Clone Name | rbastl31f10 |
---|---|
Clone Library Name | barley_pub |
>gb|AY359936.1| Trachelomonas grandis large subunit ribosomal RNA gene, partial sequence Length = 1448 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 209 agcaactctactcctgagtgc 229 ||||||||||||||||||||| Sbjct: 306 agcaactctactcctgagtgc 286
>gb|AC087490.6| Homo sapiens chromosome 15, clone RP11-810H22, complete sequence Length = 183342 Score = 42.1 bits (21), Expect = 0.80 Identities = 24/25 (96%) Strand = Plus / Minus Query: 137 atctgggagaaaataacaacaaaat 161 |||| |||||||||||||||||||| Sbjct: 63489 atctaggagaaaataacaacaaaat 63465
>gb|AC021439.9| Homo sapiens chromosome 15, clone RP11-484P15, complete sequence Length = 206030 Score = 42.1 bits (21), Expect = 0.80 Identities = 24/25 (96%) Strand = Plus / Minus Query: 137 atctgggagaaaataacaacaaaat 161 |||| |||||||||||||||||||| Sbjct: 192132 atctaggagaaaataacaacaaaat 192108
>gb|AC134460.4| Mus musculus BAC clone RP23-373D18 from chromosome 10, complete sequence Length = 174545 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 88 ggattgtgtcggttcagatg 107 |||||||||||||||||||| Sbjct: 165780 ggattgtgtcggttcagatg 165761
>gb|AC116107.10| Mus musculus chromosome 1, clone RP23-28F18, complete sequence Length = 262581 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 141 gggagaaaataacaacaaaa 160 |||||||||||||||||||| Sbjct: 28267 gggagaaaataacaacaaaa 28286
>emb|Z70206.1|CEC49F8 Caenorhabditis elegans Cosmid C49F8, complete sequence Length = 39435 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 141 gggagaaaataacaacaaaa 160 |||||||||||||||||||| Sbjct: 17996 gggagaaaataacaacaaaa 18015
>gb|AC098878.3| Mus musculus BAC clone RP23-2G23 from 4, complete sequence Length = 209021 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 136 aatctgggagaaaataacaa 155 |||||||||||||||||||| Sbjct: 183695 aatctgggagaaaataacaa 183714
>emb|AL355475.7| Human DNA sequence from clone RP1-241M7 on chromosome 1q43-44, complete sequence Length = 84707 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 ctactcctgagtgcaataaa 235 |||||||||||||||||||| Sbjct: 32634 ctactcctgagtgcaataaa 32653
>emb|AL844848.12| Mouse DNA sequence from clone RP23-247N5 on chromosome 4 Contains part of the Ptprd gene for receptor type protein tyrosine phosphatase D and a CpG island, complete sequence Length = 199012 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 136 aatctgggagaaaataacaa 155 |||||||||||||||||||| Sbjct: 141052 aatctgggagaaaataacaa 141071
>gb|AC024864.1|AC024864 Caenorhabditis elegans clone Y74C9A, complete sequence Length = 47629 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 143 gagaaaataacaacaaaatc 162 |||||||||||||||||||| Sbjct: 16253 gagaaaataacaacaaaatc 16272
>gb|AC024206.1| Caenorhabditis elegans cosmid Y74C9A, complete sequence Length = 47629 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 143 gagaaaataacaacaaaatc 162 |||||||||||||||||||| Sbjct: 16253 gagaaaataacaacaaaatc 16272
>gb|AE001437.1| Clostridium acetobutylicum ATCC 824, complete genome Length = 3940880 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 8 agcaacagtattatcaccaa 27 |||||||||||||||||||| Sbjct: 1986887 agcaacagtattatcaccaa 1986906
>gb|AC153883.6| Mus musculus 10 BAC RP23-368G20 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 181524 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 88 ggattgtgtcggttcagatg 107 |||||||||||||||||||| Sbjct: 154373 ggattgtgtcggttcagatg 154392
>emb|AL049870.3|CNS0000S Human chromosome 14 DNA sequence BAC R-857B24 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 205035 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 139 ctgggagaaaataacaacaa 158 |||||||||||||||||||| Sbjct: 41667 ctgggagaaaataacaacaa 41686
>gb|AC153533.4| Mus musculus 10 BAC RP23-474K10 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 187069 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 88 ggattgtgtcggttcagatg 107 |||||||||||||||||||| Sbjct: 77082 ggattgtgtcggttcagatg 77101
>gb|AC137515.3| Mus musculus BAC clone RP23-258C20 from 1, complete sequence Length = 215582 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 141 gggagaaaataacaacaaaa 160 |||||||||||||||||||| Sbjct: 105737 gggagaaaataacaacaaaa 105718 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,419,733 Number of Sequences: 3902068 Number of extensions: 2419733 Number of successful extensions: 43911 Number of sequences better than 10.0: 16 Number of HSP's better than 10.0 without gapping: 16 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 43884 Number of HSP's gapped (non-prelim): 27 length of query: 244 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 222 effective length of database: 17,147,199,772 effective search space: 3806678349384 effective search space used: 3806678349384 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)