Clone Name | rbastl31g05 |
---|---|
Clone Library Name | barley_pub |
>ref|XM_812246.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053508543.40) partial mRNA Length = 537 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 179 tcgtcctgcgacaccgcctc 198 |||||||||||||||||||| Sbjct: 182 tcgtcctgcgacaccgcctc 163
>ref|XM_816174.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053506401.130) partial mRNA Length = 393 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 179 tcgtcctgcgacaccgcctc 198 |||||||||||||||||||| Sbjct: 38 tcgtcctgcgacaccgcctc 19
>emb|AL672240.13| Mouse DNA sequence from clone RP23-27I16 on chromosome 11, complete sequence Length = 224603 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 cacttttacatccagttcaa 84 |||||||||||||||||||| Sbjct: 212583 cacttttacatccagttcaa 212564
>gb|AY340408.1| Ophelina acuminata 28S ribosomal RNA gene, partial sequence Length = 331 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 156 gacggtgatagccgacgggc 175 |||||||||||||||||||| Sbjct: 221 gacggtgatagccgacgggc 202
>gb|AC104365.4| Homo sapiens chromosome 18, clone RP11-108P20, complete sequence Length = 157871 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 203 ttctcccccacccaatcatg 222 |||||||||||||||||||| Sbjct: 156712 ttctcccccacccaatcatg 156693
>dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023 Length = 2661830 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 275 tgacctggacctcttcttct 294 |||||||||||||||||||| Sbjct: 676439 tgacctggacctcttcttct 676458
>gb|AY612630.1| Ophelina acuminata 28S ribosomal RNA gene, partial sequence Length = 800 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 156 gacggtgatagccgacgggc 175 |||||||||||||||||||| Sbjct: 240 gacggtgatagccgacgggc 221
>gb|AC104971.5| Homo sapiens chromosome 18, clone RP11-126O1, complete sequence Length = 164132 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 203 ttctcccccacccaatcatg 222 |||||||||||||||||||| Sbjct: 1367 ttctcccccacccaatcatg 1348
>gb|L77117.1| Methanocaldococcus jannaschii DSM 2661, complete genome Length = 1664970 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 277 acctggacctcttcttctac 296 |||||||||||||||||||| Sbjct: 417589 acctggacctcttcttctac 417570 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,860,058 Number of Sequences: 3902068 Number of extensions: 2860058 Number of successful extensions: 45093 Number of sequences better than 10.0: 9 Number of HSP's better than 10.0 without gapping: 9 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 45074 Number of HSP's gapped (non-prelim): 19 length of query: 398 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 376 effective length of database: 17,147,199,772 effective search space: 6447347114272 effective search space used: 6447347114272 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)