ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl32c09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC131800.4| Mus musculus BAC clone RP24-535O17 from chromosom... 42 1.5
2gb|AC127416.7| Mus musculus BAC clone RP23-457J22 from chromosom... 42 1.5
3gb|AC158392.2| Mus musculus BAC clone RP24-87B5 from chromosome ... 42 1.5
4gb|AC113318.8| Mus musculus chromosome 3, clone RP23-442I7, comp... 42 1.5
5gb|AC160547.6| Mus musculus chromosome 8, clone RP23-240F23, com... 42 1.5
6gb|AC161816.5| Mus musculus BAC clone RP23-308L3 from chromosome... 42 1.5
7emb|AL954353.14| Mouse DNA sequence from clone RP23-156D8 on chr... 42 1.5
8gb|CP000236.1| Ehrlichia chaffeensis str. Arkansas, complete genome 42 1.5
9gb|AC158979.2| Mus musculus BAC clone RP23-218C24 from chromosom... 42 1.5
10gb|AF332862.1|AF332859S2 Mus musculus diadenosine triphosphate h... 42 1.5
11gb|AC154205.1| Mus musculus BAC clone RP24-88I1 from chromosome ... 42 1.5
12emb|AL663026.13| Mouse DNA sequence from clone RP23-224M19 on ch... 42 1.5
13tpe|BN000728.1| TPA: TPA_exp: Canis familiaris col6a3 gene for c... 42 1.5
14emb|CT573099.7| Mouse DNA sequence from clone CH29-15F19 on chro... 42 1.5
15emb|AJ920047.1| Canis familiaris melanophilin gene locus, breed ... 42 1.5
16gb|AC139331.5| Mus musculus BAC clone RP24-189J10 from 1, comple... 42 1.5
17emb|CT025538.13| Mouse DNA sequence from clone RP23-386E7 on chr... 42 1.5
18emb|AL845441.7| Mouse DNA sequence from clone RP23-327I5 on chro... 42 1.5
19gb|AC140395.2| Mus musculus BAC clone RP24-183G4 from chromosome... 40 5.8
20gb|AC074271.24| Homo sapiens 3 BAC RP11-65D10 (Roswell Park Canc... 40 5.8
21gb|AC136506.10| Medicago truncatula clone mth2-33c8, complete se... 40 5.8
22emb|AL033376.17|HS278N12 Human DNA sequence from clone RP1-278N1... 40 5.8
23emb|AL591611.8| Mouse DNA sequence from clone RP23-228D6 on chro... 40 5.8
24dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.8
25gb|AC079922.5| Homo sapiens BAC clone RP11-368A17 from 2, comple... 40 5.8
26dbj|AP002897.2| Oryza sativa (japonica cultivar-group) genomic D... 40 5.8
27dbj|BS000107.1| Pan troglodytes chromosome 22 clone:PTB-020H02, ... 40 5.8
28dbj|AK101407.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.8
29dbj|AP001709.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 5.8
30emb|CR954198.2| Medicago truncatula chromosome 5 clone mte1-67f2... 40 5.8
31dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome 40 5.8
32emb|AL670951.6| Mouse DNA sequence from clone RP23-6N18 on chrom... 40 5.8
33dbj|AP000244.1| Homo sapiens genomic DNA, chromosome 21q22.1, D2... 40 5.8
34dbj|AP000204.1| Homo sapiens genomic DNA, chromosome 21q22.1, D2... 40 5.8

>gb|AC131800.4| Mus musculus BAC clone RP24-535O17 from chromosome 17, complete sequence
          Length = 162701

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 136    tttctctttgcagtatgcaca 156
              |||||||||||||||||||||
Sbjct: 117761 tttctctttgcagtatgcaca 117781



to top

>gb|AC127416.7| Mus musculus BAC clone RP23-457J22 from chromosome 8, complete sequence
          Length = 206997

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 136    tttctctttgcagtatgcaca 156
              |||||||||||||||||||||
Sbjct: 111408 tttctctttgcagtatgcaca 111388



to top

>gb|AC158392.2| Mus musculus BAC clone RP24-87B5 from chromosome 14, complete
            sequence
          Length = 187798

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 136  tttctctttgcagtatgcaca 156
            |||||||||||||||||||||
Sbjct: 5433 tttctctttgcagtatgcaca 5413



to top

>gb|AC113318.8| Mus musculus chromosome 3, clone RP23-442I7, complete sequence
          Length = 213409

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 136   tttctctttgcagtatgcaca 156
             |||||||||||||||||||||
Sbjct: 29590 tttctctttgcagtatgcaca 29570



to top

>gb|AC160547.6| Mus musculus chromosome 8, clone RP23-240F23, complete sequence
          Length = 170722

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 136   tttctctttgcagtatgcaca 156
             |||||||||||||||||||||
Sbjct: 81815 tttctctttgcagtatgcaca 81795



to top

>gb|AC161816.5| Mus musculus BAC clone RP23-308L3 from chromosome 16, complete sequence
          Length = 213324

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 310    cacaactgccacaaatacaaa 330
              |||||||||||||||||||||
Sbjct: 175565 cacaactgccacaaatacaaa 175585



to top

>emb|AL954353.14| Mouse DNA sequence from clone RP23-156D8 on chromosome 11 Contains a
             pseudogene similar to part of striatin (calmodulin binding
             protein) (Strn), complete sequence
          Length = 188920

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 63    attttacaaactctgtacagt 83
             |||||||||||||||||||||
Sbjct: 49171 attttacaaactctgtacagt 49151



to top

>gb|CP000236.1| Ehrlichia chaffeensis str. Arkansas, complete genome
          Length = 1176248

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 36     tccactattcttattaccaga 56
              |||||||||||||||||||||
Sbjct: 447225 tccactattcttattaccaga 447205



to top

>gb|AC158979.2| Mus musculus BAC clone RP23-218C24 from chromosome 14, complete sequence
          Length = 216848

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 136    tttctctttgcagtatgcaca 156
              |||||||||||||||||||||
Sbjct: 143403 tttctctttgcagtatgcaca 143423



to top

>gb|AF332862.1|AF332859S2 Mus musculus diadenosine triphosphate hydrolase (Fhit) gene, intron 5,
             partial sequence
          Length = 166617

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 136   tttctctttgcagtatgcaca 156
             |||||||||||||||||||||
Sbjct: 43051 tttctctttgcagtatgcaca 43071



to top

>gb|AC154205.1| Mus musculus BAC clone RP24-88I1 from chromosome 14, complete sequence
          Length = 219623

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 136    tttctctttgcagtatgcaca 156
              |||||||||||||||||||||
Sbjct: 145665 tttctctttgcagtatgcaca 145685



to top

>emb|AL663026.13| Mouse DNA sequence from clone RP23-224M19 on chromosome X, complete
              sequence
          Length = 237481

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 136    tttctctttgcagtatgcaca 156
              |||||||||||||||||||||
Sbjct: 211313 tttctctttgcagtatgcaca 211333



to top

>tpe|BN000728.1| TPA: TPA_exp: Canis familiaris col6a3 gene for collagen, type VI, alpha
             3 and mlph gene for melanophilin
          Length = 212696

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 384   ccaggaagcctccgttcccgg 404
             |||||||||||||||||||||
Sbjct: 74018 ccaggaagcctccgttcccgg 74038



to top

>emb|CT573099.7| Mouse DNA sequence from clone CH29-15F19 on chromosome 17, complete
             sequence
          Length = 82473

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 136   tttctctttgcagtatgcaca 156
             |||||||||||||||||||||
Sbjct: 39781 tttctctttgcagtatgcaca 39801



to top

>emb|AJ920047.1| Canis familiaris melanophilin gene locus, breed Doberman
          Length = 197532

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 384   ccaggaagcctccgttcccgg 404
             |||||||||||||||||||||
Sbjct: 74068 ccaggaagcctccgttcccgg 74088



to top

>gb|AC139331.5| Mus musculus BAC clone RP24-189J10 from 1, complete sequence
          Length = 164850

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 136    tttctctttgcagtatgcaca 156
              |||||||||||||||||||||
Sbjct: 115294 tttctctttgcagtatgcaca 115274



to top

>emb|CT025538.13| Mouse DNA sequence from clone RP23-386E7 on chromosome 14, complete
             sequence
          Length = 206957

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 136   tttctctttgcagtatgcaca 156
             |||||||||||||||||||||
Sbjct: 36567 tttctctttgcagtatgcaca 36587



to top

>emb|AL845441.7| Mouse DNA sequence from clone RP23-327I5 on chromosome 2, complete
             sequence
          Length = 153307

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 136   tttctctttgcagtatgcaca 156
             |||||||||||||||||||||
Sbjct: 64009 tttctctttgcagtatgcaca 64029



to top

>gb|AC140395.2| Mus musculus BAC clone RP24-183G4 from chromosome 6, complete sequence
          Length = 183546

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 136   tttctctttgcagtatgcac 155
             ||||||||||||||||||||
Sbjct: 52595 tttctctttgcagtatgcac 52576



to top

>gb|AC074271.24| Homo sapiens 3 BAC RP11-65D10 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 63185

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 35    ctccactattcttattacca 54
             ||||||||||||||||||||
Sbjct: 13653 ctccactattcttattacca 13634



to top

>gb|AC136506.10| Medicago truncatula clone mth2-33c8, complete sequence
          Length = 135457

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 313   aactgccacaaatacaaaac 332
             ||||||||||||||||||||
Sbjct: 82198 aactgccacaaatacaaaac 82217



to top

>emb|AL033376.17|HS278N12 Human DNA sequence from clone RP1-278N12 on chromosome 6q25.1-26
             Contains the 5' end of the gene for
             phosphoinositide-binding protein PIP3-E (KIAA0403),
             complete sequence
          Length = 78533

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 118   aactatgccattccccagtttctc 141
             ||||| ||||||||||||||||||
Sbjct: 71069 aactaagccattccccagtttctc 71046



to top

>emb|AL591611.8| Mouse DNA sequence from clone RP23-228D6 on chromosome 4 Contains three
             novel genes, complete sequence
          Length = 140771

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 121   tatgccattccccagtttct 140
             ||||||||||||||||||||
Sbjct: 62078 tatgccattccccagtttct 62097



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 246      ctgttcttcaagctgccctg 265
                ||||||||||||||||||||
Sbjct: 24565367 ctgttcttcaagctgccctg 24565386



to top

>gb|AC079922.5| Homo sapiens BAC clone RP11-368A17 from 2, complete sequence
          Length = 140678

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 116   gtaactatgccattccccag 135
             ||||||||||||||||||||
Sbjct: 16496 gtaactatgccattccccag 16515



to top

>dbj|AP002897.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0686E09
          Length = 156425

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 246    ctgttcttcaagctgccctg 265
              ||||||||||||||||||||
Sbjct: 145751 ctgttcttcaagctgccctg 145770



to top

>dbj|BS000107.1| Pan troglodytes chromosome 22 clone:PTB-020H02, map 22, complete
              sequences
          Length = 145633

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 33     cactccactattcttattac 52
              ||||||||||||||||||||
Sbjct: 130801 cactccactattcttattac 130782



to top

>dbj|AK101407.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033037H17, full
           insert sequence
          Length = 1060

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 246 ctgttcttcaagctgccctg 265
           ||||||||||||||||||||
Sbjct: 805 ctgttcttcaagctgccctg 786



to top

>dbj|AP001709.1| Homo sapiens genomic DNA, chromosome 21q, section 53/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 33     cactccactattcttattac 52
              ||||||||||||||||||||
Sbjct: 124504 cactccactattcttattac 124485



to top

>emb|CR954198.2| Medicago truncatula chromosome 5 clone mte1-67f21, COMPLETE SEQUENCE
          Length = 101335

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 313   aactgccacaaatacaaaac 332
             ||||||||||||||||||||
Sbjct: 56241 aactgccacaaatacaaaac 56222



to top

>dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome
          Length = 4303871

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 395    ccgttcccgggagcttagagtttt 418
              |||| |||||||||||||||||||
Sbjct: 702685 ccgtgcccgggagcttagagtttt 702708



to top

>emb|AL670951.6| Mouse DNA sequence from clone RP23-6N18 on chromosome 2, complete
             sequence
          Length = 207571

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 253   tcaagctgccctgagaaggg 272
             ||||||||||||||||||||
Sbjct: 51865 tcaagctgccctgagaaggg 51884



to top

>dbj|AP000244.1| Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region,
             clone:B282I5, complete sequence
          Length = 149898

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 33    cactccactattcttattac 52
             ||||||||||||||||||||
Sbjct: 42611 cactccactattcttattac 42592



to top

>dbj|AP000204.1| Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region, clone
             f43D11-119B8, segment 2/12, complete sequence
          Length = 100000

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 33    cactccactattcttattac 52
             ||||||||||||||||||||
Sbjct: 59492 cactccactattcttattac 59473


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,980,048
Number of Sequences: 3902068
Number of extensions: 3980048
Number of successful extensions: 68384
Number of sequences better than 10.0: 34
Number of HSP's better than 10.0 without gapping: 34
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 68301
Number of HSP's gapped (non-prelim): 83
length of query: 433
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 411
effective length of database: 17,147,199,772
effective search space: 7047499106292
effective search space used: 7047499106292
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top