ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl33b11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC068765.16| Homo sapiens 3 BAC RP11-115H18 (Roswell Park Can... 42 0.55
2emb|CR854911.13| Zebrafish DNA sequence from clone DKEY-46O18 in... 40 2.2
3ref|XM_448822.1| Candida glabrata CBS138, CAGL0L01111g partial mRNA 40 2.2
4emb|AL357793.6| Human DNA sequence from clone RP11-98G13 on chro... 40 2.2
5emb|CR380958.1| Candida glabrata strain CBS138 chromosome L comp... 40 2.2
6emb|BX548053.7| Zebrafish DNA sequence from clone DKEY-189G17 in... 40 2.2
7gb|CP000082.1| Psychrobacter arcticus 273-4, complete genome 38 8.6
8gb|AC182813.8| Medicago truncatula clone mth2-69k1, complete seq... 38 8.6
9gb|AC146607.2| Mus musculus BAC clone RP23-209N19 from chromosom... 38 8.6
10emb|CR940310.6| M.truncatula DNA sequence from clone MTH2-5D8 on... 38 8.6
11emb|CR937029.1| M.truncatula DNA sequence from clone MTH2-105B15... 38 8.6
12gb|AC118695.10| Mus musculus chromosome 19, clone RP24-62C10, co... 38 8.6
13gb|AC134322.25| Medicago truncatula clone mth2-17i21, complete s... 38 8.6
14emb|AL592182.6| Human DNA sequence from clone RP11-567C20 on chr... 38 8.6
15emb|AL589740.4| Human DNA sequence from clone RP11-436D23 on chr... 38 8.6
16emb|AL365203.19| Human DNA sequence from clone RP11-479G22 on ch... 38 8.6
17emb|AL354766.17| Human DNA sequence from clone RP11-323C15 on ch... 38 8.6
18emb|AL162293.22| Human DNA sequence from clone RP4-640H8 on chro... 38 8.6
19gb|AC010064.7| Drosophila melanogaster 3L BAC RP98-22I16 (Roswel... 38 8.6
20emb|AL035668.15|HS859D4 Human DNA sequence from clone RP5-859D4 ... 38 8.6
21gb|AC113267.14| Papio anubis clone rp41-174i6, complete sequence 38 8.6
22ref|NM_141004.1| Drosophila melanogaster CG3680-RA (CG3680), mRNA 38 8.6
23dbj|AK160961.1| Mus musculus 15 days embryo head cDNA, RIKEN ful... 38 8.6
24emb|CR378661.1| M.truncatula DNA sequence from clone XX-10B15, c... 38 8.6
25gb|AC016722.9| Homo sapiens BAC clone RP11-333I13 from 2, comple... 38 8.6
26emb|BX004768.5| Zebrafish DNA sequence from clone CH211-15L16, c... 38 8.6
27emb|CR450751.5| Zebrafish DNA sequence from clone DKEY-61P16 in ... 38 8.6
28gb|AE003592.3| Drosophila melanogaster chromosome 3L, section 73... 38 8.6
29gb|AC109258.12| Mus musculus chromosome 18, clone RP23-364K17, c... 38 8.6
30gb|AC154348.1| Mus musculus BAC clone RP24-531G19 from 16, compl... 38 8.6
31emb|AL669834.10| Mouse DNA sequence from clone RP23-114O4 on chr... 38 8.6

>gb|AC068765.16| Homo sapiens 3 BAC RP11-115H18 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 151482

 Score = 42.1 bits (21), Expect = 0.55
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 154   agggtttatgaaatttgcatt 174
             |||||||||||||||||||||
Sbjct: 75954 agggtttatgaaatttgcatt 75974



to top

>emb|CR854911.13| Zebrafish DNA sequence from clone DKEY-46O18 in linkage group 9,
             complete sequence
          Length = 233574

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 75    aaatcaaaatgttctgtaaa 94
             ||||||||||||||||||||
Sbjct: 22256 aaatcaaaatgttctgtaaa 22275



to top

>ref|XM_448822.1| Candida glabrata CBS138, CAGL0L01111g partial mRNA
          Length = 1146

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 93   aacaatacaagaagggtgcattga 116
            |||||||||||||||||| |||||
Sbjct: 1013 aacaatacaagaagggtgaattga 1036



to top

>emb|AL357793.6| Human DNA sequence from clone RP11-98G13 on chromosome 1 Contains a novel
              gene and part of a novel gene, complete sequence
          Length = 145630

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 77     atcaaaatgttctgtaaacaatac 100
              |||||||||||||| |||||||||
Sbjct: 137732 atcaaaatgttctgaaaacaatac 137709



to top

>emb|CR380958.1| Candida glabrata strain CBS138 chromosome L complete sequence
          Length = 1440588

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 93     aacaatacaagaagggtgcattga 116
              |||||||||||||||||| |||||
Sbjct: 132144 aacaatacaagaagggtgaattga 132167



to top

>emb|BX548053.7| Zebrafish DNA sequence from clone DKEY-189G17 in linkage group 9,
             complete sequence
          Length = 210830

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 75    aaatcaaaatgttctgtaaa 94
             ||||||||||||||||||||
Sbjct: 41048 aaatcaaaatgttctgtaaa 41029



to top

>gb|CP000082.1| Psychrobacter arcticus 273-4, complete genome
          Length = 2650701

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 8       caatgcactagaaacctaa 26
               |||||||||||||||||||
Sbjct: 1303931 caatgcactagaaacctaa 1303913



to top

>gb|AC182813.8| Medicago truncatula clone mth2-69k1, complete sequence
          Length = 131049

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 152   ttagggtttatgaaatttg 170
             |||||||||||||||||||
Sbjct: 25715 ttagggtttatgaaatttg 25697



to top

>gb|AC146607.2| Mus musculus BAC clone RP23-209N19 from chromosome 3, complete sequence
          Length = 173758

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                         
Query: 73     acaaatcaaaatgttctgtaaacaata 99
              |||||| ||| ||||||||||||||||
Sbjct: 121730 acaaataaaactgttctgtaaacaata 121756



to top

>emb|CR940310.6| M.truncatula DNA sequence from clone MTH2-5D8 on chromosome 3, complete
             sequence
          Length = 121689

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 152   ttagggtttatgaaatttg 170
             |||||||||||||||||||
Sbjct: 45755 ttagggtttatgaaatttg 45773



to top

>emb|CR937029.1| M.truncatula DNA sequence from clone MTH2-105B15 on chromosome 3,
             complete sequence
          Length = 112155

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 152   ttagggtttatgaaatttg 170
             |||||||||||||||||||
Sbjct: 16168 ttagggtttatgaaatttg 16150



to top

>gb|AC118695.10| Mus musculus chromosome 19, clone RP24-62C10, complete sequence
          Length = 261979

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 69    ctggacaaatcaaaatgttctgt 91
             |||||||| ||||||||||||||
Sbjct: 15726 ctggacaactcaaaatgttctgt 15704



to top

>gb|AC134322.25| Medicago truncatula clone mth2-17i21, complete sequence
          Length = 136954

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 152   ttagggtttatgaaatttg 170
             |||||||||||||||||||
Sbjct: 74401 ttagggtttatgaaatttg 74383



to top

>emb|AL592182.6| Human DNA sequence from clone RP11-567C20 on chromosome 1 Contains the 3'
              end of the ELAVL4 gene for ELAV (embryonic lethal, abnormal
              vision, Drosophila)-like 4 ((Hu antigen D) and two novel
              genes, complete sequence
          Length = 112873

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 135    taaacaatcaactatcctt 153
              |||||||||||||||||||
Sbjct: 108366 taaacaatcaactatcctt 108348



to top

>emb|AL589740.4| Human DNA sequence from clone RP11-436D23 on chromosome 6 Contains part
             of a novel gene, complete sequence
          Length = 187863

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 4     aaaacaatgcactagaaac 22
             |||||||||||||||||||
Sbjct: 60435 aaaacaatgcactagaaac 60453



to top

>emb|AL365203.19| Human DNA sequence from clone RP11-479G22 on chromosome 10 Contains the
             3' end of a novel gene (FLJ13031) (FLJ40349), the ITGB1
             gene for integrin beta 1 (fibronectin receptor beta
             polypeptide antigen CD29 includes MDF2 MSK12), an
             adenylate kinase 3 like 1 (AK3L1) pseudogene, a novel
             gene, the 5' end of a novel gene, a NADH dehydrogenase
             subunit 4L (ND4L) pseudogene, a pseudogene similar to part
             of integrin beta 2 (antigen CD18 (p95) lymphocyte
             function-associated antigen 1; macrophage antigen 1
             (mac-1) beta subunit) (ITGB2) and a CpG island, complete
             sequence
          Length = 197973

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 131   agggtaaacaatcaactat 149
             |||||||||||||||||||
Sbjct: 75214 agggtaaacaatcaactat 75232



to top

>emb|AL354766.17| Human DNA sequence from clone RP11-323C15 on chromosome 20 Contains an
             RPL13 (ribosomal protein L13) pseudogene, a novel gene,
             the 5' end of the EYA2 gene for eyes absent homolog 2
             (Drosophila) and a CpG island, complete sequence
          Length = 111170

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 67    cactggacaaatcaaaatg 85
             |||||||||||||||||||
Sbjct: 96735 cactggacaaatcaaaatg 96753



to top

>emb|AL162293.22| Human DNA sequence from clone RP4-640H8 on chromosome 20 Contains GSSs,
             complete sequence
          Length = 39617

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 152   ttagggtttatgaaatttg 170
             |||||||||||||||||||
Sbjct: 33627 ttagggtttatgaaatttg 33645



to top

>gb|AC010064.7| Drosophila melanogaster 3L BAC RP98-22I16 (Roswell Park Cancer
             Institute Drosophila BAC library) complete sequence
          Length = 199396

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 57    ttgcgggcaacactggaca 75
             |||||||||||||||||||
Sbjct: 42963 ttgcgggcaacactggaca 42945



to top

>emb|AL035668.15|HS859D4 Human DNA sequence from clone RP5-859D4 on chromosome 20p12.1-13
             Contains the BMP2 gene for bone morphogenetic protein 2, a
             novel gene and a CpG island, complete sequence
          Length = 173308

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 76    aatcaaaatgttctgtaaa 94
             |||||||||||||||||||
Sbjct: 84635 aatcaaaatgttctgtaaa 84617



to top

>gb|AC113267.14| Papio anubis clone rp41-174i6, complete sequence
          Length = 154605

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 74    caaatcaaaatgttctgta 92
             |||||||||||||||||||
Sbjct: 23958 caaatcaaaatgttctgta 23940



to top

>ref|NM_141004.1| Drosophila melanogaster CG3680-RA (CG3680), mRNA
          Length = 2913

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 57   ttgcgggcaacactggaca 75
            |||||||||||||||||||
Sbjct: 2270 ttgcgggcaacactggaca 2252



to top

>dbj|AK160961.1| Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched
            library, clone:4022416A05 product:weakly similar to
            BA265F14.5 (Novel protein similar to DNAJ) (Fragment)
            [Homo sapiens], full insert sequence
          Length = 3566

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                       
Query: 73   acaaatcaaaatgttctgtaaacaata 99
            |||||| ||| ||||||||||||||||
Sbjct: 2233 acaaataaaactgttctgtaaacaata 2207



to top

>emb|CR378661.1| M.truncatula DNA sequence from clone XX-10B15, complete sequence
          Length = 112155

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 152   ttagggtttatgaaatttg 170
             |||||||||||||||||||
Sbjct: 16168 ttagggtttatgaaatttg 16150



to top

>gb|AC016722.9| Homo sapiens BAC clone RP11-333I13 from 2, complete sequence
          Length = 149995

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 84     tgttctgtaaacaatacaa 102
              |||||||||||||||||||
Sbjct: 109032 tgttctgtaaacaatacaa 109050



to top

>emb|BX004768.5| Zebrafish DNA sequence from clone CH211-15L16, complete sequence
          Length = 180305

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    aaaatgttctgtaaacaat 98
             |||||||||||||||||||
Sbjct: 73602 aaaatgttctgtaaacaat 73584



to top

>emb|CR450751.5| Zebrafish DNA sequence from clone DKEY-61P16 in linkage group 19,
             complete sequence
          Length = 52141

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 143   caactatccttagggttta 161
             |||||||||||||||||||
Sbjct: 40846 caactatccttagggttta 40864



to top

>gb|AE003592.3| Drosophila melanogaster chromosome 3L, section 73 of 83 of the complete
              sequence
          Length = 323816

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 57     ttgcgggcaacactggaca 75
              |||||||||||||||||||
Sbjct: 183271 ttgcgggcaacactggaca 183253



to top

>gb|AC109258.12| Mus musculus chromosome 18, clone RP23-364K17, complete sequence
          Length = 232399

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 74    caaatcaaaatgttctgta 92
             |||||||||||||||||||
Sbjct: 78329 caaatcaaaatgttctgta 78347



to top

>gb|AC154348.1| Mus musculus BAC clone RP24-531G19 from 16, complete sequence
          Length = 139363

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    aaaatgttctgtaaacaat 98
             |||||||||||||||||||
Sbjct: 92367 aaaatgttctgtaaacaat 92385



to top

>emb|AL669834.10| Mouse DNA sequence from clone RP23-114O4 on chromosome 4, complete
            sequence
          Length = 147248

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 20   aacctaaattgtgattctt 38
            |||||||||||||||||||
Sbjct: 9562 aacctaaattgtgattctt 9580


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,889,061
Number of Sequences: 3902068
Number of extensions: 1889061
Number of successful extensions: 187639
Number of sequences better than 10.0: 31
Number of HSP's better than 10.0 without gapping: 31
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 187524
Number of HSP's gapped (non-prelim): 115
length of query: 176
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 154
effective length of database: 17,147,199,772
effective search space: 2640668764888
effective search space used: 2640668764888
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top