>gb|AC115777.16| Mus musculus chromosome 6, clone RP23-139O6, complete sequence
          Length = 216399

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 214    ttctactgttaggatttctgc 234
              |||||||||||||||||||||
Sbjct: 198188 ttctactgttaggatttctgc 198168

>gb|AC016546.6| Homo sapiens chromosome 5 clone CTC-232H10, complete sequence
          Length = 109918

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 201   gatgtcttcatggttctactg 221
             |||||||||||||||||||||
Sbjct: 67714 gatgtcttcatggttctactg 67694

>gb|AC154003.4| Mus musculus 6 BAC RP24-92L16 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 200703

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 214    ttctactgttaggatttctgc 234
              |||||||||||||||||||||
Sbjct: 114225 ttctactgttaggatttctgc 114245

>gb|AC117629.16| Mus musculus chromosome 19, clone RP23-179C21, complete sequence
          Length = 248718

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 171    tcctagtgaccatttgttaa 190
              ||||||||||||||||||||
Sbjct: 131357 tcctagtgaccatttgttaa 131376

>emb|AL137066.15| Human DNA sequence from clone RP11-10I9 on chromosome 9 Contains the 5'
             end of the gene for a novel protein similar to spermatid
             WD-repeat protein (FLJ90410, FLJ35921), the gene for a
             novel protein similar to B-box and SPRY-domain containing
             protein (BSPRY) (FLJ20150), a novel gene (FLJ39748), a
             novel gene, the ALAD gene for aminolevulinate delta-
             dehydratase (ALADH), the POLE3 gene for the polymerase
             (DNA directed) epsilon 3 (p17 subunit) (p17, YBL1, Ybl1,
             CHRAC17, CHARAC17), the 5' end of the RGS3 gene for the
             regulator of G-protein signalling 3 (C2PA, RGP3, FLJ20370,
             PDZ-RGS3) and six CpG islands, complete sequence
          Length = 137718

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 307   ttgcagaagggagctgaact 326
             ||||||||||||||||||||
Sbjct: 64615 ttgcagaagggagctgaact 64596

>gb|AY319481.1| Homo sapiens aminolevulinate, delta-, dehydratase (ALAD) gene,
            complete cds
          Length = 8809

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 307  ttgcagaagggagctgaact 326
            ||||||||||||||||||||
Sbjct: 3626 ttgcagaagggagctgaact 3645

>gb|AC025265.21| Homo sapiens 12 BAC RP11-341G23 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 180064

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 4      aaaagcatgatacatttgaa 23
              ||||||||||||||||||||
Sbjct: 170811 aaaagcatgatacatttgaa 170830

>dbj|AK042705.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length
          enriched library, clone:A730017I15
          product:unclassifiable, full insert sequence
          Length = 3319

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 7  agcatgatacatttgaaaac 26
          ||||||||||||||||||||
Sbjct: 70 agcatgatacatttgaaaac 51

>emb|AL928981.7| Mouse DNA sequence from clone RP23-54O14 on chromosome 2, complete
             sequence
          Length = 110096

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 316   ggagctgaactcctgctctt 335
             ||||||||||||||||||||
Sbjct: 62046 ggagctgaactcctgctctt 62027

>emb|AL645477.8| Mouse DNA sequence from clone RP23-155L18 on chromosome X, complete
             sequence
          Length = 189131

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 7     agcatgatacatttgaaaac 26
             ||||||||||||||||||||
Sbjct: 79207 agcatgatacatttgaaaac 79188

>emb|X64467.1|HSALADG H.sapiens ALAD gene for porphobilinogen synthase
          Length = 15913

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 307   ttgcagaagggagctgaact 326
             ||||||||||||||||||||
Sbjct: 12117 ttgcagaagggagctgaact 12136


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,634,103
Number of Sequences: 3902068
Number of extensions: 2634103
Number of successful extensions: 44660
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 44648
Number of HSP's gapped (non-prelim): 12
length of query: 337
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 315
effective length of database: 17,147,199,772
effective search space: 5401367928180
effective search space used: 5401367928180
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)