>dbj|AP007159.1| Aspergillus oryzae RIB40 genomic DNA, SC026
          Length = 2324132

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 93      ctggcaagagatatattcctttgaa 117
               |||||||||||| ||||||||||||
Sbjct: 1511287 ctggcaagagatgtattcctttgaa 1511263

>gb|AC153877.5| Mus musculus 6 BAC RP23-258E21 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 232977

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 237   tgaaccaccagttttacctgg 257
             |||||||||||||||||||||
Sbjct: 15794 tgaaccaccagttttacctgg 15774

>gb|AC154011.3| Mus musculus 6 BAC RP24-261O15 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 146781

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 237    tgaaccaccagttttacctgg 257
              |||||||||||||||||||||
Sbjct: 119717 tgaaccaccagttttacctgg 119697

>gb|AC093353.11| Mus musculus chromosome 10, clone RP23-19C22, complete sequence
          Length = 188921

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 35    gtgaagtcacaatacaatct 54
             ||||||||||||||||||||
Sbjct: 81116 gtgaagtcacaatacaatct 81097

>gb|AC124585.3| Mus musculus BAC clone RP23-130P17 from chromosome 10, complete sequence
          Length = 198030

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 35     gtgaagtcacaatacaatct 54
              ||||||||||||||||||||
Sbjct: 193926 gtgaagtcacaatacaatct 193907

>emb|AL450427.11| Human DNA sequence from clone RP11-372H19 on chromosome 6, complete
             sequence
          Length = 68843

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 92    tctggcaagagatatattcctttg 115
             ||||||| ||||||||||||||||
Sbjct: 26060 tctggcaggagatatattcctttg 26083

>gb|AC007849.24| Homo sapiens 3 BAC RP11-3K16 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 199835

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 111   ctttgaattgtctttgtggc 130
             ||||||||||||||||||||
Sbjct: 59910 ctttgaattgtctttgtggc 59929

>gb|AE004731.1| Pseudomonas aeruginosa PAO1, section 292 of 529 of the complete genome
          Length = 18765

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 348   cgacagcggcaccagggtat 367
             ||||||||||||||||||||
Sbjct: 12612 cgacagcggcaccagggtat 12593

>gb|AC117792.6| Mus musculus chromosome 8, clone RP24-549A13, complete sequence
          Length = 174210

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 251    tacctgggcagttctaccat 270
              ||||||||||||||||||||
Sbjct: 100742 tacctgggcagttctaccat 100761


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,375,818
Number of Sequences: 3902068
Number of extensions: 3375818
Number of successful extensions: 56268
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56246
Number of HSP's gapped (non-prelim): 22
length of query: 405
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 383
effective length of database: 17,147,199,772
effective search space: 6567377512676
effective search space used: 6567377512676
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)