>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  139 bits (70), Expect = 9e-30
 Identities = 118/134 (88%)
 Strand = Plus / Minus

                                                                            
Query: 318      ctacacgttcagaacggggacttgatggggtctggctgcagcgccttcttcacgagctcg 377
                ||||| ||||| || || || ||||| |||||| ||||||| ||||||| ||| ||||||
Sbjct: 19193103 ctacaggttcaaaatggagagttgatagggtctcgctgcagtgccttctgcacaagctcg 19193044

                                                                            
Query: 378      gtttgctcctgcacatggacagtgtagaaacctgtagctgtggctgcagatggggccctt 437
                |||||||||||||||||||| | |||||||||||| || |||||||||||||||||||||
Sbjct: 19193043 gtttgctcctgcacatggacggagtagaaacctgttgcggtggctgcagatggggccctt 19192984

                              
Query: 438      ccgacgtacttgat 451
                || ||||| |||||
Sbjct: 19192983 ccaacgtatttgat 19192970



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 233      gattattcaccaaatggctg 252
                ||||||||||||||||||||
Sbjct: 19193185 gattattcaccaaatggctg 19193166

>dbj|AK098921.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002N21, full
            insert sequence
          Length = 3612

 Score =  139 bits (70), Expect = 9e-30
 Identities = 118/134 (88%)
 Strand = Plus / Minus

                                                                        
Query: 318  ctacacgttcagaacggggacttgatggggtctggctgcagcgccttcttcacgagctcg 377
            ||||| ||||| || || || ||||| |||||| ||||||| ||||||| ||| ||||||
Sbjct: 3333 ctacaggttcaaaatggagagttgatagggtctcgctgcagtgccttctgcacaagctcg 3274

                                                                        
Query: 378  gtttgctcctgcacatggacagtgtagaaacctgtagctgtggctgcagatggggccctt 437
            |||||||||||||||||||| | |||||||||||| || |||||||||||||||||||||
Sbjct: 3273 gtttgctcctgcacatggacggagtagaaacctgttgcggtggctgcagatggggccctt 3214

                          
Query: 438  ccgacgtacttgat 451
            || ||||| |||||
Sbjct: 3213 ccaacgtatttgat 3200



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 233  gattattcaccaaatggctg 252
            ||||||||||||||||||||
Sbjct: 3415 gattattcaccaaatggctg 3396

>dbj|AK067777.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116O03, full
            insert sequence
          Length = 3581

 Score =  139 bits (70), Expect = 9e-30
 Identities = 118/134 (88%)
 Strand = Plus / Minus

                                                                        
Query: 318  ctacacgttcagaacggggacttgatggggtctggctgcagcgccttcttcacgagctcg 377
            ||||| ||||| || || || ||||| |||||| ||||||| ||||||| ||| ||||||
Sbjct: 3379 ctacaggttcaaaatggagagttgatagggtctcgctgcagtgccttctgcacaagctcg 3320

                                                                        
Query: 378  gtttgctcctgcacatggacagtgtagaaacctgtagctgtggctgcagatggggccctt 437
            |||||||||||||||||||| | |||||||||||| || |||||||||||||||||||||
Sbjct: 3319 gtttgctcctgcacatggacggagtagaaacctgttgcggtggctgcagatggggccctt 3260

                          
Query: 438  ccgacgtacttgat 451
            || ||||| |||||
Sbjct: 3259 ccaacgtatttgat 3246



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 233  gattattcaccaaatggctg 252
            ||||||||||||||||||||
Sbjct: 3461 gattattcaccaaatggctg 3442

>dbj|AK060837.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-C11, full
            insert sequence
          Length = 1546

 Score =  139 bits (70), Expect = 9e-30
 Identities = 118/134 (88%)
 Strand = Plus / Minus

                                                                        
Query: 318  ctacacgttcagaacggggacttgatggggtctggctgcagcgccttcttcacgagctcg 377
            ||||| ||||| || || || ||||| |||||| ||||||| ||||||| ||| ||||||
Sbjct: 1314 ctacaggttcaaaatggagagttgatagggtctcgctgcagtgccttctgcacaagctcg 1255

                                                                        
Query: 378  gtttgctcctgcacatggacagtgtagaaacctgtagctgtggctgcagatggggccctt 437
            |||||||||||||||||||| | |||||||||||| || |||||||||||||||||||||
Sbjct: 1254 gtttgctcctgcacatggacggagtagaaacctgttgcggtggctgcagatggggccctt 1195

                          
Query: 438  ccgacgtacttgat 451
            || ||||| |||||
Sbjct: 1194 ccaacgtatttgat 1181



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 233  gattattcaccaaatggctg 252
            ||||||||||||||||||||
Sbjct: 1396 gattattcaccaaatggctg 1377

>emb|AL731599.2|OSJN00244 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0053B21,
              complete sequence
          Length = 151936

 Score =  139 bits (70), Expect = 9e-30
 Identities = 118/134 (88%)
 Strand = Plus / Minus

                                                                          
Query: 318    ctacacgttcagaacggggacttgatggggtctggctgcagcgccttcttcacgagctcg 377
              ||||| ||||| || || || ||||| |||||| ||||||| ||||||| ||| ||||||
Sbjct: 126625 ctacaggttcaaaatggagagttgatagggtctcgctgcagtgccttctgcacaagctcg 126566

                                                                          
Query: 378    gtttgctcctgcacatggacagtgtagaaacctgtagctgtggctgcagatggggccctt 437
              |||||||||||||||||||| | |||||||||||| || |||||||||||||||||||||
Sbjct: 126565 gtttgctcctgcacatggacggagtagaaacctgttgcggtggctgcagatggggccctt 126506

                            
Query: 438    ccgacgtacttgat 451
              || ||||| |||||
Sbjct: 126505 ccaacgtatttgat 126492



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 233    gattattcaccaaatggctg 252
              ||||||||||||||||||||
Sbjct: 126707 gattattcaccaaatggctg 126688

>gb|BT019203.1| Zea mays clone Contig876.F mRNA sequence
          Length = 703

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 105/127 (82%)
 Strand = Plus / Minus

                                                                       
Query: 325 ttcagaacggggacttgatggggtctggctgcagcgccttcttcacgagctcggtttgct 384
           ||||||||||| | |||||||||||  ||||||| ||||| | ||| ||||| || ||||
Sbjct: 468 ttcagaacgggtagttgatggggtcgcgctgcagggccttttgcaccagctccgtctgct 409

                                                                       
Query: 385 cctgcacatggacagtgtagaaacctgtagctgtggctgcagatggggcccttccgacgt 444
           ||||||| || || | |||||| || ||||| || || || || |||||||| |||||||
Sbjct: 408 cctgcacgtgcaccgagtagaagcccgtagcagtagcagccgacggggccctgccgacgt 349

                  
Query: 445 acttgat 451
           |||||||
Sbjct: 348 acttgat 342

>gb|BT018365.1| Zea mays clone EL01N0311E09.c mRNA sequence
          Length = 674

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 105/127 (82%)
 Strand = Plus / Minus

                                                                       
Query: 325 ttcagaacggggacttgatggggtctggctgcagcgccttcttcacgagctcggtttgct 384
           ||||||||||| | |||||||||||  ||||||| ||||| | ||| ||||| || ||||
Sbjct: 470 ttcagaacgggtagttgatggggtcgcgctgcagggccttttgcaccagctccgtctgct 411

                                                                       
Query: 385 cctgcacatggacagtgtagaaacctgtagctgtggctgcagatggggcccttccgacgt 444
           ||||||| || || | |||||| || ||||| || || || || |||||||| |||||||
Sbjct: 410 cctgcacgtgcaccgagtagaagcccgtagcagtagcagccgacggggccctgccgacgt 351

                  
Query: 445 acttgat 451
           |||||||
Sbjct: 350 acttgat 344

>gb|AY103815.1| Zea mays PCO096873 mRNA sequence
          Length = 1431

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 104/127 (81%)
 Strand = Plus / Minus

                                                                        
Query: 325  ttcagaacggggacttgatggggtctggctgcagcgccttcttcacgagctcggtttgct 384
            ||||||| ||| | |||| ||||||  ||||||||||||||| ||| ||||| || ||||
Sbjct: 1130 ttcagaaagggtagttgagggggtcgcgctgcagcgccttctgcaccagctccgtctgct 1071

                                                                        
Query: 385  cctgcacatggacagtgtagaaacctgtagctgtggctgcagatggggcccttccgacgt 444
            ||||||| || || | |||||| || || || || || || || |||||||| |||||||
Sbjct: 1070 cctgcacgtgcaccgagtagaagcccgtcgcggtagcagccgacggggccctgccgacgt 1011

                   
Query: 445  acttgat 451
            |||||||
Sbjct: 1010 acttgat 1004

>gb|BT013018.1| Lycopersicon esculentum clone 114256R, mRNA sequence
          Length = 3457

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 401  gtagaaacctgtagctgtggctgcaga 427
            ||||||||| |||||||||||||||||
Sbjct: 3141 gtagaaaccagtagctgtggctgcaga 3115

>gb|AY491010.1| Leishmania major Hut1L protein (Hut1L) gene, complete cds
          Length = 1732

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 204 taacgcgcgcggtaccacaca 224
           |||||||||||||||||||||
Sbjct: 675 taacgcgcgcggtaccacaca 655

>gb|AC012188.2|F14L17 Sequence of BAC F14L17 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 111686

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 131   acaaaaggatgtagacaaaag 151
             |||||||||||||||||||||
Sbjct: 37480 acaaaaggatgtagacaaaag 37500

>gb|BT018310.1| Zea mays clone EL01T0206H09.c mRNA sequence
          Length = 817

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 339 ttgatggggtctggctgcagcgccttcttcacgagctcggtttgctcctgcacatg 394
           ||||| || |||| |||||| ||||||||||| ||||| |  ||||||||| ||||
Sbjct: 643 ttgatcggctctgcctgcagtgccttcttcactagctctgactgctcctgcgcatg 588

>gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, complete sequence
          Length = 4837408

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 11     cagcagtatggatgtaccgt 30
              ||||||||||||||||||||
Sbjct: 938827 cagcagtatggatgtaccgt 938846

>gb|AC121797.3| Mus musculus BAC clone RP23-424C23 from chromosome 3, complete sequence
          Length = 177109

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 57    tgggtacagttctttattgg 76
             ||||||||||||||||||||
Sbjct: 61035 tgggtacagttctttattgg 61016

>gb|AC087289.9| Homo sapiens chromosome 17, clone RP11-552F3, complete sequence
          Length = 203765

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 415   ctgtggctgcagatggggcc 434
             ||||||||||||||||||||
Sbjct: 32852 ctgtggctgcagatggggcc 32833

>emb|AL590426.6| Human DNA sequence from clone RP11-354K4 on chromosome 6 Contains novel
              pseudogene, complete sequence
          Length = 204235

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 299    tcatggctatgcaaagaacc 318
              ||||||||||||||||||||
Sbjct: 122766 tcatggctatgcaaagaacc 122747

>emb|AL358216.33| Human DNA sequence from clone RP11-809C18 on chromosome 10 Contains two
             novel genes, the gene for a novel protein (FLJ38694
             FLJ38681) and five CpG islands, complete sequence
          Length = 96891

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 417   gtggctgcagatggggccct 436
             ||||||||||||||||||||
Sbjct: 32127 gtggctgcagatggggccct 32146

>emb|AL672262.11| Mouse DNA sequence from clone RP23-318G8 on chromosome 11, complete
             sequence
          Length = 101598

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 241   accaaatggctgtaatttag 260
             ||||||||||||||||||||
Sbjct: 78854 accaaatggctgtaatttag 78835

>emb|CR450779.7| Zebrafish DNA sequence from clone CH211-258C22 in linkage group 5,
              complete sequence
          Length = 179980

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 163    aacaaaattatgcactgaaa 182
              ||||||||||||||||||||
Sbjct: 125048 aacaaaattatgcactgaaa 125029

>dbj|AP007170.1| Aspergillus oryzae RIB40 genomic DNA, SC138
          Length = 504369

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 150    aggcgatgacgggaacaaaa 169
              ||||||||||||||||||||
Sbjct: 431604 aggcgatgacgggaacaaaa 431623

>emb|BX322651.3| Zebrafish DNA sequence from clone DKEYP-32G10, complete sequence
          Length = 152913

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 163   aacaaaattatgcactgaaa 182
             ||||||||||||||||||||
Sbjct: 71960 aacaaaattatgcactgaaa 71979

>dbj|AK130224.1| Homo sapiens cDNA FLJ26714 fis, clone PNC01043
          Length = 1991

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 417 gtggctgcagatggggccct 436
           ||||||||||||||||||||
Sbjct: 910 gtggctgcagatggggccct 891

>gb|AY104202.1| Zea mays PCO125624 mRNA sequence
          Length = 1720

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 339  ttgatggggtctggctgcagcgccttcttcacgagctcggtttgctcctgcacatg 394
            ||||| || |||| |||||| ||||||||||| ||||| |  ||||||||| ||||
Sbjct: 1545 ttgatcggctctgcctgcagtgccttcttcactagctctgactgctcctgcgcatg 1490


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,262,901
Number of Sequences: 3902068
Number of extensions: 4262901
Number of successful extensions: 71568
Number of sequences better than 10.0: 23
Number of HSP's better than 10.0 without gapping: 23
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 71495
Number of HSP's gapped (non-prelim): 73
length of query: 456
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 434
effective length of database: 17,147,199,772
effective search space: 7441884701048
effective search space used: 7441884701048
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)