ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl33a07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|DP000016.1| Pan troglodytes target 1 genomic scaffold 46 0.11
2gb|AC087512.2| Pan troglodytes clone RP43-144M20, complete sequence 46 0.11
3gb|AC147106.2| Pan troglodytes BAC clone RP43-15F7 from 7, compl... 46 0.11
4gb|AC146205.2| Pan troglodytes BAC clone RP43-34B6 from 7, compl... 46 0.11
5emb|BX927225.7| Zebrafish DNA sequence from clone CH211-106F9 in... 42 1.7
6emb|AL035475.7|PFMAL4P2 Plasmodium falciparum MAL4P2 42 1.7
7gb|AC112649.9| Homo sapiens 3 BAC RP11-65J14 (Roswell Park Cance... 40 6.8
8emb|AL109614.28|HSBA425M5 Human DNA sequence from clone RP11-425... 40 6.8
9emb|AL935257.1| Lactobacillus plantarum strain WCFS1 complete ge... 40 6.8
10emb|AL391069.11| Human DNA sequence from clone RP11-126K1 on chr... 40 6.8
11gb|AC007187.5| Arabidopsis thaliana chromosome 2 clone F7E22 map... 40 6.8
12gb|AY900631.1| Drosophila buzzatii clone BAC 5H14, complete sequ... 40 6.8
13gb|AC154323.3| Mus musculus BAC clone RP23-307K19 from chromosom... 40 6.8
14gb|AC073616.17| Homo sapiens 12 BAC RP3-361K10 (Roswell Park Can... 40 6.8
15gb|AC161614.4| Pan troglodytes BAC clone CH251-575E11 from chrom... 40 6.8
16gb|AC009306.5| Homo sapiens BAC clone RP11-290K24 from 2, comple... 40 6.8
17gb|AC154407.2| Mus musculus BAC clone RP24-257B4 from 14, comple... 40 6.8
18gb|AC146598.4| Mus musculus BAC clone RP24-129K7 from 6, complet... 40 6.8
19emb|BX000990.6| Mouse DNA sequence from clone RP23-128J19 on chr... 40 6.8
20emb|AL672222.11| Mouse DNA sequence from clone RP23-330A15 on ch... 40 6.8
21emb|AL772293.7| Mouse DNA sequence from clone RP23-57D24 on chro... 40 6.8

>gb|DP000016.1| Pan troglodytes target 1 genomic scaffold
          Length = 1623484

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 174    gttacatagactcaaaaacatataaat 200
              |||||||||||| ||||||||||||||
Sbjct: 274055 gttacatagacttaaaaacatataaat 274029



to top

>gb|AC087512.2| Pan troglodytes clone RP43-144M20, complete sequence
          Length = 120797

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 174   gttacatagactcaaaaacatataaat 200
             |||||||||||| ||||||||||||||
Sbjct: 63233 gttacatagacttaaaaacatataaat 63207



to top

>gb|AC147106.2| Pan troglodytes BAC clone RP43-15F7 from 7, complete sequence
          Length = 193107

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 174    gttacatagactcaaaaacatataaat 200
              |||||||||||| ||||||||||||||
Sbjct: 151352 gttacatagacttaaaaacatataaat 151378



to top

>gb|AC146205.2| Pan troglodytes BAC clone RP43-34B6 from 7, complete sequence
          Length = 187725

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 174   gttacatagactcaaaaacatataaat 200
             |||||||||||| ||||||||||||||
Sbjct: 74261 gttacatagacttaaaaacatataaat 74235



to top

>emb|BX927225.7| Zebrafish DNA sequence from clone CH211-106F9 in linkage group 6,
             complete sequence
          Length = 161068

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 172   cagttacatagactcaaaaac 192
             |||||||||||||||||||||
Sbjct: 51898 cagttacatagactcaaaaac 51878



to top

>emb|AL035475.7|PFMAL4P2 Plasmodium falciparum MAL4P2
          Length = 234081

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 186    caaaaacatataaattaatta 206
              |||||||||||||||||||||
Sbjct: 179133 caaaaacatataaattaatta 179153



to top

>gb|AC112649.9| Homo sapiens 3 BAC RP11-65J14 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 70655

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 440   cattggccatctggggacca 459
             ||||||||||||||||||||
Sbjct: 66003 cattggccatctggggacca 65984



to top

>emb|AL109614.28|HSBA425M5 Human DNA sequence from clone RP11-425M5 on chromosome 20 Contains the
              GLRXP gene for glutaredoxin (thioltransferase) pseudogene,
              the PPIAP3 gene for peptidylprolyl isomerase A (cyclophilin
              A) pseudogene 3, the NNAT gene for neuronatin, the BLCAP
              gene for bladder cancer 10 kD protein BC10, a novel gene
              and three CpG islands, complete sequence
          Length = 194433

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 90     aaatacccagagttcttaca 109
              ||||||||||||||||||||
Sbjct: 157260 aaatacccagagttcttaca 157241



to top

>emb|AL935257.1| Lactobacillus plantarum strain WCFS1 complete genome; segment 6/11
          Length = 302050

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 185   tcaaaaacatataaattaattata 208
             ||||||||| ||||||||||||||
Sbjct: 22734 tcaaaaacagataaattaattata 22711



to top

>emb|AL391069.11| Human DNA sequence from clone RP11-126K1 on chromosome 1 Contains the 3'
              end of the PSMD4 gene for proteasome (prosome, macropain)
              26S subunit non-ATPase 4, two novel genes, gene KIAA1441
              (FLJ13043), the PIK4CB genen for phosphatidylinositol
              4-kinase catalytic beta polypeptide, the RFX5 gene for
              regulatory factor X 5 (influences HLA class II expression),
              the SELENBP1 gene for selenium binding protein 1 and two
              CpG islands, complete sequence
          Length = 121357

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 1      gggaaggggagcaaaattgg 20
              ||||||||||||||||||||
Sbjct: 110775 gggaaggggagcaaaattgg 110794



to top

>gb|AC007187.5| Arabidopsis thaliana chromosome 2 clone F7E22 map mi421, complete
             sequence
          Length = 98432

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 181   agactcaaaaacatataaattaat 204
             ||||| ||||||||||||||||||
Sbjct: 15066 agacttaaaaacatataaattaat 15043



to top

>gb|AY900631.1| Drosophila buzzatii clone BAC 5H14, complete sequence
          Length = 124024

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 188   aaaacatataaattaattat 207
             ||||||||||||||||||||
Sbjct: 42065 aaaacatataaattaattat 42046



to top

>gb|AC154323.3| Mus musculus BAC clone RP23-307K19 from chromosome 14, complete
            sequence
          Length = 191902

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 300  tttggtacatttattattca 319
            ||||||||||||||||||||
Sbjct: 4673 tttggtacatttattattca 4654



to top

>gb|AC073616.17| Homo sapiens 12 BAC RP3-361K10 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 128936

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 249   ccacaggtgtggatgtaattacta 272
             |||||| |||||||||||||||||
Sbjct: 64163 ccacagatgtggatgtaattacta 64186



to top

>gb|AC161614.4| Pan troglodytes BAC clone CH251-575E11 from chromosome unknown, complete
              sequence
          Length = 172771

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 1      gggaaggggagcaaaattgg 20
              ||||||||||||||||||||
Sbjct: 111758 gggaaggggagcaaaattgg 111739



to top

>gb|AC009306.5| Homo sapiens BAC clone RP11-290K24 from 2, complete sequence
          Length = 176602

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 189   aaacatataaattaattata 208
             ||||||||||||||||||||
Sbjct: 66327 aaacatataaattaattata 66346



to top

>gb|AC154407.2| Mus musculus BAC clone RP24-257B4 from 14, complete sequence
          Length = 158436

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 300   tttggtacatttattattca 319
             ||||||||||||||||||||
Sbjct: 47934 tttggtacatttattattca 47953



to top

>gb|AC146598.4| Mus musculus BAC clone RP24-129K7 from 6, complete sequence
          Length = 168141

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 378   aaactcccttggatgttcat 397
             ||||||||||||||||||||
Sbjct: 64534 aaactcccttggatgttcat 64515



to top

>emb|BX000990.6| Mouse DNA sequence from clone RP23-128J19 on chromosome X, complete
             sequence
          Length = 19228

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 187   aaaaacatataaattaatta 206
             ||||||||||||||||||||
Sbjct: 19038 aaaaacatataaattaatta 19019



to top

>emb|AL672222.11| Mouse DNA sequence from clone RP23-330A15 on chromosome X, complete
            sequence
          Length = 194025

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 187  aaaaacatataaattaatta 206
            ||||||||||||||||||||
Sbjct: 1810 aaaaacatataaattaatta 1791



to top

>emb|AL772293.7| Mouse DNA sequence from clone RP23-57D24 on chromosome 4, complete
              sequence
          Length = 251930

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 188    aaaacatataaattaattat 207
              ||||||||||||||||||||
Sbjct: 194495 aaaacatataaattaattat 194476


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,353,342
Number of Sequences: 3902068
Number of extensions: 5353342
Number of successful extensions: 108122
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 108064
Number of HSP's gapped (non-prelim): 58
length of query: 501
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 479
effective length of database: 17,147,199,772
effective search space: 8213508690788
effective search space used: 8213508690788
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top