ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl32f01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL441988.11| Human DNA sequence from clone RP11-348I14 on ch... 46 0.11
2emb|AL117574.1|HSM801105 Homo sapiens mRNA; cDNA DKFZp434L2221 (... 46 0.11
3gb|AC147179.15| Medicago truncatula clone mth2-142n19, complete ... 42 1.7
4gb|AC116618.4| Homo sapiens BAC clone RP11-98L17 from 4, complet... 42 1.7
5gb|AY013285.1| Meloidogyne artiellia chitin synthase gene, compl... 42 1.7
6gb|AY873792.1| Popillia japonica iridescent virus ribonucleoside... 42 1.7
7gb|AY873791.1| Iridovirus IV31 ribonucleoside-diphosphate reduct... 42 1.7
8gb|AC126244.3| Mus musculus BAC clone RP24-319A6 from chromosome... 40 6.6
9emb|CR759903.8| Zebrafish DNA sequence from clone CH211-138E6 in... 40 6.6
10emb|AL138849.12| Human DNA sequence from clone RP5-965L7 on chro... 40 6.6
11gb|AC103018.7| Rattus norvegicus 1 CH230-196F22 (Children's Hosp... 40 6.6
12gb|AC007493.7| Homo sapiens chromosome 16 clone RP11-21B23, comp... 40 6.6
13gb|AC105225.5| Homo sapiens chromosome 8, clone RP11-775E18, com... 40 6.6
14gb|AC084702.4| Homo sapiens chromosome 18, clone RP11-1133K3, co... 40 6.6
15emb|BX248080.21| Zebrafish DNA sequence from clone CH211-226C1 i... 40 6.6
16gb|AC157822.2| Mus musculus BAC clone RP23-392J15 from chromosom... 40 6.6
17gb|AC015599.5|AC015599 Homo sapiens chromosome , clone RP11-45B1... 40 6.6
18emb|AL954845.21| Zebrafish DNA sequence from clone DKEY-30H3, co... 40 6.6
19gb|AC021049.12| Homo sapiens 12 BAC RP11-904M10 (Roswell Park Ca... 40 6.6
20gb|AC135075.5| Homo sapiens chromosome 8, clone RP11-557G24, com... 40 6.6
21emb|AL928901.8| Zebrafish DNA sequence from clone CH211-155M12 i... 40 6.6
22emb|AL450399.16| Mouse DNA sequence from clone RP23-286I5 on chr... 40 6.6

>emb|AL441988.11| Human DNA sequence from clone RP11-348I14 on chromosome 20 Contains the
             5' end of a novel gene, the C20orf80 gene for a protein
             similar to FSHD region gene 1 (FRG1), the MLLT10L gene for
             myeloid/lymphoid or mixed-lineage leukemia (trithorax
             homolog, Drosophila) (translocated to 10)-like pseudogene,
             a novel gene and two CpG islands, complete sequence
          Length = 69918

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 417   aagtattttacaattttacactactat 443
             |||||||||| ||||||||||||||||
Sbjct: 32018 aagtattttataattttacactactat 32044



to top

>emb|AL117574.1|HSM801105 Homo sapiens mRNA; cDNA DKFZp434L2221 (from clone DKFZp434L2221)
          Length = 3004

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 417  aagtattttacaattttacactactat 443
            |||||||||| ||||||||||||||||
Sbjct: 1666 aagtattttataattttacactactat 1692



to top

>gb|AC147179.15| Medicago truncatula clone mth2-142n19, complete sequence
          Length = 113361

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 266   aaactcaagggttgcatgtca 286
             |||||||||||||||||||||
Sbjct: 53048 aaactcaagggttgcatgtca 53068



to top

>gb|AC116618.4| Homo sapiens BAC clone RP11-98L17 from 4, complete sequence
          Length = 153040

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 417    aagtattttacaattttacactact 441
              |||||||||| ||||||||||||||
Sbjct: 117813 aagtattttataattttacactact 117837



to top

>gb|AY013285.1| Meloidogyne artiellia chitin synthase gene, complete cds
          Length = 11155

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 184   gcagaggaagggaacaagaaa 204
             |||||||||||||||||||||
Sbjct: 10531 gcagaggaagggaacaagaaa 10551



to top

>gb|AY873792.1| Popillia japonica iridescent virus ribonucleoside-diphosphate
           reductase large chain gene, partial cds
          Length = 677

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 57  tgaaagatgcaccaaagaaaa 77
           |||||||||||||||||||||
Sbjct: 225 tgaaagatgcaccaaagaaaa 245



to top

>gb|AY873791.1| Iridovirus IV31 ribonucleoside-diphosphate reductase large chain
           gene, partial cds
          Length = 595

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 57  tgaaagatgcaccaaagaaaa 77
           |||||||||||||||||||||
Sbjct: 156 tgaaagatgcaccaaagaaaa 176



to top

>gb|AC126244.3| Mus musculus BAC clone RP24-319A6 from chromosome 12, complete sequence
          Length = 175549

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 359   tagggcacacaccatggcaa 378
             ||||||||||||||||||||
Sbjct: 82963 tagggcacacaccatggcaa 82982



to top

>emb|CR759903.8| Zebrafish DNA sequence from clone CH211-138E6 in linkage group 9,
             complete sequence
          Length = 168689

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 386   gcaagttactcatgctccat 405
             ||||||||||||||||||||
Sbjct: 97112 gcaagttactcatgctccat 97131



to top

>emb|AL138849.12| Human DNA sequence from clone RP5-965L7 on chromosome 1p32.1-33
             Contains the 3' ends of genes FLJ34719 and KIAA0191,
             complete sequence
          Length = 127006

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 69    caaagaaaataacagcaaca 88
             ||||||||||||||||||||
Sbjct: 23605 caaagaaaataacagcaaca 23624



to top

>gb|AC103018.7| Rattus norvegicus 1 CH230-196F22 (Children's Hospital Oakland Research
             Institute) complete sequence
          Length = 212568

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 383   agagcaagttactcatgctc 402
             ||||||||||||||||||||
Sbjct: 85130 agagcaagttactcatgctc 85111



to top

>gb|AC007493.7| Homo sapiens chromosome 16 clone RP11-21B23, complete sequence
          Length = 155461

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 70     aaagaaaataacagcaacatcttg 93
              |||||||| |||||||||||||||
Sbjct: 123532 aaagaaaaaaacagcaacatcttg 123509



to top

>gb|AC105225.5| Homo sapiens chromosome 8, clone RP11-775E18, complete sequence
          Length = 135609

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 67    accaaagaaaataacagcaa 86
             ||||||||||||||||||||
Sbjct: 30224 accaaagaaaataacagcaa 30205



to top

>gb|AC084702.4| Homo sapiens chromosome 18, clone RP11-1133K3, complete sequence
          Length = 141820

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 72    agaaaataacagcaacatct 91
             ||||||||||||||||||||
Sbjct: 84404 agaaaataacagcaacatct 84423



to top

>emb|BX248080.21| Zebrafish DNA sequence from clone CH211-226C1 in linkage group 5,
             complete sequence
          Length = 188075

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 405   tcactaaaacacaagtattttaca 428
             |||||||||||||||| |||||||
Sbjct: 11304 tcactaaaacacaagtcttttaca 11327



to top

>gb|AC157822.2| Mus musculus BAC clone RP23-392J15 from chromosome 12, complete
             sequence
          Length = 185536

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 359   tagggcacacaccatggcaa 378
             ||||||||||||||||||||
Sbjct: 63591 tagggcacacaccatggcaa 63610



to top

>gb|AC015599.5|AC015599 Homo sapiens chromosome , clone RP11-45B19, complete sequence
          Length = 162607

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 67    accaaagaaaataacagcaa 86
             ||||||||||||||||||||
Sbjct: 10133 accaaagaaaataacagcaa 10114



to top

>emb|AL954845.21| Zebrafish DNA sequence from clone DKEY-30H3, complete sequence
          Length = 226343

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 386    gcaagttactcatgctccat 405
              ||||||||||||||||||||
Sbjct: 167683 gcaagttactcatgctccat 167702



to top

>gb|AC021049.12| Homo sapiens 12 BAC RP11-904M10 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 175315

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 425    tacaattttacactactatt 444
              ||||||||||||||||||||
Sbjct: 113945 tacaattttacactactatt 113964



to top

>gb|AC135075.5| Homo sapiens chromosome 8, clone RP11-557G24, complete sequence
          Length = 72016

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 67    accaaagaaaataacagcaa 86
             ||||||||||||||||||||
Sbjct: 42631 accaaagaaaataacagcaa 42612



to top

>emb|AL928901.8| Zebrafish DNA sequence from clone CH211-155M12 in linkage group 5,
             complete sequence
          Length = 145957

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 405   tcactaaaacacaagtattttaca 428
             |||||||||||||||| |||||||
Sbjct: 56357 tcactaaaacacaagtcttttaca 56380



to top

>emb|AL450399.16| Mouse DNA sequence from clone RP23-286I5 on chromosome X, complete
              sequence
          Length = 207922

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 69     caaagaaaataacagcaaca 88
              ||||||||||||||||||||
Sbjct: 114258 caaagaaaataacagcaaca 114277


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,197,330
Number of Sequences: 3902068
Number of extensions: 5197330
Number of successful extensions: 112306
Number of sequences better than 10.0: 22
Number of HSP's better than 10.0 without gapping: 22
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 112256
Number of HSP's gapped (non-prelim): 50
length of query: 486
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 464
effective length of database: 17,147,199,772
effective search space: 7956300694208
effective search space used: 7956300694208
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top