Clone Name | rbastl33a10 |
---|---|
Clone Library Name | barley_pub |
>emb|AL845440.23| Mouse DNA sequence from clone RP23-294B7 on chromosome 2, complete sequence Length = 188464 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 316 gaaatggcatgctttatttgt 336 ||||||||||||||||||||| Sbjct: 17708 gaaatggcatgctttatttgt 17728
>gb|AC005900.1|AC005900 Homo sapiens chromosome 17, clone hRPK.998_F_8, complete sequence Length = 175066 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 314 ctgaaatggcatgctttattt 334 ||||||||||||||||||||| Sbjct: 123017 ctgaaatggcatgctttattt 122997
>gb|DQ486030.1| Antheraea pernyi nucleopolyhedrovirus, complete genome Length = 126479 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 188 gcgacaattgcaaaatgcca 207 |||||||||||||||||||| Sbjct: 104298 gcgacaattgcaaaatgcca 104279
>gb|AC153123.10| Medicago truncatula clone mte1-72m7, complete sequence Length = 105895 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 13 tatactagttaaaattaaac 32 |||||||||||||||||||| Sbjct: 39717 tatactagttaaaattaaac 39698
>emb|AL359181.28| Human DNA sequence from clone RP11-392N11 on chromosome 9 Contains the 3' end of the PHF2 gene for PHD finger protein 2 (GRC5, KIAA0662), complete sequence Length = 165415 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 149 tctggaatgaggtgatttca 168 |||||||||||||||||||| Sbjct: 86459 tctggaatgaggtgatttca 86478
>emb|AL034561.5|HS692C8 Human DNA sequence from clone RP4-692C8 on chromosome 20p11.22-12.2 Contains GSSs and STSs, complete sequence Length = 125698 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 374 aagcttttcattgagcttgt 393 |||||||||||||||||||| Sbjct: 13191 aagcttttcattgagcttgt 13210
>gb|AC107965.4| Homo sapiens chromosome 8, clone CTD-2332A4, complete sequence Length = 112032 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 318 aatggcatgctttatttgtgagaa 341 ||||| |||||||||||||||||| Sbjct: 17079 aatggtatgctttatttgtgagaa 17102
>gb|AC116422.1| Homo sapiens BAC clone RP11-401G6 from 4, complete sequence Length = 61946 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 160 gtgatttcatgaagaaaatg 179 |||||||||||||||||||| Sbjct: 58677 gtgatttcatgaagaaaatg 58658
>gb|AC021760.9| Homo sapiens chromosome 8, clone RP11-433L7, complete sequence Length = 183059 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 318 aatggcatgctttatttgtgagaa 341 ||||| |||||||||||||||||| Sbjct: 21399 aatggtatgctttatttgtgagaa 21376
>gb|AC008925.4| Homo sapiens chromosome 5 clone CTD-2284O10, complete sequence Length = 131990 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 157 gaggtgatttcatgaagaaa 176 |||||||||||||||||||| Sbjct: 73617 gaggtgatttcatgaagaaa 73636
>gb|AE002098.2| Neisseria meningitidis MC58, complete genome Length = 2272360 Score = 40.1 bits (20), Expect = 5.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 175 aaatgttgcacctgcgacaattgcaaaa 202 ||||||||||| |||||||| ||||||| Sbjct: 1425201 aaatgttgcacttgcgacaactgcaaaa 1425174
>gb|AC006369.3| Homo sapiens BAC clone RP11-278G12 from 2, complete sequence Length = 188359 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 158 aggtgatttcatgaagaaaa 177 |||||||||||||||||||| Sbjct: 43764 aggtgatttcatgaagaaaa 43783
>dbj|AP002783.3| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-664H7, complete sequence Length = 167026 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 162 gatttcatgaagaaaatgttgcac 185 ||||||||||||||||||| |||| Sbjct: 145424 gatttcatgaagaaaatgtggcac 145401 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,013,681 Number of Sequences: 3902068 Number of extensions: 4013681 Number of successful extensions: 68330 Number of sequences better than 10.0: 13 Number of HSP's better than 10.0 without gapping: 13 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 68301 Number of HSP's gapped (non-prelim): 29 length of query: 436 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 414 effective length of database: 17,147,199,772 effective search space: 7098940705608 effective search space used: 7098940705608 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)