ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl33a10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL845440.23| Mouse DNA sequence from clone RP23-294B7 on chr... 42 1.5
2gb|AC005900.1|AC005900 Homo sapiens chromosome 17, clone hRPK.99... 42 1.5
3gb|DQ486030.1| Antheraea pernyi nucleopolyhedrovirus, complete g... 40 5.9
4gb|AC153123.10| Medicago truncatula clone mte1-72m7, complete se... 40 5.9
5emb|AL359181.28| Human DNA sequence from clone RP11-392N11 on ch... 40 5.9
6emb|AL034561.5|HS692C8 Human DNA sequence from clone RP4-692C8 o... 40 5.9
7gb|AC107965.4| Homo sapiens chromosome 8, clone CTD-2332A4, comp... 40 5.9
8gb|AC116422.1| Homo sapiens BAC clone RP11-401G6 from 4, complet... 40 5.9
9gb|AC021760.9| Homo sapiens chromosome 8, clone RP11-433L7, comp... 40 5.9
10gb|AC008925.4| Homo sapiens chromosome 5 clone CTD-2284O10, comp... 40 5.9
11gb|AE002098.2| Neisseria meningitidis MC58, complete genome 40 5.9
12gb|AC006369.3| Homo sapiens BAC clone RP11-278G12 from 2, comple... 40 5.9
13dbj|AP002783.3| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 5.9

>emb|AL845440.23| Mouse DNA sequence from clone RP23-294B7 on chromosome 2, complete
             sequence
          Length = 188464

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 316   gaaatggcatgctttatttgt 336
             |||||||||||||||||||||
Sbjct: 17708 gaaatggcatgctttatttgt 17728



to top

>gb|AC005900.1|AC005900 Homo sapiens chromosome 17, clone hRPK.998_F_8, complete sequence
          Length = 175066

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 314    ctgaaatggcatgctttattt 334
              |||||||||||||||||||||
Sbjct: 123017 ctgaaatggcatgctttattt 122997



to top

>gb|DQ486030.1| Antheraea pernyi nucleopolyhedrovirus, complete genome
          Length = 126479

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 188    gcgacaattgcaaaatgcca 207
              ||||||||||||||||||||
Sbjct: 104298 gcgacaattgcaaaatgcca 104279



to top

>gb|AC153123.10| Medicago truncatula clone mte1-72m7, complete sequence
          Length = 105895

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 13    tatactagttaaaattaaac 32
             ||||||||||||||||||||
Sbjct: 39717 tatactagttaaaattaaac 39698



to top

>emb|AL359181.28| Human DNA sequence from clone RP11-392N11 on chromosome 9 Contains the
             3' end of the PHF2 gene for PHD finger protein 2 (GRC5,
             KIAA0662), complete sequence
          Length = 165415

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 149   tctggaatgaggtgatttca 168
             ||||||||||||||||||||
Sbjct: 86459 tctggaatgaggtgatttca 86478



to top

>emb|AL034561.5|HS692C8 Human DNA sequence from clone RP4-692C8 on chromosome 20p11.22-12.2
             Contains GSSs and STSs, complete sequence
          Length = 125698

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 374   aagcttttcattgagcttgt 393
             ||||||||||||||||||||
Sbjct: 13191 aagcttttcattgagcttgt 13210



to top

>gb|AC107965.4| Homo sapiens chromosome 8, clone CTD-2332A4, complete sequence
          Length = 112032

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 318   aatggcatgctttatttgtgagaa 341
             ||||| ||||||||||||||||||
Sbjct: 17079 aatggtatgctttatttgtgagaa 17102



to top

>gb|AC116422.1| Homo sapiens BAC clone RP11-401G6 from 4, complete sequence
          Length = 61946

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 160   gtgatttcatgaagaaaatg 179
             ||||||||||||||||||||
Sbjct: 58677 gtgatttcatgaagaaaatg 58658



to top

>gb|AC021760.9| Homo sapiens chromosome 8, clone RP11-433L7, complete sequence
          Length = 183059

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 318   aatggcatgctttatttgtgagaa 341
             ||||| ||||||||||||||||||
Sbjct: 21399 aatggtatgctttatttgtgagaa 21376



to top

>gb|AC008925.4| Homo sapiens chromosome 5 clone CTD-2284O10, complete sequence
          Length = 131990

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 157   gaggtgatttcatgaagaaa 176
             ||||||||||||||||||||
Sbjct: 73617 gaggtgatttcatgaagaaa 73636



to top

>gb|AE002098.2| Neisseria meningitidis MC58, complete genome
          Length = 2272360

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 175     aaatgttgcacctgcgacaattgcaaaa 202
               ||||||||||| |||||||| |||||||
Sbjct: 1425201 aaatgttgcacttgcgacaactgcaaaa 1425174



to top

>gb|AC006369.3| Homo sapiens BAC clone RP11-278G12 from 2, complete sequence
          Length = 188359

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 158   aggtgatttcatgaagaaaa 177
             ||||||||||||||||||||
Sbjct: 43764 aggtgatttcatgaagaaaa 43783



to top

>dbj|AP002783.3| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-664H7, complete
              sequence
          Length = 167026

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 162    gatttcatgaagaaaatgttgcac 185
              ||||||||||||||||||| ||||
Sbjct: 145424 gatttcatgaagaaaatgtggcac 145401


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,013,681
Number of Sequences: 3902068
Number of extensions: 4013681
Number of successful extensions: 68330
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 68301
Number of HSP's gapped (non-prelim): 29
length of query: 436
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 414
effective length of database: 17,147,199,772
effective search space: 7098940705608
effective search space used: 7098940705608
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top