>ref|XM_812246.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053508543.40) partial mRNA
          Length = 537

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 179 tcgtcctgcgacaccgcctc 198
           ||||||||||||||||||||
Sbjct: 182 tcgtcctgcgacaccgcctc 163

>ref|XM_816174.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053506401.130) partial mRNA
          Length = 393

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 179 tcgtcctgcgacaccgcctc 198
           ||||||||||||||||||||
Sbjct: 38  tcgtcctgcgacaccgcctc 19

>emb|AL672240.13| Mouse DNA sequence from clone RP23-27I16 on chromosome 11, complete
              sequence
          Length = 224603

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 65     cacttttacatccagttcaa 84
              ||||||||||||||||||||
Sbjct: 212583 cacttttacatccagttcaa 212564

>gb|AY340408.1| Ophelina acuminata 28S ribosomal RNA gene, partial sequence
          Length = 331

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 156 gacggtgatagccgacgggc 175
           ||||||||||||||||||||
Sbjct: 221 gacggtgatagccgacgggc 202

>gb|AC104365.4| Homo sapiens chromosome 18, clone RP11-108P20, complete sequence
          Length = 157871

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 203    ttctcccccacccaatcatg 222
              ||||||||||||||||||||
Sbjct: 156712 ttctcccccacccaatcatg 156693

>dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023
          Length = 2661830

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 275    tgacctggacctcttcttct 294
              ||||||||||||||||||||
Sbjct: 676439 tgacctggacctcttcttct 676458

>gb|AY612630.1| Ophelina acuminata 28S ribosomal RNA gene, partial sequence
          Length = 800

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 156 gacggtgatagccgacgggc 175
           ||||||||||||||||||||
Sbjct: 240 gacggtgatagccgacgggc 221

>gb|AC104971.5| Homo sapiens chromosome 18, clone RP11-126O1, complete sequence
          Length = 164132

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 203  ttctcccccacccaatcatg 222
            ||||||||||||||||||||
Sbjct: 1367 ttctcccccacccaatcatg 1348

>gb|L77117.1| Methanocaldococcus jannaschii DSM 2661, complete genome
          Length = 1664970

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 277    acctggacctcttcttctac 296
              ||||||||||||||||||||
Sbjct: 417589 acctggacctcttcttctac 417570


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,860,058
Number of Sequences: 3902068
Number of extensions: 2860058
Number of successful extensions: 45093
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 45074
Number of HSP's gapped (non-prelim): 19
length of query: 398
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 376
effective length of database: 17,147,199,772
effective search space: 6447347114272
effective search space used: 6447347114272
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)