>ref|XM_467482.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 4672

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                        
Query: 308  tttctatgccttctgcttcgacttctgcttcttcagctccaatgacgcacctaatcctac 367
            |||||||| ||||||||| || ||||||||||||| |||||| || |  |||||||||||
Sbjct: 4408 tttctatgacttctgctttgatttctgcttcttcaactccaaggaagtccctaatcctac 4349

               
Query: 368  tgg 370
            |||
Sbjct: 4348 tgg 4346

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                            
Query: 308      tttctatgccttctgcttcgacttctgcttcttcagctccaatgacgcacctaatcctac 367
                |||||||| ||||||||| || ||||||||||||| |||||| || |  |||||||||||
Sbjct: 29782379 tttctatgacttctgctttgatttctgcttcttcaactccaaggaagtccctaatcctac 29782438

                   
Query: 368      tgg 370
                |||
Sbjct: 29782439 tgg 29782441

>dbj|AP004098.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ2056_H01
          Length = 123428

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                         
Query: 308   tttctatgccttctgcttcgacttctgcttcttcagctccaatgacgcacctaatcctac 367
             |||||||| ||||||||| || ||||||||||||| |||||| || |  |||||||||||
Sbjct: 38724 tttctatgacttctgctttgatttctgcttcttcaactccaaggaagtccctaatcctac 38783

                
Query: 368   tgg 370
             |||
Sbjct: 38784 tgg 38786

>dbj|AP004047.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1191_G08
          Length = 172832

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                          
Query: 308    tttctatgccttctgcttcgacttctgcttcttcagctccaatgacgcacctaatcctac 367
              |||||||| ||||||||| || ||||||||||||| |||||| || |  |||||||||||
Sbjct: 151358 tttctatgacttctgctttgatttctgcttcttcaactccaaggaagtccctaatcctac 151417

                 
Query: 368    tgg 370
              |||
Sbjct: 151418 tgg 151420

>dbj|AK121612.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033043J17, full
            insert sequence
          Length = 4673

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                        
Query: 308  tttctatgccttctgcttcgacttctgcttcttcagctccaatgacgcacctaatcctac 367
            |||||||| ||||||||| || ||||||||||||| |||||| || |  |||||||||||
Sbjct: 4409 tttctatgacttctgctttgatttctgcttcttcaactccaaggaagtccctaatcctac 4350

               
Query: 368  tgg 370
            |||
Sbjct: 4349 tgg 4347

>ref|XM_719537.1| Plasmodium yoelii yoelii str. 17XNL splicing factor 1 (PY04347)
           partial mRNA
          Length = 930

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 317 cttctgcttcgacttctgcttct 339
           |||||||||||||||||||||||
Sbjct: 707 cttctgcttcgacttctgcttct 685

>gb|U40412.1| Caenorhabditis elegans cosmid F46G11, complete sequence
          Length = 21731

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 157 tattatttttattgcactcattctac 182
           ||||||||||| ||||||||||||||
Sbjct: 549 tattatttttaatgcactcattctac 574

>gb|CP000016.1| Candidatus Blochmannia pennsylvanicus str. BPEN, complete genome
          Length = 791654

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 36     aaacaaattggtgtagccagtttaca 61
              |||||||||||||||| |||||||||
Sbjct: 430558 aaacaaattggtgtagtcagtttaca 430583

>ref|XM_548972.2| PREDICTED: Canis familiaris similar to XRP2 protein (LOC491853),
           mRNA
          Length = 1203

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 428 attcagggtagtaccattgga 448
           |||||||||||||||||||||
Sbjct: 580 attcagggtagtaccattgga 560

>emb|AL805937.11| Mouse DNA sequence from clone RP23-139B4 on chromosome X, complete
              sequence
          Length = 178671

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 317    cttctgcttcgacttctgcttcttc 341
              |||||||||| ||||||||||||||
Sbjct: 110719 cttctgcttctacttctgcttcttc 110695

>gb|M98552.2| Caenorhabditis elegans cosmid ZK370, complete sequence
          Length = 38725

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 328   acttctgcttcttcagctcc 347
             ||||||||||||||||||||
Sbjct: 26479 acttctgcttcttcagctcc 26498

>gb|AC073958.4| Homo sapiens BAC clone RP11-533L22 from 7, complete sequence
          Length = 168991

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 152   gttgctattatttttattgc 171
             ||||||||||||||||||||
Sbjct: 57850 gttgctattatttttattgc 57869

>gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome
          Length = 3059876

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 320    ctgcttcgacttctgcttcttcag 343
              ||||||||||||||||||| ||||
Sbjct: 157575 ctgcttcgacttctgcttcgtcag 157598

>emb|AL627143.13| Human DNA sequence from clone RP11-14O9 on chromosome X Contains the 3'
             end of the RP2 gene for retinitis pigmentosa 2 (X-linked
             recessive), a novel gene, the 5' end of a novel gene
             (KIAA0215) and a CpG island, complete sequence
          Length = 81195

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 152   gttgctattatttttattgc 171
             ||||||||||||||||||||
Sbjct: 19804 gttgctattatttttattgc 19785

>emb|AL590445.1|CNS07EGC chromosome V of strain GB-M1 of Encephalitozoon cuniculi (Microspora)
          Length = 211018

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 140   caccccattctcgttgctat 159
             ||||||||||||||||||||
Sbjct: 20081 caccccattctcgttgctat 20062

>gb|AC016644.9| Homo sapiens chromosome 5 clone RP11-52M14, complete sequence
          Length = 157751

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 263   ctagaggttcaaaattgcaa 282
             ||||||||||||||||||||
Sbjct: 41334 ctagaggttcaaaattgcaa 41315

>gb|AC008937.7| Homo sapiens chromosome 5 clone CTD-2310F14, complete sequence
          Length = 171480

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 263 ctagaggttcaaaattgcaa 282
           ||||||||||||||||||||
Sbjct: 277 ctagaggttcaaaattgcaa 258

>gb|AC161621.5| Pan troglodytes BAC clone CH251-164P18 from chromosome unknown, complete
              sequence
          Length = 172032

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 263    ctagaggttcaaaattgcaa 282
              ||||||||||||||||||||
Sbjct: 121151 ctagaggttcaaaattgcaa 121132

>gb|AC007822.4|AC007822 Drosophila melanogaster, chromosome 3R, region 86C-86C, BAC clone
             BACR02E04, complete sequence
          Length = 157607

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 320   ctgcttcgacttctgcttcttcagctcc 347
             |||| ||| |||||||||||||||||||
Sbjct: 35376 ctgcatcggcttctgcttcttcagctcc 35349

>gb|AC007770.5|AC007770 Drosophila melanogaster, chromosome 3R, region 86C-86C, BAC clone
              BACR03J13, complete sequence
          Length = 179260

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 320    ctgcttcgacttctgcttcttcagctcc 347
              |||| ||| |||||||||||||||||||
Sbjct: 163160 ctgcatcggcttctgcttcttcagctcc 163133

>gb|AC009507.3| Homo sapiens BAC clone RP11-543L11 from 2, complete sequence
          Length = 122213

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 186   cccccaccccaccacaaata 205
             ||||||||||||||||||||
Sbjct: 26226 cccccaccccaccacaaata 26207

>gb|AC092623.2| Homo sapiens BAC clone RP11-260E12 from 2, complete sequence
          Length = 172344

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 184   aacccccaccccaccacaaa 203
             ||||||||||||||||||||
Sbjct: 16323 aacccccaccccaccacaaa 16304

>gb|AY103753.1| Zea mays PCO143558 mRNA sequence
          Length = 2771

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                        
Query: 308  tttctatgccttctgcttcgacttctgcttcttcagctccaatg 351
            |||||| | ||| ||||| || ||||||||||||| ||||||||
Sbjct: 2436 tttctacgacttttgctttgatttctgcttcttcaactccaatg 2393

>gb|AE003687.3| Drosophila melanogaster chromosome 3R, section 25 of 118 of the complete
              sequence
          Length = 260168

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 320    ctgcttcgacttctgcttcttcagctcc 347
              |||| ||| |||||||||||||||||||
Sbjct: 216336 ctgcatcggcttctgcttcttcagctcc 216309

>gb|AC163725.4| Pan troglodytes BAC clone CH251-612A20 from chromosome unknown,
            complete sequence
          Length = 179999

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 263  ctagaggttcaaaattgcaa 282
            ||||||||||||||||||||
Sbjct: 4802 ctagaggttcaaaattgcaa 4783

>emb|AL671891.12| Mouse DNA sequence from clone RP23-405E21 on chromosome X, complete
              sequence
          Length = 195749

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 162    tttttattgcactcattcta 181
              ||||||||||||||||||||
Sbjct: 188535 tttttattgcactcattcta 188516


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,405,955
Number of Sequences: 3902068
Number of extensions: 5405955
Number of successful extensions: 111965
Number of sequences better than 10.0: 26
Number of HSP's better than 10.0 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 111863
Number of HSP's gapped (non-prelim): 102
length of query: 463
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 441
effective length of database: 17,147,199,772
effective search space: 7561915099452
effective search space used: 7561915099452
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)