct: 991 ctcca 987
>ref|NM_125118.2| Arabidopsis thaliana AHA3; ATPase AT5G57350 (AHA3) mRNA, complete cds Length = 3226 Score = 40.1 bits (20), Expect = 5.5 Identities = 56/68 (82%) Strand = Plus / Minus Query: 339 gtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgagcgtatga 398 ||||| ||||| || ||||| ||||| || || ||||| || || ||||| ||||||||| Sbjct: 2875 gtctcaatgtctagtccctttagcttcaccactgactctacatgtcctttaagcgtatga 2816 Query: 399 agctccct 406 || ||||| Sbjct: 2815 agttccct 2808
>gb|AE009036.1| Agrobacterium tumefaciens str. C58 circular chromosome, section 62 of 256 of the complete sequence Length = 10029 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 329 ctgctggatggtctcgatgtcgag 352 |||||||| ||||||||||||||| Sbjct: 8243 ctgctggaaggtctcgatgtcgag 8266
>emb|CR450690.7| Zebrafish DNA sequence from clone CH211-78C14 in linkage group 11, complete sequence Length = 163328 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 53 aaaaatgaaggggggaaaca 72 |||||||||||||||||||| Sbjct: 113061 aaaaatgaaggggggaaaca 113080
>gb|J04737.1|ATHATP Arabidopsis thaliana ATPase gene, complete cds Length = 5646 Score = 40.1 bits (20), Expect = 5.5 Identities = 56/68 (82%) Strand = Plus / Minus Query: 339 gtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgagcgtatga 398 ||||| ||||| || ||||| ||||| || || ||||| || || ||||| ||||||||| Sbjct: 5364 gtctcaatgtctagtccctttagcttcaccactgactctacatgtcctttaagcgtatga 5305 Query: 399 agctccct 406 || ||||| Sbjct: 5304 agttccct 5297
>gb|AY072153.1| Arabidopsis thaliana putative plasma membrane proton pump ATPase 3 (At5g57350) mRNA, complete cds Length = 3185 Score = 40.1 bits (20), Expect = 5.5 Identities = 56/68 (82%) Strand = Plus / Minus Query: 339 gtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgagcgtatga 398 ||||| ||||| || ||||| ||||| || || ||||| || || ||||| ||||||||| Sbjct: 2865 gtctcaatgtctagtccctttagcttcaccactgactctacatgtcctttaagcgtatga 2806 Query: 399 agctccct 406 || ||||| Sbjct: 2805 agttccct 2798
>gb|AC112657.2| Homo sapiens X BAC RP11-647I17 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 116810 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 cacagatccactcttcactc 246 |||||||||||||||||||| Sbjct: 79368 cacagatccactcttcactc 79349
>gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome Length = 2841581 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 329 ctgctggatggtctcgatgtcgag 352 |||||||| ||||||||||||||| Sbjct: 678827 ctgctggaaggtctcgatgtcgag 678850
>gb|AY056780.1| Arabidopsis thaliana AT5g57350/MJB24_16 mRNA, complete cds Length = 3159 Score = 40.1 bits (20), Expect = 5.5 Identities = 56/68 (82%) Strand = Plus / Minus Query: 339 gtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgagcgtatga 398 ||||| ||||| || ||||| ||||| || || ||||| || || ||||| ||||||||| Sbjct: 2875 gtctcaatgtctagtccctttagcttcaccactgactctacatgtcctttaagcgtatga 2816 Query: 399 agctccct 406 || ||||| Sbjct: 2815 agttccct 2808
>gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome Length = 3304561 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 145 caaactgcatcaccagcggg 164 |||||||||||||||||||| Sbjct: 1807036 caaactgcatcaccagcggg 1807055
>emb|BX833784.1|CNS0A208 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL76ZH09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 824 Score = 40.1 bits (20), Expect = 5.5 Identities = 56/68 (82%) Strand = Plus / Minus Query: 339 gtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgagcgtatga 398 ||||| ||||| || ||||| ||||| || || ||||| || || ||||| ||||||||| Sbjct: 519 gtctcaatgtctagtccctttagcttcaccactgactctacatgtcctttaagcgtatga 460 Query: 399 agctccct 406 || ||||| Sbjct: 459 agttccct 452
>dbj|AB019233.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJB24 Length = 58589 Score = 40.1 bits (20), Expect = 5.5 Identities = 56/68 (82%) Strand = Plus / Plus Query: 339 gtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgagcgtatga 398 ||||| ||||| || ||||| ||||| || || ||||| || || ||||| ||||||||| Sbjct: 55268 gtctcaatgtctagtccctttagcttcaccactgactctacatgtcctttaagcgtatga 55327 Query: 399 agctccct 406 || ||||| Sbjct: 55328 agttccct 55335
>dbj|AB042103.1| Asparagus officinalis AoPOX1 mRNA for peroxidase, complete cds Length = 1159 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 343 cgatgtcgagacccttgagcttga 366 |||||||||| ||||||||||||| Sbjct: 556 cgatgtcgaggcccttgagcttga 533
>emb|BX571709.23| Zebrafish DNA sequence from clone DKEY-251M8 in linkage group 11, complete sequence Length = 154382 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 53 aaaaatgaaggggggaaaca 72 |||||||||||||||||||| Sbjct: 111457 aaaaatgaaggggggaaaca 111438 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,375,869 Number of Sequences: 3902068 Number of extensions: 2375869 Number of successful extensions: 36806 Number of sequences better than 10.0: 106 Number of HSP's better than 10.0 without gapping: 106 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 36596 Number of HSP's gapped (non-prelim): 208 length of query: 412 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 390 effective length of database: 17,147,199,772 effective search space: 6687407911080 effective search space used: 6687407911080 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
