>emb|AL645626.10| Mouse DNA sequence from clone RP23-397J5 on chromosome 11 Contains part
             of the Accn1 gene for neuronal amiloride-sensitive cation
             channel 1 (degenerin), a CpG island and a novel gene,
             complete sequence
          Length = 170821

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 14    ccatccattatccatcatct 33
             ||||||||||||||||||||
Sbjct: 78874 ccatccattatccatcatct 78893

>gb|AC174467.2| Medicago truncatula chromosome 7 BAC clone mth2-44j14, complete
             sequence
          Length = 127007

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 16    atccattatccatcatcttt 35
             ||||||||||||||||||||
Sbjct: 22283 atccattatccatcatcttt 22302

>emb|BX324225.7| Zebrafish DNA sequence from clone DKEY-180I22 in linkage group 21,
             complete sequence
          Length = 207125

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 101   aatctccatcaaatacaagc 120
             ||||||||||||||||||||
Sbjct: 84989 aatctccatcaaatacaagc 84970

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 11       caaccatccattatccatca 30
                ||||||||||||||||||||
Sbjct: 25812318 caaccatccattatccatca 25812337

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 11       caaccatccattatccatca 30
                ||||||||||||||||||||
Sbjct: 25740494 caaccatccattatccatca 25740513

>emb|AL928780.5|CNS08CCA Oryza sativa chromosome 12, . BAC OSJNBa0018C20 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 137492

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 11    caaccatccattatccatca 30
             ||||||||||||||||||||
Sbjct: 33769 caaccatccattatccatca 33788

>ref|XM_523625.1| PREDICTED: Pan troglodytes similar to CDC6 homolog; CDC18 (cell
           division cycle 18, S.pombe, homolog)-like; CDC6-related
           protein; CDC6 (cell division cycle 6, S. cerevisiae)
           homolog (LOC468234), mRNA
          Length = 2904

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 42  tgcacgatgtctcaaccaa 60
           |||||||||||||||||||
Sbjct: 696 tgcacgatgtctcaaccaa 714

>gb|AC126800.3| Mus musculus BAC clone RP24-447D19 from chromosome 8, complete sequence
          Length = 171823

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 17    tccattatccatcatcttt 35
             |||||||||||||||||||
Sbjct: 92028 tccattatccatcatcttt 92010

>gb|BC115375.1| Homo sapiens Rap guanine nucleotide exchange factor (GEF)-like 1,
            mRNA (cDNA clone MGC:134799 IMAGE:40028280), complete cds
          Length = 2964

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 42   tgcacgatgtctcaaccaa 60
            |||||||||||||||||||
Sbjct: 1449 tgcacgatgtctcaaccaa 1467

>gb|BC115374.1| Homo sapiens Rap guanine nucleotide exchange factor (GEF)-like 1,
            mRNA (cDNA clone MGC:134798 IMAGE:40028278), complete cds
          Length = 2964

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 42   tgcacgatgtctcaaccaa 60
            |||||||||||||||||||
Sbjct: 1449 tgcacgatgtctcaaccaa 1467

>ref|NM_016339.1| Homo sapiens Rap guanine nucleotide exchange factor (GEF)-like 1
            (RAPGEFL1), mRNA
          Length = 3340

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 42   tgcacgatgtctcaaccaa 60
            |||||||||||||||||||
Sbjct: 1555 tgcacgatgtctcaaccaa 1573

>emb|AL138816.12| Human DNA sequence from clone RP11-235O20 on chromosome 13 Contains the
              3' end of the gene for a novel protein similar to heparan
              sulfate 6-sulfotransferase, complete sequence
          Length = 142420

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 33     tttggggggtgcacgatgt 51
              |||||||||||||||||||
Sbjct: 123766 tttggggggtgcacgatgt 123784

>gb|AC007346.6| Homo sapiens chromosome 16 clone RP11-467J12, complete sequence
          Length = 204130

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 14     ccatccattatccatcatc 32
              |||||||||||||||||||
Sbjct: 166486 ccatccattatccatcatc 166468

>gb|AC007834.40| Homo sapiens 12 BAC RP11-7G5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 210578

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 10    ccaaccatccattatccatcatc 32
             |||||||||||| ||||||||||
Sbjct: 85904 ccaaccatccatcatccatcatc 85926

>emb|CR859477.1| Pongo pygmaeus mRNA; cDNA DKFZp459G2226 (from clone DKFZp459G2226)
          Length = 3292

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 42   tgcacgatgtctcaaccaa 60
            |||||||||||||||||||
Sbjct: 1480 tgcacgatgtctcaaccaa 1498

>gb|AC084741.4| Homo sapiens BAC clone RP11-537K6 from 4, complete sequence
          Length = 146143

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 100   caatctccatcaaatacaa 118
             |||||||||||||||||||
Sbjct: 96634 caatctccatcaaatacaa 96616

>gb|AC026423.9| Homo sapiens chromosome 16 clone CTD-2169M19, complete sequence
          Length = 116130

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 38   ggggtgcacgatgtctcaa 56
            |||||||||||||||||||
Sbjct: 8447 ggggtgcacgatgtctcaa 8465

>gb|AC007906.8| Homo sapiens chromosome 16 clone RP11-295M3, complete sequence
          Length = 183257

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 14     ccatccattatccatcatc 32
              |||||||||||||||||||
Sbjct: 180314 ccatccattatccatcatc 180332

>gb|AC068669.21| Homo sapiens chromosome 17, clone RP11-749I16, complete sequence
          Length = 194780

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 42     tgcacgatgtctcaaccaa 60
              |||||||||||||||||||
Sbjct: 138816 tgcacgatgtctcaaccaa 138834

>gb|AC006531.1|AC006531 Homo sapiens chromosome 16 clone 113K5, complete sequence
          Length = 167525

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 38     ggggtgcacgatgtctcaa 56
              |||||||||||||||||||
Sbjct: 166796 ggggtgcacgatgtctcaa 166814

>gb|AF117946.1|AF117946 Homo sapiens Link guanine nucleotide exchange factor II mRNA,
            complete cds
          Length = 3340

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 42   tgcacgatgtctcaaccaa 60
            |||||||||||||||||||
Sbjct: 1555 tgcacgatgtctcaaccaa 1573

>gb|AC153858.3| Mus musculus 10 BAC RP23-139H21 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 198030

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 111    aaatacaagctgggcaaat 129
              |||||||||||||||||||
Sbjct: 175569 aaatacaagctgggcaaat 175551

>emb|AL844882.9| Mouse DNA sequence from clone RP23-360H15 on chromosome 2, complete
             sequence
          Length = 167978

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 14    ccatccattatccatcatc 32
             |||||||||||||||||||
Sbjct: 40319 ccatccattatccatcatc 40337

>emb|AL604043.11| Mouse DNA sequence from clone RP23-391H8 on chromosome 11, complete
              sequence
          Length = 221374

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 14     ccatccattatccatcatc 32
              |||||||||||||||||||
Sbjct: 166883 ccatccattatccatcatc 166865


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 860,083
Number of Sequences: 3902068
Number of extensions: 860083
Number of successful extensions: 54234
Number of sequences better than 10.0: 24
Number of HSP's better than 10.0 without gapping: 24
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 54178
Number of HSP's gapped (non-prelim): 56
length of query: 165
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 143
effective length of database: 17,147,199,772
effective search space: 2452049567396
effective search space used: 2452049567396
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)