>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 79/91 (86%)
 Strand = Plus / Plus

                                                                            
Query: 285      tagaagacgtccgggttgtagcgcccgggcatggagctgctctgctgggcctgcttcaga 344
                ||||||||||| || ||| || ||||||| |||||| || ||||||| ||||||||||||
Sbjct: 25800318 tagaagacgtcaggattgaagtgcccggggatggagttgttctgctgagcctgcttcaga 25800377

                                               
Query: 345      tgcatctgcagcgcgtagttgttgatctgca 375
                ||||||  |||||| |||||||| |||||||
Sbjct: 25800378 tgcatcgtcagcgcatagttgtttatctgca 25800408

>dbj|AP003523.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0416A11
          Length = 171519

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 79/91 (86%)
 Strand = Plus / Plus

                                                                         
Query: 285   tagaagacgtccgggttgtagcgcccgggcatggagctgctctgctgggcctgcttcaga 344
             ||||||||||| || ||| || ||||||| |||||| || ||||||| ||||||||||||
Sbjct: 82522 tagaagacgtcaggattgaagtgcccggggatggagttgttctgctgagcctgcttcaga 82581

                                            
Query: 345   tgcatctgcagcgcgtagttgttgatctgca 375
             ||||||  |||||| |||||||| |||||||
Sbjct: 82582 tgcatcgtcagcgcatagttgtttatctgca 82612

>dbj|AK073896.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033072G12, full
            insert sequence
          Length = 1456

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 76/88 (86%)
 Strand = Plus / Minus

                                                                        
Query: 285  tagaagacgtccgggttgtagcgcccgggcatggagctgctctgctgggcctgcttcaga 344
            ||||||||||| || ||| || ||||||| |||||| || ||||||| ||||||||||||
Sbjct: 1028 tagaagacgtcaggattgaagtgcccggggatggagttgttctgctgagcctgcttcaga 969

                                        
Query: 345  tgcatctgcagcgcgtagttgttgatct 372
            ||||||  |||||| |||||||| ||||
Sbjct: 968  tgcatcgtcagcgcatagttgtttatct 941

>gb|AY105502.1| Zea mays PCO135520 mRNA sequence
          Length = 835

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 297 gggttgtagcgcccgggcatggagctgctctgctgggcctgcttcagatgcat 349
           |||||| | ||||| || ||||||||||||||||| |||||||| || |||||
Sbjct: 533 gggttgaaacgcccaggaatggagctgctctgctgagcctgcttgaggtgcat 481

>gb|AC147712.17| Medicago truncatula clone mth2-34f1, complete sequence
          Length = 136410

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 182    caacattttctagtcatcttca 203
              ||||||||||||||||||||||
Sbjct: 130219 caacattttctagtcatcttca 130198

>emb|CT009511.9| M.truncatula DNA sequence from clone MTH2-69I7 on chromosome 3,
             complete sequence
          Length = 116999

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 182   caacattttctagtcatcttca 203
             ||||||||||||||||||||||
Sbjct: 13601 caacattttctagtcatcttca 13580

>ref|XM_815877.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053508175.100) partial mRNA
          Length = 1743

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 409  aacagaaaaggatgagcgaat 429
            |||||||||||||||||||||
Sbjct: 1629 aacagaaaaggatgagcgaat 1649

>emb|AL645527.20| Mouse DNA sequence from clone RP23-26L6 on chromosome 11 Contains the
              Vamp2 gene for vesicle-associated membrane 2, the Per1 gene
              for period homolog 1 (Drosophila), the Hes7 gene for hairy
              and enhancer of split 7 (Drosophila), the Aloxe3 gene for
              arachidonate lipoxygenase 3, the Alox12b gene for
              arachidonate 12-lipoxygenase 12R type, the Alox15b gene for
              arachidonate 15-lipoxygenase second type, the Gucy2e gene
              for guanylate cyclase 2e, a novel gene, the gene for
              LYST-interacting protein LIP8 (Lip8-pending), the gene for
              the likely ortholog of H. sapiens trafficking protein
              particle complex 1 (TRAPPC1)), the Kcnab3 gene for
              potassium voltage-gated channel shaker-related subfamily
              beta member 3, a novel gene, the 3' end of the Chd3 gene
              for chromodomain helicase DNA binding protein 3 and six CpG
              islands, complete sequence
          Length = 261224

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 32     attgttttgtgtatatattaa 52
              |||||||||||||||||||||
Sbjct: 139537 attgttttgtgtatatattaa 139517

>emb|BX248391.22| Zebrafish DNA sequence from clone CH211-212M14 in linkage group 17,
              complete sequence
          Length = 202287

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 36     ttttgtgtatatattaaatac 56
              |||||||||||||||||||||
Sbjct: 161433 ttttgtgtatatattaaatac 161453

>emb|BX539349.17| Zebrafish DNA sequence from clone DKEY-74L17 in linkage group 17,
             complete sequence
          Length = 140881

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 36    ttttgtgtatatattaaatac 56
             |||||||||||||||||||||
Sbjct: 59818 ttttgtgtatatattaaatac 59798

>emb|BX510306.17| Zebrafish DNA sequence from clone CH211-195F19 in linkage group 13,
             complete sequence
          Length = 194184

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 183   aacattttctagtcatcttca 203
             |||||||||||||||||||||
Sbjct: 29610 aacattttctagtcatcttca 29590

>gb|AC132949.4| Mus musculus BAC clone RP24-547H18 from chromosome 7, complete sequence
          Length = 206116

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 248   agggccagggctcatcaacat 268
             |||||||||||||||||||||
Sbjct: 76677 agggccagggctcatcaacat 76657

>gb|AC021889.29| Homo sapiens 3 BAC RP11-554F8 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 178752

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 375   aacacaagtagatttttcagt 395
             |||||||||||||||||||||
Sbjct: 64718 aacacaagtagatttttcagt 64698

>ref|XM_391186.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG11010.1)
            partial mRNA
          Length = 3237

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 138  gtcagcaaaccaacatccac 157
            ||||||||||||||||||||
Sbjct: 1612 gtcagcaaaccaacatccac 1631

>ref|XM_814668.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053506825.200) partial mRNA
          Length = 1746

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 410  acagaaaaggatgagcgaat 429
            ||||||||||||||||||||
Sbjct: 1633 acagaaaaggatgagcgaat 1652

>emb|AL356095.11| Human DNA sequence from clone RP11-369J21 on chromosome 10 Contains a
              pseudogene similar to part of homeobox proteins, three
              nuclear DNA binding protein (C1D) pseudogenes, three novel
              genes, a ribosomal protein L22 (RPL22) pseudogene, the 3'
              end of the ANXA11 gene for annexin A11 and two CpG islands,
              complete sequence
          Length = 172079

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 39     tgtgtatatattaaatacga 58
              ||||||||||||||||||||
Sbjct: 124664 tgtgtatatattaaatacga 124683

>gb|AC090133.6| Homo sapiens chromosome 8, clone RP11-813L8, complete sequence
          Length = 201279

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 406   tcaaacagaaaaggatgagc 425
             ||||||||||||||||||||
Sbjct: 88729 tcaaacagaaaaggatgagc 88710

>gb|AC123777.4| Homo sapiens chromosome 8, clone RP11-252C15, complete sequence
          Length = 175943

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 406   tcaaacagaaaaggatgagc 425
             ||||||||||||||||||||
Sbjct: 32007 tcaaacagaaaaggatgagc 31988

>ref|XM_686252.1| PREDICTED: Danio rerio similar to solute carrier family 9 isoform 3
            regulator 2 isoform A (LOC562884), mRNA
          Length = 2649

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 259  tcatcaacatcagcctgaag 278
            ||||||||||||||||||||
Sbjct: 1058 tcatcaacatcagcctgaag 1077

>emb|CR318601.8| Zebrafish DNA sequence from clone CH211-274E20 in linkage group 7,
            complete sequence
          Length = 165501

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 32   attgttttgtgtatatatta 51
            ||||||||||||||||||||
Sbjct: 2986 attgttttgtgtatatatta 2967

>gb|AC138594.10| Mus musculus chromosome 7, clone RP24-283N22, complete sequence
          Length = 167184

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 398   agatgtcatcaaacagaaaa 417
             ||||||||||||||||||||
Sbjct: 53238 agatgtcatcaaacagaaaa 53257


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,383,473
Number of Sequences: 3902068
Number of extensions: 4383473
Number of successful extensions: 91856
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 91798
Number of HSP's gapped (non-prelim): 58
length of query: 441
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 419
effective length of database: 17,147,199,772
effective search space: 7184676704468
effective search space used: 7184676704468
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)