Clone Name | rbastl31h11 |
---|---|
Clone Library Name | barley_pub |
>gb|AC140286.3| Mus musculus BAC clone RP24-573E14 from chromosome 5, complete sequence Length = 164620 Score = 42.1 bits (21), Expect = 0.43 Identities = 21/21 (100%) Strand = Plus / Minus Query: 82 ggaagcacatggtagaagggg 102 ||||||||||||||||||||| Sbjct: 18492 ggaagcacatggtagaagggg 18472
>gb|AC117196.3| Mus musculus BAC clone RP23-108H19 from 8, complete sequence Length = 185947 Score = 42.1 bits (21), Expect = 0.43 Identities = 21/21 (100%) Strand = Plus / Minus Query: 52 ccttgctaatgttacaaccat 72 ||||||||||||||||||||| Sbjct: 73745 ccttgctaatgttacaaccat 73725
>gb|AC120412.12| Mus musculus chromosome 5, clone RP24-447P14, complete sequence Length = 149454 Score = 42.1 bits (21), Expect = 0.43 Identities = 21/21 (100%) Strand = Plus / Minus Query: 82 ggaagcacatggtagaagggg 102 ||||||||||||||||||||| Sbjct: 36483 ggaagcacatggtagaagggg 36463
>emb|AL359852.20| Human DNA sequence from clone RP11-299J5 on chromosome 6, complete sequence Length = 120512 Score = 40.1 bits (20), Expect = 1.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 96 gaagggggtgagcacctaag 115 |||||||||||||||||||| Sbjct: 92814 gaagggggtgagcacctaag 92833
>gb|AC073343.6| Homo sapiens BAC clone RP11-611L7 from 7, complete sequence Length = 173967 Score = 40.1 bits (20), Expect = 1.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 80 ggggaagcacatggtagaag 99 |||||||||||||||||||| Sbjct: 4157 ggggaagcacatggtagaag 4138
>gb|AC098931.3| Homo sapiens chromosome 3 clone RP11-353I6, complete sequence Length = 179082 Score = 40.1 bits (20), Expect = 1.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 89 catggtagaagggggtgagcacct 112 |||||||||||||||||| ||||| Sbjct: 159393 catggtagaagggggtgaccacct 159370
>emb|CR938722.3| Pig DNA sequence from clone CH242-150C11 on chromosome 4, complete sequence Length = 177720 Score = 40.1 bits (20), Expect = 1.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 30 gccaaggaaatgaaacttcagccc 53 |||||||| ||||||||||||||| Sbjct: 102344 gccaaggagatgaaacttcagccc 102321
>gb|AC134459.4| Mus musculus BAC clone RP23-360L15 from chromosome 8, complete sequence Length = 211773 Score = 38.2 bits (19), Expect = 6.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 89 catggtagaagggggtgag 107 ||||||||||||||||||| Sbjct: 208508 catggtagaagggggtgag 208490
>gb|AC115073.9| Mus musculus chromosome 8, clone RP24-417J18, complete sequence Length = 161625 Score = 38.2 bits (19), Expect = 6.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 89 catggtagaagggggtgag 107 ||||||||||||||||||| Sbjct: 68179 catggtagaagggggtgag 68161
>emb|Z68014.1|CEW04G3 Caenorhabditis elegans Cosmid W04G3, complete sequence Length = 32158 Score = 38.2 bits (19), Expect = 6.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 54 ttgctaatgttacaaccat 72 ||||||||||||||||||| Sbjct: 13694 ttgctaatgttacaaccat 13676
>emb|AL445238.12| Human DNA sequence from clone RP11-394A14 on chromosome 13 Contains a protein phosphatase 1, regulatory (inhibitor) subunit 2 (PPP1R2) pseudogene, a novel gene and an olfactory receptor pseudogene, complete sequence Length = 174801 Score = 38.2 bits (19), Expect = 6.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 4 gagtacatatgtatgaaat 22 ||||||||||||||||||| Sbjct: 88354 gagtacatatgtatgaaat 88372
>emb|AL118516.10|HSBK29F11 Human DNA sequence from clone CTA-29F11 on chromosome 22, complete sequence Length = 89319 Score = 38.2 bits (19), Expect = 6.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 6 gtacatatgtatgaaatga 24 ||||||||||||||||||| Sbjct: 68693 gtacatatgtatgaaatga 68711
>gb|AC023720.4| Drosophila melanogaster X BAC RP98-7F15 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 179205 Score = 38.2 bits (19), Expect = 6.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 6 gtacatatgtatgaaatga 24 ||||||||||||||||||| Sbjct: 118897 gtacatatgtatgaaatga 118915
>gb|AC097502.3| Homo sapiens BAC clone RP11-340B18 from 4, complete sequence Length = 168254 Score = 38.2 bits (19), Expect = 6.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 agtacatatgtatgaaatg 23 ||||||||||||||||||| Sbjct: 166819 agtacatatgtatgaaatg 166801
>dbj|AB091568.1| Crassostrea gigas DNA, microsatellite locus TNFRI-Crgi23 Length = 599 Score = 38.2 bits (19), Expect = 6.8 Identities = 22/23 (95%) Strand = Plus / Minus Query: 61 tgttacaaccatatacagtgggg 83 |||||||| |||||||||||||| Sbjct: 146 tgttacaagcatatacagtgggg 124
>gb|AC097507.2| Homo sapiens BAC clone RP11-371E22 from 4, complete sequence Length = 167032 Score = 38.2 bits (19), Expect = 6.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 agtacatatgtatgaaatg 23 ||||||||||||||||||| Sbjct: 565 agtacatatgtatgaaatg 547
>gb|AE003436.3| Drosophila melanogaster chromosome X, section 20 of 74 of the complete sequence Length = 317322 Score = 38.2 bits (19), Expect = 6.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 6 gtacatatgtatgaaatga 24 ||||||||||||||||||| Sbjct: 20353 gtacatatgtatgaaatga 20335 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,295,256 Number of Sequences: 3902068 Number of extensions: 1295256 Number of successful extensions: 87469 Number of sequences better than 10.0: 17 Number of HSP's better than 10.0 without gapping: 17 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 87429 Number of HSP's gapped (non-prelim): 40 length of query: 142 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 121 effective length of database: 17,151,101,840 effective search space: 2075283322640 effective search space used: 2075283322640 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)