ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl31f09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL670951.6| Mouse DNA sequence from clone RP23-6N18 on chrom... 44 0.28
2gb|AC120527.3| Oryza sativa (japonica cultivar-group) chromosome... 42 1.1
3gb|AC124055.6| Homo sapiens chromosome 11, clone RP4-608B4, comp... 42 1.1
4emb|BX537106.6| Zebrafish DNA sequence from clone DKEY-98P3 in l... 42 1.1
5emb|AJ006345.1|HSA6345 Homo sapiens KVLQT1 gene 42 1.1
6gb|AC021424.6| Homo sapiens chromosome 11, clone RP11-38L8, comp... 42 1.1
7gb|AC157774.5| Mus musculus chromosome 8, clone RP23-423E20, com... 42 1.1
8dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.1
9emb|BX005104.7| Zebrafish DNA sequence from clone DKEY-191D13 in... 42 1.1
10gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 42 1.1
11gb|AC002403.1|AC002403 Human Chromosome 11p15.5 pac pDJ608b4, co... 42 1.1
12gb|U90095.1|U90095 Human Chromosome 11p15.5 pac pDJ74k15, comple... 42 1.1
13emb|AL928701.7| Zebrafish DNA sequence from clone CH211-201H21, ... 42 1.1
14emb|AL808141.8| Zebrafish DNA sequence from clone CH211-260N19, ... 42 1.1
15gb|AC167132.12| Mus musculus chromosome 8, clone RP24-335A22, co... 42 1.1
16gb|AC116798.11| Mus musculus chromosome 1, clone RP24-329K22, co... 40 4.4
17gb|AC131191.4| Mus musculus BAC clone RP24-464B16 from chromosom... 40 4.4
18gb|AC138109.3| Mus musculus BAC clone RP24-444I15 from chromosom... 40 4.4
19gb|AC130714.3| Mus musculus BAC clone RP23-367L18 from chromosom... 40 4.4
20gb|AC156556.8| Mus musculus chromosome 7, clone RP23-92E8, compl... 40 4.4
21ref|XM_975010.1| PREDICTED: Mus musculus hypothetical protein LO... 40 4.4
22ref|XM_974871.1| PREDICTED: Mus musculus hypothetical protein LO... 40 4.4
23ref|XM_973576.1| PREDICTED: Mus musculus hypothetical protein LO... 40 4.4
24emb|CT025601.7| Mouse DNA sequence from clone RP23-424B7 on chro... 40 4.4
25gb|AC116470.12| Mus musculus chromosome 16, clone RP23-383N18, c... 40 4.4
26gb|AC138619.4| Mus musculus BAC clone RP23-278M16 from chromosom... 40 4.4
27gb|AC133889.9| Mus musculus chromosome 16, clone RP23-380I13, co... 40 4.4
28gb|AC113019.13| Mus musculus chromosome 7, clone RP23-185A21, co... 40 4.4
29emb|AL390035.10| Human DNA sequence from clone RP13-9D14 on chro... 40 4.4
30gb|AC108004.3| Homo sapiens chromosome 17, clone CTD-2348K1, com... 40 4.4
31dbj|AK148940.1| Mus musculus 2 days neonate sympathetic ganglion... 40 4.4
32ref|XM_392897.2| PREDICTED: Apis mellifera similar to thyroid ho... 40 4.4
33emb|AL732612.28| Mouse DNA sequence from clone RP23-31L20 on chr... 40 4.4
34emb|AL845360.10| Mouse DNA sequence from clone RP23-421L7 on chr... 40 4.4
35dbj|AP000412.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 40 4.4
36emb|AJ338005.1|HSA338005 Homo sapiens genomic sequence surroundi... 40 4.4
37gb|AC154739.2| Mus musculus BAC clone RP23-117B4 from 9, complet... 40 4.4
38gb|AC154630.2| Mus musculus BAC clone RP23-319C8 from 9, complet... 40 4.4
39emb|AL831756.8| Mouse DNA sequence from clone RP23-300P20 on chr... 40 4.4

>emb|AL670951.6| Mouse DNA sequence from clone RP23-6N18 on chromosome 2, complete
             sequence
          Length = 207571

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 240   accagaagcttccttcttccat 261
             ||||||||||||||||||||||
Sbjct: 18688 accagaagcttccttcttccat 18667



to top

>gb|AC120527.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0011J22 map R10571S, complete sequence
          Length = 154441

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 198   ccacaaaataacattcagagt 218
             |||||||||||||||||||||
Sbjct: 85791 ccacaaaataacattcagagt 85811



to top

>gb|AC124055.6| Homo sapiens chromosome 11, clone RP4-608B4, complete sequence
          Length = 133815

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 147   tccatccaaatgaattgtcca 167
             |||||||||||||||||||||
Sbjct: 50105 tccatccaaatgaattgtcca 50085



to top

>emb|BX537106.6| Zebrafish DNA sequence from clone DKEY-98P3 in linkage group 20 Contains
              the gene for a novel protein similar to vertebrate
              dermatopontin (DPT), the atp1b1a gene for ATPase, Na+/K+
              transporting, beta 1a polypeptide, the gene for a novel
              protein containing a homocysteine S-methyltransferase
              domain, the bivm gene for basic, immunoglobulin-like
              variable motif containing, the 5' end of the gene for a
              novel zinc finger protein (wu:fc06h02), the ndpkz4 gene for
              nucleoside diphosphate kinase-Z4 and the gene for a novel
              protein containing an inosine-uridine preferring nucleoside
              hydrolase doamin, complete sequence
          Length = 162005

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 191    atgcatcccacaaaataacat 211
              |||||||||||||||||||||
Sbjct: 115020 atgcatcccacaaaataacat 115040



to top

>emb|AJ006345.1|HSA6345 Homo sapiens KVLQT1 gene
          Length = 404123

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 147    tccatccaaatgaattgtcca 167
              |||||||||||||||||||||
Sbjct: 203820 tccatccaaatgaattgtcca 203840



to top

>gb|AC021424.6| Homo sapiens chromosome 11, clone RP11-38L8, complete sequence
          Length = 181025

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 147    tccatccaaatgaattgtcca 167
              |||||||||||||||||||||
Sbjct: 179116 tccatccaaatgaattgtcca 179096



to top

>gb|AC157774.5| Mus musculus chromosome 8, clone RP23-423E20, complete sequence
          Length = 198967

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   cagaagcttccttcttccatt 262
             |||||||||||||||||||||
Sbjct: 19215 cagaagcttccttcttccatt 19235



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 198     ccacaaaataacattcagagt 218
               |||||||||||||||||||||
Sbjct: 3229194 ccacaaaataacattcagagt 3229174



to top

>emb|BX005104.7| Zebrafish DNA sequence from clone DKEY-191D13 in linkage group 6,
              complete sequence
          Length = 152217

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 191    atgcatcccacaaaataacat 211
              |||||||||||||||||||||
Sbjct: 144255 atgcatcccacaaaataacat 144275



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 198     ccacaaaataacattcagagt 218
               |||||||||||||||||||||
Sbjct: 3237899 ccacaaaataacattcagagt 3237879



to top

>gb|AC002403.1|AC002403 Human Chromosome 11p15.5 pac pDJ608b4, complete sequence
          Length = 132960

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 147   tccatccaaatgaattgtcca 167
             |||||||||||||||||||||
Sbjct: 50104 tccatccaaatgaattgtcca 50084



to top

>gb|U90095.1|U90095 Human Chromosome 11p15.5 pac pDJ74k15, complete sequence
          Length = 120229

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 147    tccatccaaatgaattgtcca 167
              |||||||||||||||||||||
Sbjct: 118690 tccatccaaatgaattgtcca 118670



to top

>emb|AL928701.7| Zebrafish DNA sequence from clone CH211-201H21, complete sequence
          Length = 188745

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 191   atgcatcccacaaaataacat 211
             |||||||||||||||||||||
Sbjct: 25972 atgcatcccacaaaataacat 25992



to top

>emb|AL808141.8| Zebrafish DNA sequence from clone CH211-260N19, complete sequence
          Length = 147111

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 191   atgcatcccacaaaataacat 211
             |||||||||||||||||||||
Sbjct: 17594 atgcatcccacaaaataacat 17614



to top

>gb|AC167132.12| Mus musculus chromosome 8, clone RP24-335A22, complete sequence
          Length = 203284

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   cagaagcttccttcttccatt 262
             |||||||||||||||||||||
Sbjct: 46662 cagaagcttccttcttccatt 46642



to top

>gb|AC116798.11| Mus musculus chromosome 1, clone RP24-329K22, complete sequence
          Length = 173479

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 242  cagaagcttccttcttccat 261
            ||||||||||||||||||||
Sbjct: 3481 cagaagcttccttcttccat 3462



to top

>gb|AC131191.4| Mus musculus BAC clone RP24-464B16 from chromosome 18, complete
             sequence
          Length = 136832

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 242   cagaagcttccttcttccat 261
             ||||||||||||||||||||
Sbjct: 62510 cagaagcttccttcttccat 62529



to top

>gb|AC138109.3| Mus musculus BAC clone RP24-444I15 from chromosome 1, complete sequence
          Length = 209820

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 242    cagaagcttccttcttccat 261
              ||||||||||||||||||||
Sbjct: 154326 cagaagcttccttcttccat 154307



to top

>gb|AC130714.3| Mus musculus BAC clone RP23-367L18 from chromosome 18, complete sequence
          Length = 193184

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 242    cagaagcttccttcttccat 261
              ||||||||||||||||||||
Sbjct: 167982 cagaagcttccttcttccat 168001



to top

>gb|AC156556.8| Mus musculus chromosome 7, clone RP23-92E8, complete sequence
          Length = 250903

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 242    cagaagcttccttcttccat 261
              ||||||||||||||||||||
Sbjct: 109193 cagaagcttccttcttccat 109174



to top

>ref|XM_975010.1| PREDICTED: Mus musculus hypothetical protein LOC669245 (LOC669245),
           mRNA
          Length = 2064

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 242 cagaagcttccttcttccat 261
           ||||||||||||||||||||
Sbjct: 136 cagaagcttccttcttccat 117



to top

>ref|XM_974871.1| PREDICTED: Mus musculus hypothetical protein LOC664925 (LOC664925),
           mRNA
          Length = 2064

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 242 cagaagcttccttcttccat 261
           ||||||||||||||||||||
Sbjct: 136 cagaagcttccttcttccat 117



to top

>ref|XM_973576.1| PREDICTED: Mus musculus hypothetical protein LOC674284 (LOC674284),
           mRNA
          Length = 2064

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 242 cagaagcttccttcttccat 261
           ||||||||||||||||||||
Sbjct: 136 cagaagcttccttcttccat 117



to top

>emb|CT025601.7| Mouse DNA sequence from clone RP23-424B7 on chromosome 17, complete
             sequence
          Length = 197841

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 242   cagaagcttccttcttccat 261
             ||||||||||||||||||||
Sbjct: 85983 cagaagcttccttcttccat 85964



to top

>gb|AC116470.12| Mus musculus chromosome 16, clone RP23-383N18, complete sequence
          Length = 194593

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 242    cagaagcttccttcttccat 261
              ||||||||||||||||||||
Sbjct: 188090 cagaagcttccttcttccat 188109



to top

>gb|AC138619.4| Mus musculus BAC clone RP23-278M16 from chromosome 18, complete
             sequence
          Length = 170250

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 242   cagaagcttccttcttccat 261
             ||||||||||||||||||||
Sbjct: 17379 cagaagcttccttcttccat 17398



to top

>gb|AC133889.9| Mus musculus chromosome 16, clone RP23-380I13, complete sequence
          Length = 235574

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 242   cagaagcttccttcttccat 261
             ||||||||||||||||||||
Sbjct: 55849 cagaagcttccttcttccat 55868



to top

>gb|AC113019.13| Mus musculus chromosome 7, clone RP23-185A21, complete sequence
          Length = 215975

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 121   acatccaagatcacagcaaa 140
             ||||||||||||||||||||
Sbjct: 76599 acatccaagatcacagcaaa 76580



to top

>emb|AL390035.10| Human DNA sequence from clone RP13-9D14 on chromosome X Contains the 5'
              end of gene KIAA2022 and a CpG island, complete sequence
          Length = 148057

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 231    caaaatgcaaccagaagctt 250
              ||||||||||||||||||||
Sbjct: 108064 caaaatgcaaccagaagctt 108083



to top

>gb|AC108004.3| Homo sapiens chromosome 17, clone CTD-2348K1, complete sequence
          Length = 116762

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 260   attcttgtgtcatttcttca 279
             ||||||||||||||||||||
Sbjct: 60550 attcttgtgtcatttcttca 60569



to top

>dbj|AK148940.1| Mus musculus 2 days neonate sympathetic ganglion cDNA, RIKEN
            full-length enriched library, clone:7120465J07
            product:unclassifiable, full insert sequence
          Length = 2064

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 242  cagaagcttccttcttccat 261
            ||||||||||||||||||||
Sbjct: 1929 cagaagcttccttcttccat 1948



to top

>ref|XM_392897.2| PREDICTED: Apis mellifera similar to thyroid hormone receptor
           interactor 12 (LOC409382), mRNA
          Length = 6977

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 217 gttctcgtacaccacaaaat 236
           ||||||||||||||||||||
Sbjct: 443 gttctcgtacaccacaaaat 462



to top

>emb|AL732612.28| Mouse DNA sequence from clone RP23-31L20 on chromosome 11, complete
             sequence
          Length = 145244

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 242   cagaagcttccttcttccat 261
             ||||||||||||||||||||
Sbjct: 14659 cagaagcttccttcttccat 14640



to top

>emb|AL845360.10| Mouse DNA sequence from clone RP23-421L7 on chromosome 2, complete
              sequence
          Length = 196651

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 242    cagaagcttccttcttccat 261
              ||||||||||||||||||||
Sbjct: 113584 cagaagcttccttcttccat 113603



to top

>dbj|AP000412.1| Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone: K3G3
          Length = 24057

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 239  aaccagaagcttccttcttc 258
            ||||||||||||||||||||
Sbjct: 2599 aaccagaagcttccttcttc 2618



to top

>emb|AJ338005.1|HSA338005 Homo sapiens genomic sequence surrounding NotI site, clone
           NR1-IF13C
          Length = 709

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 126 caagatcacagcaaaagaac 145
           ||||||||||||||||||||
Sbjct: 494 caagatcacagcaaaagaac 513



to top

>gb|AC154739.2| Mus musculus BAC clone RP23-117B4 from 9, complete sequence
          Length = 196406

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Plus

                                              
Query: 123    atccaagatcacagcaaaagaa-catccatcc 153
              ||||||||||||| |||||||| |||||||||
Sbjct: 114759 atccaagatcacatcaaaagaatcatccatcc 114790



to top

>gb|AC154630.2| Mus musculus BAC clone RP23-319C8 from 9, complete sequence
          Length = 182834

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Plus

                                              
Query: 123    atccaagatcacagcaaaagaa-catccatcc 153
              ||||||||||||| |||||||| |||||||||
Sbjct: 181240 atccaagatcacatcaaaagaatcatccatcc 181271



to top

>emb|AL831756.8| Mouse DNA sequence from clone RP23-300P20 on chromosome 4, complete
             sequence
          Length = 164883

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 242   cagaagcttccttcttccat 261
             ||||||||||||||||||||
Sbjct: 80777 cagaagcttccttcttccat 80796


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,265,851
Number of Sequences: 3902068
Number of extensions: 3265851
Number of successful extensions: 68396
Number of sequences better than 10.0: 39
Number of HSP's better than 10.0 without gapping: 37
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 68265
Number of HSP's gapped (non-prelim): 133
length of query: 330
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 308
effective length of database: 17,147,199,772
effective search space: 5281337529776
effective search space used: 5281337529776
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top