>gb|AC154487.2| Mus musculus BAC clone RP24-119I4 from chromosome 14, complete sequence
          Length = 199036

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 168    aaaacttctctacaacagcacaaaat 193
              |||| |||||||||||||||||||||
Sbjct: 137231 aaaaattctctacaacagcacaaaat 137256

>emb|BX323873.9| Zebrafish DNA sequence from clone CH211-133L21 in linkage group 19,
             complete sequence
          Length = 186708

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 30    agaaaaggctaaacaaacatt 50
             |||||||||||||||||||||
Sbjct: 97095 agaaaaggctaaacaaacatt 97115

>gb|AC013244.39| Homo sapiens 12 BAC RP11-60E8 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 119008

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 206   tcttcaaatttctgtatcatt 226
             |||||||||||||||||||||
Sbjct: 78207 tcttcaaatttctgtatcatt 78227

>gb|AC115786.8| Mus musculus chromosome 5, clone RP23-170E15, complete sequence
          Length = 193480

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 148    gaatagtttaggagtgtctt 167
              ||||||||||||||||||||
Sbjct: 114258 gaatagtttaggagtgtctt 114277

>emb|CR751601.8| Zebrafish DNA sequence from clone CH211-162E3 in linkage group 14,
             complete sequence
          Length = 141943

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 6     atgtgttttagcattaagca 25
             ||||||||||||||||||||
Sbjct: 82247 atgtgttttagcattaagca 82228

>gb|AC102819.5| Mus musculus chromosome 8, clone RP23-117H21, complete sequence
          Length = 191116

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 29    cagaaaaggctaaacaaaca 48
             ||||||||||||||||||||
Sbjct: 19535 cagaaaaggctaaacaaaca 19554

>gb|AC117202.2| Mus musculus BAC clone RP23-248L5 from 14, complete sequence
          Length = 209508

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 3      gaaatgtgttttagcattaa 22
              ||||||||||||||||||||
Sbjct: 149862 gaaatgtgttttagcattaa 149843

>gb|CP000300.1| Methanococcoides burtonii DSM 6242, complete genome
          Length = 2575032

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 32     aaaaggctaaacaaacattg 51
              ||||||||||||||||||||
Sbjct: 298106 aaaaggctaaacaaacattg 298125

>emb|BX571981.5| Zebrafish DNA sequence from clone DKEY-31J3 in linkage group 14, complete
              sequence
          Length = 258091

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 6      atgtgttttagcattaagca 25
              ||||||||||||||||||||
Sbjct: 185713 atgtgttttagcattaagca 185732

>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 42     acaaacattgttgcactaaaccaa 65
              |||||| |||||||||||||||||
Sbjct: 622477 acaaaccttgttgcactaaaccaa 622500


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,751,921
Number of Sequences: 3902068
Number of extensions: 2751921
Number of successful extensions: 46682
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 46657
Number of HSP's gapped (non-prelim): 25
length of query: 277
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 255
effective length of database: 17,147,199,772
effective search space: 4372535941860
effective search space used: 4372535941860
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)