Clone Information

BLAST Search Result

Clone Name	rbastl33f03
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	gb\|AY107387.1\| Zea mays PCO149313 mRNA sequence	149	9e-33
2	dbj\|AP008207.1\| Oryza sativa (japonica cultivar-group) genomic D...	145	1e-31
3	dbj\|AP003106.1\| Oryza sativa (japonica cultivar-group) genomic D...	145	1e-31
4	dbj\|AP003371.5\| Oryza sativa (japonica cultivar-group) genomic D...	145	1e-31
5	dbj\|AK105465.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	145	1e-31
6	dbj\|AK101775.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	145	1e-31
7	ref\|NM_191406.1\| Oryza sativa (japonica cultivar-group), predic...	143	5e-31
8	gb\|DP000009.1\| Oryza sativa (japonica cultivar-group) chromosome 3	141	2e-30
9	dbj\|AP008209.1\| Oryza sativa (japonica cultivar-group) genomic D...	141	2e-30
10	gb\|AC137699.1\| Genomic sequence for Oryza sativa, Nipponbare str...	141	2e-30
11	dbj\|AK099791.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	141	2e-30
12	gb\|DQ356247.1\| Cooperia oncophora clone Co4 depsiphilin mRNA, co...	46	0.094
13	gb\|DQ356246.1\| Cooperia oncophora clone Co2 depsiphilin mRNA, co...	46	0.094
14	gb\|AC148919.1\| Gallus gallus BAC clone CH261-43B19 from chromoso...	44	0.37
15	gb\|AC142329.1\| Pan troglodytes BAC clone RP43-25D8 from 11, comp...	42	1.5
16	dbj\|D10511.2\| Homo sapiens MAT gene for mitochondrial acetoacety...	42	1.5
17	emb\|CR753890.27\| Zebrafish DNA sequence from clone CH211-207D8 i...	42	1.5
18	dbj\|AP002433.5\| Homo sapiens genomic DNA, chromosome 11 clone:RP...	42	1.5
19	emb\|CR382130.1\| Yarrowia lipolytica chromosome D of strain CLIB1...	42	1.5
20	emb\|BX914197.15\| Zebrafish DNA sequence from clone DKEYP-81F11 i...	40	5.8
21	emb\|CR788310.10\| Zebrafish DNA sequence from clone DKEY-74F15 in...	40	5.8
22	ref\|XM_810566.1\| Trypanosoma cruzi strain CL Brener mucin TcMUCI...	40	5.8
23	ref\|XM_816612.1\| Trypanosoma cruzi strain CL Brener mucin TcMUCI...	40	5.8
24	ref\|XM_812621.1\| Trypanosoma cruzi strain CL Brener mucin TcMUCI...	40	5.8
25	ref\|XM_810828.1\| Trypanosoma cruzi strain CL Brener mucin TcMUCI...	40	5.8
26	gb\|AC145866.3\| Pan troglodytes BAC clone RP43-21B7 from 7, compl...	40	5.8
27	emb\|CR786580.6\| Human DNA sequence from clone RP11-764K9 on chro...	40	5.8
28	emb\|AL773545.13\| Human DNA sequence from clone RP11-216M21 on ch...	40	5.8
29	emb\|AL772155.6\| Human DNA sequence from clone RP11-149F8 on chro...	40	5.8
30	emb\|AL591479.3\| Human DNA sequence from clone RP11-154P18 on chr...	40	5.8
31	emb\|AL513478.10\| Human DNA sequence from clone RP11-327I22 on ch...	40	5.8
32	gb\|CP000302.1\| Shewanella denitrificans OS217, complete genome	40	5.8
33	emb\|AL354718.10\| Human DNA sequence from clone RP11-187C18 on ch...	40	5.8
34	emb\|AL159159.21\| Human DNA sequence from clone RP11-88J11 on chr...	40	5.8
35	emb\|AL117340.3\|HSBA192P3 Human DNA sequence from clone RP11-192P...	40	5.8
36	emb\|CR391971.7\| Zebrafish DNA sequence from clone CH211-260O6 in...	40	5.8
37	emb\|CR759923.6\| Zebrafish DNA sequence from clone CH211-147L19 i...	40	5.8
38	emb\|AL592220.6\| Human DNA sequence from clone RP11-12P21 on chro...	40	5.8
39	emb\|CR548622.8\| Zebrafish DNA sequence from clone DKEY-189A9 in ...	40	5.8
40	emb\|CR385085.9\| Zebrafish DNA sequence from clone CH211-195A16, ...	40	5.8
41	emb\|CR318610.8\| Zebrafish DNA sequence from clone CH211-14B14 in...	40	5.8
42	emb\|BX530079.19\| Zebrafish DNA sequence from clone DKEY-51A16 in...	40	5.8
43	gb\|AC120338.4\| Homo sapiens X BAC RP11-791N19 (Roswell Park Canc...	40	5.8
44	gb\|AC068305.30\|AC068305 Homo sapiens 12 BAC RP11-557F20 (Roswell...	40	5.8
45	emb\|BX294395.15\| Zebrafish DNA sequence from clone CH211-220B11 ...	40	5.8
46	emb\|BX296526.5\| Zebrafish DNA sequence from clone DKEY-229D2 in ...	40	5.8
47	emb\|AL355000.11\| Human DNA sequence from clone RP11-78N10 on chr...	40	5.8
48	emb\|BX005463.5\| Zebrafish DNA sequence from clone CH211-177H19 i...	40	5.8
49	gb\|AF225898.1\|AF225898 Homo sapiens BAC clone 13d21, complete se...	40	5.8
50	emb\|BX649231.4\| Zebrafish DNA sequence from clone DKEY-225H23 in...	40	5.8
51	emb\|BX005011.6\| Zebrafish DNA sequence from clone CH211-59F19 in...	40	5.8
52	gb\|CP000155.1\| Hahella chejuensis KCTC 2396, complete genome	40	5.8

>gb|AY107387.1| Zea mays PCO149313 mRNA sequence
          Length = 1336

 Score =  149 bits (75), Expect = 9e-33
 Identities = 138/159 (86%)
 Strand = Plus / Minus

                                                                        
Query: 274  acctcaccgccccttggggttcatgatctgtgagaacaccgcgcttggcgtcagcccatc 333
            |||||||||||||||||||||||||||||| ||||| || ||||| ||||||||||||||
Sbjct: 1083 acctcaccgccccttggggttcatgatctgcgagaagacggcgctaggcgtcagcccatc 1024

                                                                        
Query: 334  cgagtcgatgctcgcgacactttggtcacccatgcttaaggaagttgttgtggtcgtcgt 393
            |||||| || |||||||| |||||||| ||||||||||  ||||| || || || || ||
Sbjct: 1023 cgagtctatactcgcgacgctttggtcgcccatgcttatagaagtggtggttgtggtggt 964

                                                   
Query: 394  ggtgcttgaatcaattgatgggtcattgggatccttctt 432
            ||||||||| || || |||||||| || || ||||||||
Sbjct: 963  ggtgcttgactcgatcgatgggtcgttcgggtccttctt 925

to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  145 bits (73), Expect = 1e-31
 Identities = 136/157 (86%)
 Strand = Plus / Minus

                                                                            
Query: 276      ctcaccgccccttggggttcatgatctgtgagaacaccgcgcttggcgtcagcccatccg 335
                ||||||| |||||||||||||||||||||||||| || ||||| || || ||||| || |
Sbjct: 32458055 ctcaccgtcccttggggttcatgatctgtgagaagacagcgctaggagtaagcccgtcgg 32457996

                                                                            
Query: 336      agtcgatgctcgcgacactttggtcacccatgcttaaggaagttgttgtggtcgtcgtgg 395
                |||| ||||| || ||||||||||| |||||||||| ||| || |||||||| || ||||
Sbjct: 32457995 agtctatgctagcaacactttggtcgcccatgcttatggacgtggttgtggttgtagtgg 32457936

                                                     
Query: 396      tgcttgaatcaattgatgggtcattgggatccttctt 432
                ||||||| || || ||||| |||||||||||||||||
Sbjct: 32457935 tgcttgactcgatcgatggatcattgggatccttctt 32457899



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                                
Query: 128      aaatatctaatatgaaacaattctctgacttc 159
                |||||||||||||| ||||| |||||||||||
Sbjct: 32458183 aaatatctaatatggaacaactctctgacttc 32458152

to top

>dbj|AP003106.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0665A11
          Length = 166421

 Score =  145 bits (73), Expect = 1e-31
 Identities = 136/157 (86%)
 Strand = Plus / Minus

                                                                         
Query: 276   ctcaccgccccttggggttcatgatctgtgagaacaccgcgcttggcgtcagcccatccg 335
             ||||||| |||||||||||||||||||||||||| || ||||| || || ||||| || |
Sbjct: 45576 ctcaccgtcccttggggttcatgatctgtgagaagacagcgctaggagtaagcccgtcgg 45517

                                                                         
Query: 336   agtcgatgctcgcgacactttggtcacccatgcttaaggaagttgttgtggtcgtcgtgg 395
             |||| ||||| || ||||||||||| |||||||||| ||| || |||||||| || ||||
Sbjct: 45516 agtctatgctagcaacactttggtcgcccatgcttatggacgtggttgtggttgtagtgg 45457

                                                  
Query: 396   tgcttgaatcaattgatgggtcattgggatccttctt 432
             ||||||| || || ||||| |||||||||||||||||
Sbjct: 45456 tgcttgactcgatcgatggatcattgggatccttctt 45420



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 128   aaatatctaatatgaaacaattctctgacttc 159
             |||||||||||||| ||||| |||||||||||
Sbjct: 45704 aaatatctaatatggaacaactctctgacttc 45673

to top

>dbj|AP003371.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:B1143G03
          Length = 137770

 Score =  145 bits (73), Expect = 1e-31
 Identities = 136/157 (86%)
 Strand = Plus / Minus

                                                                          
Query: 276    ctcaccgccccttggggttcatgatctgtgagaacaccgcgcttggcgtcagcccatccg 335
              ||||||| |||||||||||||||||||||||||| || ||||| || || ||||| || |
Sbjct: 137552 ctcaccgtcccttggggttcatgatctgtgagaagacagcgctaggagtaagcccgtcgg 137493

                                                                          
Query: 336    agtcgatgctcgcgacactttggtcacccatgcttaaggaagttgttgtggtcgtcgtgg 395
              |||| ||||| || ||||||||||| |||||||||| ||| || |||||||| || ||||
Sbjct: 137492 agtctatgctagcaacactttggtcgcccatgcttatggacgtggttgtggttgtagtgg 137433

                                                   
Query: 396    tgcttgaatcaattgatgggtcattgggatccttctt 432
              ||||||| || || ||||| |||||||||||||||||
Sbjct: 137432 tgcttgactcgatcgatggatcattgggatccttctt 137396



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 128    aaatatctaatatgaaacaattctctgacttc 159
              |||||||||||||| ||||| |||||||||||
Sbjct: 137680 aaatatctaatatggaacaactctctgacttc 137649

to top

>dbj|AK105465.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-126-A03, full
            insert sequence
          Length = 1761

 Score =  145 bits (73), Expect = 1e-31
 Identities = 136/157 (86%)
 Strand = Plus / Minus

                                                                        
Query: 276  ctcaccgccccttggggttcatgatctgtgagaacaccgcgcttggcgtcagcccatccg 335
            ||||||| |||||||||||||||||||||||||| || ||||| || || ||||| || |
Sbjct: 1505 ctcaccgtcccttggggttcatgatctgtgagaagacagcgctaggagtaagcccgtcgg 1446

                                                                        
Query: 336  agtcgatgctcgcgacactttggtcacccatgcttaaggaagttgttgtggtcgtcgtgg 395
            |||| ||||| || ||||||||||| |||||||||| ||| || |||||||| || ||||
Sbjct: 1445 agtctatgctagcaacactttggtcgcccatgcttatggacgtggttgtggttgtagtgg 1386

                                                 
Query: 396  tgcttgaatcaattgatgggtcattgggatccttctt 432
            ||||||| || || ||||| |||||||||||||||||
Sbjct: 1385 tgcttgactcgatcgatggatcattgggatccttctt 1349



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 128  aaatatctaatatgaaacaattctctgacttc 159
            |||||||||||||| ||||| |||||||||||
Sbjct: 1633 aaatatctaatatggaacaactctctgacttc 1602

to top

>dbj|AK101775.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033064M23, full
            insert sequence
          Length = 3155

 Score =  145 bits (73), Expect = 1e-31
 Identities = 136/157 (86%)
 Strand = Plus / Minus

                                                                        
Query: 276  ctcaccgccccttggggttcatgatctgtgagaacaccgcgcttggcgtcagcccatccg 335
            ||||||| |||||||||||||||||||||||||| || ||||| || || ||||| || |
Sbjct: 2922 ctcaccgtcccttggggttcatgatctgtgagaagacagcgctaggagtaagcccgtcgg 2863

                                                                        
Query: 336  agtcgatgctcgcgacactttggtcacccatgcttaaggaagttgttgtggtcgtcgtgg 395
            |||| ||||| || ||||||||||| |||||||||| ||| || |||||||| || ||||
Sbjct: 2862 agtctatgctagcaacactttggtcgcccatgcttatggacgtggttgtggttgtagtgg 2803

                                                 
Query: 396  tgcttgaatcaattgatgggtcattgggatccttctt 432
            ||||||| || || ||||| |||||||||||||||||
Sbjct: 2802 tgcttgactcgatcgatggatcattgggatccttctt 2766



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 128  aaatatctaatatgaaacaattctctgacttc 159
            |||||||||||||| ||||| |||||||||||
Sbjct: 3050 aaatatctaatatggaacaactctctgacttc 3019

to top

>ref|NM_191406.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2691

 Score =  143 bits (72), Expect = 5e-31
 Identities = 135/156 (86%)
 Strand = Plus / Minus

                                                                        
Query: 277  tcaccgccccttggggttcatgatctgtgagaacaccgcgcttggcgtcagcccatccga 336
            |||||| |||||||||||||||||||||||||| || ||||| || || ||||| || ||
Sbjct: 2691 tcaccgtcccttggggttcatgatctgtgagaagacagcgctaggagtaagcccgtcgga 2632

                                                                        
Query: 337  gtcgatgctcgcgacactttggtcacccatgcttaaggaagttgttgtggtcgtcgtggt 396
            ||| ||||| || ||||||||||| |||||||||| ||| || |||||||| || |||||
Sbjct: 2631 gtctatgctagcaacactttggtcgcccatgcttatggacgtggttgtggttgtagtggt 2572

                                                
Query: 397  gcttgaatcaattgatgggtcattgggatccttctt 432
            |||||| || || ||||| |||||||||||||||||
Sbjct: 2571 gcttgactcgatcgatggatcattgggatccttctt 2536

to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  141 bits (71), Expect = 2e-30
 Identities = 137/159 (86%)
 Strand = Plus / Minus

                                                                            
Query: 274      acctcaccgccccttggggttcatgatctgtgagaacaccgcgcttggcgtcagcccatc 333
                ||||||||| |||||||||||||||||||| ||||| || || || ||||||||||||||
Sbjct: 12284688 acctcaccgtcccttggggttcatgatctgcgagaagacagcactaggcgtcagcccatc 12284629

                                                                            
Query: 334      cgagtcgatgctcgcgacactttggtcacccatgcttaaggaagttgttgtggtcgtcgt 393
                |||||| || || || ||||| || |||||||||||||  || || ||||| || |||||
Sbjct: 12284628 cgagtcaatacttgcaacactctgctcacccatgcttatcgaggtagttgtcgttgtcgt 12284569

                                                       
Query: 394      ggtgcttgaatcaattgatgggtcattgggatccttctt 432
                ||||||||| || || ||||| |||||||||||||||||
Sbjct: 12284568 ggtgcttgactcgatagatggatcattgggatccttctt 12284530



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                             
Query: 190      caaactcatgaaaatatgctgaatgaata 218
                |||||||||||| ||||||||||||||||
Sbjct: 12284753 caaactcatgaacatatgctgaatgaata 12284725

to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  141 bits (71), Expect = 2e-30
 Identities = 137/159 (86%)
 Strand = Plus / Minus

                                                                            
Query: 274      acctcaccgccccttggggttcatgatctgtgagaacaccgcgcttggcgtcagcccatc 333
                ||||||||| |||||||||||||||||||| ||||| || || || ||||||||||||||
Sbjct: 12281451 acctcaccgtcccttggggttcatgatctgcgagaagacagcactaggcgtcagcccatc 12281392

                                                                            
Query: 334      cgagtcgatgctcgcgacactttggtcacccatgcttaaggaagttgttgtggtcgtcgt 393
                |||||| || || || ||||| || |||||||||||||  || || ||||| || |||||
Sbjct: 12281391 cgagtcaatacttgcaacactctgctcacccatgcttatcgaggtagttgtcgttgtcgt 12281332

                                                       
Query: 394      ggtgcttgaatcaattgatgggtcattgggatccttctt 432
                ||||||||| || || ||||| |||||||||||||||||
Sbjct: 12281331 ggtgcttgactcgatagatggatcattgggatccttctt 12281293



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                             
Query: 190      caaactcatgaaaatatgctgaatgaata 218
                |||||||||||| ||||||||||||||||
Sbjct: 12281516 caaactcatgaacatatgctgaatgaata 12281488

to top

>gb|AC137699.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBb0029K10, from chromosome 3, complete sequence
          Length = 135940

 Score =  141 bits (71), Expect = 2e-30
 Identities = 137/159 (86%)
 Strand = Plus / Minus

                                                                         
Query: 274   acctcaccgccccttggggttcatgatctgtgagaacaccgcgcttggcgtcagcccatc 333
             ||||||||| |||||||||||||||||||| ||||| || || || ||||||||||||||
Sbjct: 54221 acctcaccgtcccttggggttcatgatctgcgagaagacagcactaggcgtcagcccatc 54162

                                                                         
Query: 334   cgagtcgatgctcgcgacactttggtcacccatgcttaaggaagttgttgtggtcgtcgt 393
             |||||| || || || ||||| || |||||||||||||  || || ||||| || |||||
Sbjct: 54161 cgagtcaatacttgcaacactctgctcacccatgcttatcgaggtagttgtcgttgtcgt 54102

                                                    
Query: 394   ggtgcttgaatcaattgatgggtcattgggatccttctt 432
             ||||||||| || || ||||| |||||||||||||||||
Sbjct: 54101 ggtgcttgactcgatagatggatcattgggatccttctt 54063



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 190   caaactcatgaaaatatgctgaatgaata 218
             |||||||||||| ||||||||||||||||
Sbjct: 54286 caaactcatgaacatatgctgaatgaata 54258

to top

>dbj|AK099791.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013097C16, full
            insert sequence
          Length = 3171

 Score =  141 bits (71), Expect = 2e-30
 Identities = 137/159 (86%)
 Strand = Plus / Minus

                                                                        
Query: 274  acctcaccgccccttggggttcatgatctgtgagaacaccgcgcttggcgtcagcccatc 333
            ||||||||| |||||||||||||||||||| ||||| || || || ||||||||||||||
Sbjct: 2927 acctcaccgtcccttggggttcatgatctgcgagaagacagcactaggcgtcagcccatc 2868

                                                                        
Query: 334  cgagtcgatgctcgcgacactttggtcacccatgcttaaggaagttgttgtggtcgtcgt 393
            |||||| || || || ||||| || |||||||||||||  || || ||||| || |||||
Sbjct: 2867 cgagtcaatacttgcaacactctgctcacccatgcttatcgaggtagttgtcgttgtcgt 2808

                                                   
Query: 394  ggtgcttgaatcaattgatgggtcattgggatccttctt 432
            ||||||||| || || ||||| |||||||||||||||||
Sbjct: 2807 ggtgcttgactcgatagatggatcattgggatccttctt 2769



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 190  caaactcatgaaaatatgctgaatgaata 218
            |||||||||||| ||||||||||||||||
Sbjct: 2992 caaactcatgaacatatgctgaatgaata 2964

to top

>gb|DQ356247.1| Cooperia oncophora clone Co4 depsiphilin mRNA, complete cds
          Length = 3565

 Score = 46.1 bits (23), Expect = 0.094
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 374 gaagttgttgtggtcgtcgtggt 396
           |||||||||||||||||||||||
Sbjct: 548 gaagttgttgtggtcgtcgtggt 526

to top

>gb|DQ356246.1| Cooperia oncophora clone Co2 depsiphilin mRNA, complete cds
          Length = 3038

 Score = 46.1 bits (23), Expect = 0.094
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 374 gaagttgttgtggtcgtcgtggt 396
           |||||||||||||||||||||||
Sbjct: 437 gaagttgttgtggtcgtcgtggt 415

to top

>gb|AC148919.1| Gallus gallus BAC clone CH261-43B19 from chromosome unknown, complete
             sequence
          Length = 163278

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 140   tgaaacaattctctgacttcta 161
             ||||||||||||||||||||||
Sbjct: 52897 tgaaacaattctctgacttcta 52876

to top

>gb|AC142329.1| Pan troglodytes BAC clone RP43-25D8 from 11, complete sequence
          Length = 188643

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 186   agcacaaactcatgaaaatat 206
             |||||||||||||||||||||
Sbjct: 60366 agcacaaactcatgaaaatat 60346

to top

>dbj|D10511.2| Homo sapiens MAT gene for mitochondrial acetoacetyl-CoA thiolase,
           complete cds
          Length = 4392

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 186 agcacaaactcatgaaaatat 206
           |||||||||||||||||||||
Sbjct: 627 agcacaaactcatgaaaatat 607

to top

>emb|CR753890.27| Zebrafish DNA sequence from clone CH211-207D8 in linkage group 9,
            complete sequence
          Length = 201771

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 46   ggtacaacaacacatgcaaat 66
            |||||||||||||||||||||
Sbjct: 1138 ggtacaacaacacatgcaaat 1118

to top

>dbj|AP002433.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-144G7, complete
              sequence
          Length = 165164

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 186    agcacaaactcatgaaaatat 206
              |||||||||||||||||||||
Sbjct: 105823 agcacaaactcatgaaaatat 105803

to top

>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 2       tatacggtgtattatacgttg 22
               |||||||||||||||||||||
Sbjct: 3003487 tatacggtgtattatacgttg 3003507

to top

>emb|BX914197.15| Zebrafish DNA sequence from clone DKEYP-81F11 in linkage group 11,
              complete sequence
          Length = 198600

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 197    atgaaaatatgctgaatgaa 216
              ||||||||||||||||||||
Sbjct: 104691 atgaaaatatgctgaatgaa 104710

to top

>emb|CR788310.10| Zebrafish DNA sequence from clone DKEY-74F15 in linkage group 2,
           complete sequence
          Length = 244700

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 54  aacacatgcaaataagcata 73
           ||||||||||||||||||||
Sbjct: 325 aacacatgcaaataagcata 306

to top

>ref|XM_810566.1| Trypanosoma cruzi strain CL Brener mucin TcMUCII
           (Tc00.1047053506939.40) partial mRNA
          Length = 564

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 377 gttgttgtggtcgtcgtggt 396
           ||||||||||||||||||||
Sbjct: 416 gttgttgtggtcgtcgtggt 397

to top

>ref|XM_816612.1| Trypanosoma cruzi strain CL Brener mucin TcMUCII
           (Tc00.1047053508873.150) partial mRNA
          Length = 564

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 377 gttgttgtggtcgtcgtggt 396
           ||||||||||||||||||||
Sbjct: 416 gttgttgtggtcgtcgtggt 397

to top

>ref|XM_812621.1| Trypanosoma cruzi strain CL Brener mucin TcMUCI
           (Tc00.1047053511149.130) partial mRNA
          Length = 387

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 377 gttgttgtggtcgtcgtggt 396
           ||||||||||||||||||||
Sbjct: 227 gttgttgtggtcgtcgtggt 208

to top

>ref|XM_810828.1| Trypanosoma cruzi strain CL Brener mucin TcMUCII
           (Tc00.1047053511099.230) partial mRNA
          Length = 337

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 377 gttgttgtggtcgtcgtggt 396
           ||||||||||||||||||||
Sbjct: 177 gttgttgtggtcgtcgtggt 158

to top

>gb|AC145866.3| Pan troglodytes BAC clone RP43-21B7 from 7, complete sequence
          Length = 189814

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 176   agacagcaagagcacaaactcatg 199
             ||||||||||||||||| ||||||
Sbjct: 91746 agacagcaagagcacaagctcatg 91723

to top

>emb|CR786580.6| Human DNA sequence from clone RP11-764K9 on chromosome 9 Contains two
              novel pseudogenes, a novel gene, a pseudogene similar to
              part of double homeobox, 4 (DUX4), a FSHD region gene 1
              (FRG1) pseudogene and four CpG islands, complete sequence
          Length = 191980

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 353    ctttggtcacccatgcttaa 372
              ||||||||||||||||||||
Sbjct: 173493 ctttggtcacccatgcttaa 173512

to top

>emb|AL773545.13| Human DNA sequence from clone RP11-216M21 on chromosome 9 Contains
             three novel pseudogenes, a pseudogene similar to part of
             meprin A, alpha (PABA peptide hydrolase) (MEP1A), a
             pseudogene similar to part of G protein-coupled receptor
             116 (GPR116), two novel genes, the 5' end of a novel gene
             similar to ankyrin repeat domain 20A (ANKRD20A) and three
             CpG islands, complete sequence
          Length = 165886

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 353   ctttggtcacccatgcttaa 372
             ||||||||||||||||||||
Sbjct: 83941 ctttggtcacccatgcttaa 83922

to top

>emb|AL772155.6| Human DNA sequence from clone RP11-149F8 on chromosome 9 Contains a
             novel gene, two novel pseudogenes, a  pseudogene similar
             to part of myosin V family protein, a tumor suppressor
             deleted in oral cancer-related 1 (DOC-1R) pseudogene, a
             pseudogene similar to part of prostaglandin E receptor 4
             (subtype EP4) (PTGER4) and a CpG island, complete sequence
          Length = 163569

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 353   ctttggtcacccatgcttaa 372
             ||||||||||||||||||||
Sbjct: 31823 ctttggtcacccatgcttaa 31842

to top

>emb|AL591479.3| Human DNA sequence from clone RP11-154P18 on chromosome 9 Contains two
              novel pseudogene, a CDRT15 protein pseudogene, a pseudogene
              similar to part of meprin A, alpha (PABA peptide hydrolase)
              (MEP1A) and two CpG islands, complete sequence
          Length = 178933

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 353    ctttggtcacccatgcttaa 372
              ||||||||||||||||||||
Sbjct: 136879 ctttggtcacccatgcttaa 136860

to top

>emb|AL513478.10| Human DNA sequence from clone RP11-327I22 on chromosome 9 Contains a
              pseudogene similar to part of sorting nexin associated
              golgi protein 1 (SNAG1), the ANKRD20A gene for ankyrin
              repeat domain 20A, five novel genes, a pseudogene similar
              to part of eprin A, alpha (PABA peptide hydrolase) (MEP1A)
              and a CpG island, complete sequence
          Length = 180498

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 353    ctttggtcacccatgcttaa 372
              ||||||||||||||||||||
Sbjct: 170412 ctttggtcacccatgcttaa 170431

to top

>gb|CP000302.1| Shewanella denitrificans OS217, complete genome
          Length = 4545906

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 179     cagcaagagcacaaactcat 198
               ||||||||||||||||||||
Sbjct: 2367821 cagcaagagcacaaactcat 2367802

to top

>emb|AL354718.10| Human DNA sequence from clone RP11-187C18 on chromosome 9 Contains a
              pseudogene similar to part of ribosomal protein L7a
              (RPL7A), three novel genes, three novel pseudogene and two
              CpG islands, complete sequence
          Length = 175271

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 353    ctttggtcacccatgcttaa 372
              ||||||||||||||||||||
Sbjct: 172244 ctttggtcacccatgcttaa 172225

to top

>emb|AL159159.21| Human DNA sequence from clone RP11-88J11 on chromosome 13 Contains the
             3' end of the CDK8 gene for cyclin-dependent kinase 8,
             complete sequence
          Length = 144626

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 186   agcacaaactcatgaaaatatgct 209
             ||||||||| ||||||||||||||
Sbjct: 65285 agcacaaacccatgaaaatatgct 65308

to top

>emb|AL117340.3|HSBA192P3 Human DNA sequence from clone RP11-192P3 on chromosome 10 Contains a
              novel gene, the 5' end of the TCF8 gene for transcription
              factor 8 (represses interleukin 2 expression)
              (BZP,ZEB,ZEB1,AREB6,ZFHEP,NIL-2A,ZFHX1A,NIL-2-A), a
              pseudogene similar to part of serine palmitoyltransferase,
              long chain base subunit 1 (SPTLC1) (HSAN, HSN1, LBC1, LCB1,
              SPT1, SPTI) and two CpG islands, complete sequence
          Length = 187517

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 208    ctgaatgaataagttaggca 227
              ||||||||||||||||||||
Sbjct: 174428 ctgaatgaataagttaggca 174447

to top

>emb|CR391971.7| Zebrafish DNA sequence from clone CH211-260O6 in linkage group 21,
            complete sequence
          Length = 129478

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 197  atgaaaatatgctgaatgaa 216
            ||||||||||||||||||||
Sbjct: 2764 atgaaaatatgctgaatgaa 2745

to top

>emb|CR759923.6| Zebrafish DNA sequence from clone CH211-147L19 in linkage group 21,
             complete sequence
          Length = 147564

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 197   atgaaaatatgctgaatgaa 216
             ||||||||||||||||||||
Sbjct: 41288 atgaaaatatgctgaatgaa 41269

to top

>emb|AL592220.6| Human DNA sequence from clone RP11-12P21 on chromosome 9 Contains a
             tumor suppressor deleted in oral cancer-related 1 (DOC-1R)
             pseudogene, a novel pseudogene and a CpG island, complete
             sequence
          Length = 163556

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 353   ctttggtcacccatgcttaa 372
             ||||||||||||||||||||
Sbjct: 31811 ctttggtcacccatgcttaa 31830

to top

>emb|CR548622.8| Zebrafish DNA sequence from clone DKEY-189A9 in linkage group 11,
             complete sequence
          Length = 137993

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 197   atgaaaatatgctgaatgaa 216
             ||||||||||||||||||||
Sbjct: 16675 atgaaaatatgctgaatgaa 16694

to top

>emb|CR385085.9| Zebrafish DNA sequence from clone CH211-195A16, complete sequence
          Length = 211060

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 197    atgaaaatatgctgaatgaa 216
              ||||||||||||||||||||
Sbjct: 156937 atgaaaatatgctgaatgaa 156956

to top

>emb|CR318610.8| Zebrafish DNA sequence from clone CH211-14B14 in linkage group 5,
              complete sequence
          Length = 164564

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 197    atgaaaatatgctgaatgaa 216
              ||||||||||||||||||||
Sbjct: 152626 atgaaaatatgctgaatgaa 152607

to top

>emb|BX530079.19| Zebrafish DNA sequence from clone DKEY-51A16 in linkage group 13,
              complete sequence
          Length = 166397

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 197    atgaaaatatgctgaatgaa 216
              ||||||||||||||||||||
Sbjct: 141164 atgaaaatatgctgaatgaa 141145

to top

>gb|AC120338.4| Homo sapiens X BAC RP11-791N19 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 109001

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 200   aaaatatgctgaatgaataa 219
             ||||||||||||||||||||
Sbjct: 94435 aaaatatgctgaatgaataa 94454

to top

>gb|AC068305.30|AC068305 Homo sapiens 12 BAC RP11-557F20 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 131811

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 208   ctgaatgaataagttaggca 227
             ||||||||||||||||||||
Sbjct: 54484 ctgaatgaataagttaggca 54503

to top

>emb|BX294395.15| Zebrafish DNA sequence from clone CH211-220B11 in linkage group 5,
             complete sequence
          Length = 213232

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 197   atgaaaatatgctgaatgaa 216
             ||||||||||||||||||||
Sbjct: 65218 atgaaaatatgctgaatgaa 65237

to top

>emb|BX296526.5| Zebrafish DNA sequence from clone DKEY-229D2 in linkage group 5,
             complete sequence
          Length = 179086

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 197   atgaaaatatgctgaatgaa 216
             ||||||||||||||||||||
Sbjct: 19761 atgaaaatatgctgaatgaa 19742

to top

>emb|AL355000.11| Human DNA sequence from clone RP11-78N10 on chromosome 22, complete
             sequence
          Length = 219376

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 353   ctttggtcacccatgcttaa 372
             ||||||||||||||||||||
Sbjct: 90460 ctttggtcacccatgcttaa 90441

to top

>emb|BX005463.5| Zebrafish DNA sequence from clone CH211-177H19 in linkage group 6,
             complete sequence
          Length = 163804

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 197   atgaaaatatgctgaatgaa 216
             ||||||||||||||||||||
Sbjct: 47713 atgaaaatatgctgaatgaa 47694

to top

>gb|AF225898.1|AF225898 Homo sapiens BAC clone 13d21, complete sequence
          Length = 198084

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 208   ctgaatgaataagttaggca 227
             ||||||||||||||||||||
Sbjct: 56841 ctgaatgaataagttaggca 56860

to top

>emb|BX649231.4| Zebrafish DNA sequence from clone DKEY-225H23 in linkage group 20,
             complete sequence
          Length = 153569

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 197   atgaaaatatgctgaatgaa 216
             ||||||||||||||||||||
Sbjct: 62267 atgaaaatatgctgaatgaa 62248

to top

>emb|BX005011.6| Zebrafish DNA sequence from clone CH211-59F19 in linkage group 23,
              complete sequence
          Length = 178148

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 197    atgaaaatatgctgaatgaa 216
              ||||||||||||||||||||
Sbjct: 129196 atgaaaatatgctgaatgaa 129177

to top

>gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome
          Length = 7215267

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 252    agcagacccagatttttacc 271
              ||||||||||||||||||||
Sbjct: 165101 agcagacccagatttttacc 165120


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,478,249
Number of Sequences: 3902068
Number of extensions: 3478249
Number of successful extensions: 65610
Number of sequences better than 10.0: 52
Number of HSP's better than 10.0 without gapping: 52
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 65400
Number of HSP's gapped (non-prelim): 210
length of query: 432
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 410
effective length of database: 17,147,199,772
effective search space: 7030351906520
effective search space used: 7030351906520
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result