ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl30f08
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_197768.1| Oryza sativa (japonica cultivar-group) putative... 119 7e-24
2gb|AC084763.4| Oryza sativa chromosome 10 BAC OSJNBa0027P10 geno... 119 7e-24
3dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 119 7e-24
4dbj|AK067167.1| Oryza sativa (japonica cultivar-group) cDNA clon... 119 7e-24
5gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 119 7e-24
6emb|AJ821812.1| Guillardia theta partial mRNA for putative methi... 88 3e-14
7gb|AY106642.1| Zea mays PCO120819 mRNA sequence 78 2e-11
8emb|AL442104.2| Oryza sativa genomic DNA, chromosome 4, BAC clon... 60 6e-06
9ref|NM_125558.2| Arabidopsis thaliana PMSR1 (PEPTIDEMETHIONINE S... 54 4e-04
10emb|BX833798.1|CNS0A1UF Arabidopsis thaliana Full-length cDNA Co... 54 4e-04
11gb|BT005850.1| Arabidopsis thaliana At5g61640 gene, complete cds 54 4e-04
12gb|AY088791.1| Arabidopsis thaliana clone 95135 mRNA, complete s... 54 4e-04
13dbj|AB012239.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 54 4e-04
14ref|XM_472921.1| Oryza sativa (japonica cultivar-group), predic... 52 0.001
15ref|XM_472920.1| Oryza sativa (japonica cultivar-group), predic... 52 0.001
16emb|AL606614.3|OSJN00047 Oryza sativa genomic DNA, chromosome 4,... 52 0.001
17dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.001
18dbj|AK064801.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.001
19gb|AY110857.1| Zea mays CL6436_1 mRNA sequence 52 0.001
20gb|AY350715.1| Arabidopsis arenosa clone BAC Aer1B10, complete s... 50 0.006
21gb|AY350713.1| Capsella rubella clone BAC Cr33L6, complete sequence 50 0.006
22gb|AY914027.1| Hylaeus nivicola isolate niv_149 cytochrome oxida... 50 0.006
23gb|AY914002.1| Hylaeus fuscipennis isolate fusMw_218_3C cytochro... 50 0.006
24gb|AY913972.1| Hylaeus andrenoides isolate and_79 cytochrome oxi... 50 0.006
25gb|AY530805.1| Populus balsamifera subsp. trichocarpa x Populus ... 48 0.022
26emb|BX248396.10| Zebrafish DNA sequence from clone CH211-219M13,... 48 0.022
27gb|AY224208.1| Gossypium barbadense peptide methionine sulfoxide... 46 0.086
28emb|AJ617793.1| Secale cereale mRNA for peptide methionine sulfo... 46 0.086
29gb|AE000666.1| Methanothermobacter thermautotrophicus str. Delta... 46 0.086
30ref|XM_519601.1| PREDICTED: Pan troglodytes similar to Peptide m... 44 0.34
31gb|BC054033.1| Homo sapiens methionine sulfoxide reductase A, mR... 44 0.34
32gb|AY350714.1| Olimarabidopsis pumila clone BAC Op37I22, complet... 44 0.34
33gb|BC047552.1| Homo sapiens methionine sulfoxide reductase A, mR... 44 0.34
34ref|NM_012331.2| Homo sapiens methionine sulfoxide reductase A (... 44 0.34
35gb|AF086925.1| Homo sapiens methionine sulfoxide reductase mRNA,... 44 0.34
36emb|AJ242973.1|HSA242973 Homo sapiens mRNA for peptide methionin... 44 0.34
37gb|AC112673.7| Homo sapiens chromosome 8, clone RP11-212F11, com... 44 0.34
38gb|BC102980.1| Bos taurus methionine sulfoxide reductase A, mRNA... 44 0.34
39dbj|AK123132.1| Homo sapiens cDNA FLJ41137 fis, clone BRACE2029849 44 0.34
40dbj|AB220441.1| Macaca fascicularis mRNA, clone QccE-19538: simi... 44 0.34
41ref|NM_174114.2| Bos taurus methionine sulfoxide reductase A (MS... 44 0.34
42gb|AY958432.1| Homo sapiens methionine sulfoxide reductase gene,... 44 0.34
43gb|AY958431.1| Homo sapiens methionine sulfoxide reductase A3 mR... 44 0.34
44gb|AY958430.1| Homo sapiens methionine sulfoxide reductase A2 mR... 44 0.34
45gb|AY958429.1| Homo sapiens methionine sulfoxide reductase A1 mR... 44 0.34
46gb|AF183420.1|AF183420 Homo sapiens peptide methionine sulfoxide... 44 0.34
47gb|BT021044.1| Bos taurus methionine sulfoxide reductase A (MSRA... 44 0.34
48gb|AY690665.1| Homo sapiens cytosolic methionine-S-sulfoxide red... 44 0.34
49gb|U37150.1|BTU37150 Bos taurus peptide methionine sulfoxide red... 44 0.34
50ref|NM_120829.2| Arabidopsis thaliana PMSR3 (PEPTIDEMETHIONINE S... 42 1.3
51gb|AY754788.1| Protomognathus americanus haplotype Z cytochrome ... 42 1.3
52gb|AY754787.1| Protomognathus americanus haplotype Y cytochrome ... 42 1.3
53gb|AY754785.1| Protomognathus americanus haplotype W cytochrome ... 42 1.3
54gb|AY754783.1| Protomognathus americanus haplotype U cytochrome ... 42 1.3
55gb|AY754770.1| Protomognathus americanus haplotype H cytochrome ... 42 1.3
56gb|AY754768.1| Protomognathus americanus haplotype F cytochrome ... 42 1.3
57gb|AY754765.1| Protomognathus americanus haplotype C cytochrome ... 42 1.3
58gb|AY754763.1| Protomognathus americanus haplotype A cytochrome ... 42 1.3
59gb|AC140267.2| Mus musculus BAC clone RP24-303O5 from chromosome... 42 1.3
60gb|AY350710.1| Brassica oleracea clone BAC Bo37N21, partial sequ... 42 1.3
61ref|XM_544163.2| PREDICTED: Canis familiaris similar to Copine-3... 42 1.3
62emb|Z98748.1|HS381E2 Human DNA sequence from clone RP3-381E2 on ... 42 1.3
63emb|AL096678.8|HSDJ122O8 Human DNA sequence from clone RP1-122O8... 42 1.3
64emb|AJ133754.1|ATH133754 Arabidopsis thaliana gene for peptide m... 42 1.3
65emb|AJ133753.1|ATH133753 Arabidopsis thaliana mRNA for peptide m... 42 1.3
66gb|AC093913.2| Homo sapiens BAC clone RP11-768G3 from 4, complet... 42 1.3
67gb|AC155313.2| Mus musculus BAC clone RP23-349D10 from chromosom... 42 1.3
68gb|AC154363.2| Mus musculus BAC clone RP23-154K12 from chromosom... 42 1.3
69gb|AY044316.1| Arabidopsis thaliana peptide methionine sulfoxide... 42 1.3
70emb|BX831567.1|CNS09YSX Arabidopsis thaliana Full-length cDNA Co... 42 1.3
71gb|AY087046.1| Arabidopsis thaliana clone 31014 mRNA, complete s... 42 1.3
72dbj|AK118353.1| Arabidopsis thaliana At5g07470 mRNA for putative... 42 1.3
73gb|AY913999.1| Hylaeus fuscipennis isolate fusL_83_1C cytochrome... 42 1.3
74gb|AY913982.1| Hylaeus connectens isolate conH_32 cytochrome oxi... 42 1.3
75emb|AL163912.1|ATT2I1 Arabidopsis thaliana DNA chromosome 5, BAC... 42 1.3
76emb|AL669860.8| Mouse DNA sequence from clone RP23-227P19 on chr... 42 1.3
77gb|AC154113.1| Medicago truncatula chromosome 2 BAC clone mte1-2... 40 5.3
78gb|AY757207.1| Temnothorax longispinosus haplotype C cytochrome ... 40 5.3
79gb|AY754792.1| Temnothorax longispinosus haplotype C cytochrome ... 40 5.3
80gb|AY657538.1| Synthetic construct Peudomonas aeruginosa clone F... 40 5.3
81gb|AC154746.2| Mus musculus BAC clone RP24-396N7 from chromosome... 40 5.3
82emb|AL358178.14| Human DNA sequence from clone RP11-812I20 on ch... 40 5.3
83emb|AL139115.5| Human DNA sequence from clone RP11-335L15 on chr... 40 5.3
84emb|BX067392.1|CNS09O5W Single read from an extremity of a full-... 40 5.3
85gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 40 5.3
86gb|AC141866.11| Medicago truncatula clone mth2-12p22, complete s... 40 5.3
87dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete g... 40 5.3
88gb|AC154665.2| Mus musculus BAC clone RP24-284M11 from chromosom... 40 5.3
89gb|AE004914.1| Pseudomonas aeruginosa PAO1, section 475 of 529 o... 40 5.3
90gb|AC010877.3|AC010877 Homo sapiens BAC clone RP11-218F6 from Y,... 40 5.3
91emb|BX511094.6| Zebrafish DNA sequence from clone CH211-137G12 i... 40 5.3
92gb|AC139241.4| Mus musculus BAC clone RP24-79L4 from 3, complete... 40 5.3
93gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome 40 5.3 
>ref|NM_197768.1| Oryza sativa (japonica cultivar-group) putative peptide methionine
           sulfoxide reductase (OSJNBa0027P10.3), mRNA
          Length = 1165

 Score =  119 bits (60), Expect = 7e-24
 Identities = 96/108 (88%)
 Strand = Plus / Minus

                                                                       
Query: 290 ttcatccgtagcagcggatggggtcgttgcagcccttctccgtggactgcttgaagccaa 349
           |||| |||||||| ||||||||||||||||| ||||||||||  |||||| |||| || |
Sbjct: 886 ttcacccgtagcaacggatggggtcgttgcaacccttctccgcagactgcctgaacccga 827

                                                           
Query: 350 agcgaccgcccttcgcaaggtactgctggtggtactcttccgccctgt 397
           |||||||||| ||||||||||| |||||||||||||| || |||||||
Sbjct: 826 agcgaccgcctttcgcaaggtattgctggtggtactcctctgccctgt 779
to top
>gb|AC084763.4| Oryza sativa chromosome 10 BAC OSJNBa0027P10 genomic sequence, complete
             sequence
          Length = 141307

 Score =  119 bits (60), Expect = 7e-24
 Identities = 96/108 (88%)
 Strand = Plus / Minus

                                                                         
Query: 290   ttcatccgtagcagcggatggggtcgttgcagcccttctccgtggactgcttgaagccaa 349
             |||| |||||||| ||||||||||||||||| ||||||||||  |||||| |||| || |
Sbjct: 51960 ttcacccgtagcaacggatggggtcgttgcaacccttctccgcagactgcctgaacccga 51901

                                                             
Query: 350   agcgaccgcccttcgcaaggtactgctggtggtactcttccgccctgt 397
             |||||||||| ||||||||||| |||||||||||||| || |||||||
Sbjct: 51900 agcgaccgcctttcgcaaggtattgctggtggtactcctctgccctgt 51853
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  119 bits (60), Expect = 7e-24
 Identities = 96/108 (88%)
 Strand = Plus / Minus

                                                                            
Query: 290      ttcatccgtagcagcggatggggtcgttgcagcccttctccgtggactgcttgaagccaa 349
                |||| |||||||| ||||||||||||||||| ||||||||||  |||||| |||| || |
Sbjct: 21737277 ttcacccgtagcaacggatggggtcgttgcaacccttctccgcagactgcctgaacccga 21737218

                                                                
Query: 350      agcgaccgcccttcgcaaggtactgctggtggtactcttccgccctgt 397
                |||||||||| ||||||||||| |||||||||||||| || |||||||
Sbjct: 21737217 agcgaccgcctttcgcaaggtattgctggtggtactcctctgccctgt 21737170
to top
>dbj|AK067167.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013096G11, full
           insert sequence
          Length = 1118

 Score =  119 bits (60), Expect = 7e-24
 Identities = 96/108 (88%)
 Strand = Plus / Minus

                                                                       
Query: 290 ttcatccgtagcagcggatggggtcgttgcagcccttctccgtggactgcttgaagccaa 349
           |||| |||||||| ||||||||||||||||| ||||||||||  |||||| |||| || |
Sbjct: 899 ttcacccgtagcaacggatggggtcgttgcaacccttctccgcagactgcctgaacccga 840

                                                           
Query: 350 agcgaccgcccttcgcaaggtactgctggtggtactcttccgccctgt 397
           |||||||||| ||||||||||| |||||||||||||| || |||||||
Sbjct: 839 agcgaccgcctttcgcaaggtattgctggtggtactcctctgccctgt 792
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  119 bits (60), Expect = 7e-24
 Identities = 96/108 (88%)
 Strand = Plus / Minus

                                                                            
Query: 290      ttcatccgtagcagcggatggggtcgttgcagcccttctccgtggactgcttgaagccaa 349
                |||| |||||||| ||||||||||||||||| ||||||||||  |||||| |||| || |
Sbjct: 21748940 ttcacccgtagcaacggatggggtcgttgcaacccttctccgcagactgcctgaacccga 21748881

                                                                
Query: 350      agcgaccgcccttcgcaaggtactgctggtggtactcttccgccctgt 397
                |||||||||| ||||||||||| |||||||||||||| || |||||||
Sbjct: 21748880 agcgaccgcctttcgcaaggtattgctggtggtactcctctgccctgt 21748833
to top
>emb|AJ821812.1| Guillardia theta partial mRNA for putative methionine sulfoxide
           reductase (msr gene)
          Length = 663

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 295 ccgtagcagcggatggggtcgttgcagcccttctccgtggactgcttgaagccaaagcga 354
           |||||||| ||||||||||||||||| |||||  | |  ||||||||| |||||||||| 
Sbjct: 659 ccgtagcaacggatggggtcgttgcatcccttagcggcagactgcttggagccaaagcgt 600

                                           
Query: 355 ccgcccttcgcaaggtactgctggtggtactc 386
           || |||||| |||||||||||||||| |||||
Sbjct: 599 cctcccttctcaaggtactgctggtgatactc 568
to top
>gb|AY106642.1| Zea mays PCO120819 mRNA sequence
          Length = 747

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 84/99 (84%)
 Strand = Plus / Minus

                                                                       
Query: 291 tcatccgtagcagcggatggggtcgttgcagcccttctccgtggactgcttgaagccaaa 350
           |||||||||||| ||||||||||| |||||||||||  | |  || |||  |||||| ||
Sbjct: 519 tcatccgtagcatcggatggggtcattgcagcccttggctgcagattgcccgaagccgaa 460

                                                  
Query: 351 gcgaccgcccttcgcaaggtactgctggtggtactcttc 389
           ||| ||||||||| | ||||||||||| |||||||||||
Sbjct: 459 gcggccgcccttctccaggtactgctgatggtactcttc 421
to top
>emb|AL442104.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0510A06, complete
             sequence
          Length = 90767

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                               
Query: 295   ccgtagcagcggatggggtcgttgcagcccttct 328
             |||||||||||||||||||||||||||| |||||
Sbjct: 70724 ccgtagcagcggatggggtcgttgcagctcttct 70757



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                               
Query: 295   ccgtagcagcggatggggtcgttgcagcccttct 328
             ||||||| ||||||||||||| ||||||||||||
Sbjct: 77297 ccgtagcggcggatggggtcggtgcagcccttct 77330
to top
>ref|NM_125558.2| Arabidopsis thaliana PMSR1 (PEPTIDEMETHIONINE SULFOXIDE REDUCTASE
           1); protein-methionine-S-oxide reductase AT5G61640
           (PMSR1) mRNA, complete cds
          Length = 924

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 295 ccgtagcagcggatggggtcgttgcagcccttctccgtggactgctt 341
           |||||||||||||| |||||||||||||| || ||||| || |||||
Sbjct: 677 ccgtagcagcggattgggtcgttgcagcctttttccgttgattgctt 631
to top
>emb|BX833798.1|CNS0A1UF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL77ZH09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 879

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 295 ccgtagcagcggatggggtcgttgcagcccttctccgtggactgctt 341
           |||||||||||||| |||||||||||||| || ||||| || |||||
Sbjct: 658 ccgtagcagcggattgggtcgttgcagcctttttccgttgattgctt 612
to top
>gb|BT005850.1| Arabidopsis thaliana At5g61640 gene, complete cds
          Length = 609

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 295 ccgtagcagcggatggggtcgttgcagcccttctccgtggactgctt 341
           |||||||||||||| |||||||||||||| || ||||| || |||||
Sbjct: 605 ccgtagcagcggattgggtcgttgcagcctttttccgttgattgctt 559
to top
>gb|AY088791.1| Arabidopsis thaliana clone 95135 mRNA, complete sequence
          Length = 815

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 295 ccgtagcagcggatggggtcgttgcagcccttctccgtggactgctt 341
           |||||||||||||| |||||||||||||| || ||||| || |||||
Sbjct: 677 ccgtagcagcggattgggtcgttgcagcctttttccgttgattgctt 631
to top
>dbj|AB012239.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K11J9
          Length = 69142

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                            
Query: 295   ccgtagcagcggatggggtcgttgcagcccttctccgtggactgctt 341
             |||||||||||||| |||||||||||||| || ||||| || |||||
Sbjct: 50718 ccgtagcagcggattgggtcgttgcagcctttttccgttgattgctt 50672
to top
>ref|XM_472921.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 573

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 295 ccgtagcagcggatggggtcgttgcagcccttct 328
           ||||||| ||||||||||||| ||||||||||||
Sbjct: 569 ccgtagcggcggatggggtcggtgcagcccttct 536
to top
>ref|XM_472920.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 564

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 295 ccgtagcagcggatggggtcgttgcagcccttct 328
           |||||||| ||||||||||||||||||| |||||
Sbjct: 560 ccgtagcaacggatggggtcgttgcagctcttct 527
to top
>emb|AL606614.3|OSJN00047 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0011N17,
             complete sequence
          Length = 129498

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                               
Query: 295   ccgtagcagcggatggggtcgttgcagcccttct 328
             ||||||| ||||||||||||| ||||||||||||
Sbjct: 81311 ccgtagcggcggatggggtcggtgcagcccttct 81344



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                               
Query: 295   ccgtagcagcggatggggtcgttgcagcccttct 328
             |||||||| ||||||||||||||||||| |||||
Sbjct: 75636 ccgtagcaacggatggggtcgttgcagctcttct 75669
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                                  
Query: 295      ccgtagcagcggatggggtcgttgcagcccttct 328
                ||||||| ||||||||||||| ||||||||||||
Sbjct: 24084332 ccgtagcggcggatggggtcggtgcagcccttct 24084365



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                                  
Query: 295      ccgtagcagcggatggggtcgttgcagcccttct 328
                |||||||| ||||||||||||||||||| |||||
Sbjct: 24078657 ccgtagcaacggatggggtcgttgcagctcttct 24078690
to top
>dbj|AK064801.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000D08, full
           insert sequence
          Length = 1032

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 295 ccgtagcagcggatggggtcgttgcagcccttct 328
           |||||||| ||||||||||||||||||| |||||
Sbjct: 640 ccgtagcaacggatggggtcgttgcagctcttct 607
to top
>gb|AY110857.1| Zea mays CL6436_1 mRNA sequence
          Length = 905

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 295 ccgtagcagcggatggggtcgttgcagcccttct 328
           ||||||||||||||||| ||| ||||||||||||
Sbjct: 647 ccgtagcagcggatgggatcgctgcagcccttct 614



 Score = 48.1 bits (24), Expect = 0.022
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 355 ccgcccttcgcaaggtactgctggtggtactc 386
           ||||||||| | ||||||||||||||||||||
Sbjct: 602 ccgcccttctcgaggtactgctggtggtactc 571
to top
>gb|AY350715.1| Arabidopsis arenosa clone BAC Aer1B10, complete sequence
          Length = 78945

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 295  ccgtagcagcggatggggtcgttgcagcc 323
            |||||||||||||| ||||||||||||||
Sbjct: 4660 ccgtagcagcggattgggtcgttgcagcc 4688
to top
>gb|AY350713.1| Capsella rubella clone BAC Cr33L6, complete sequence
          Length = 74492

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 295  ccgtagcagcggatggggtcgttgcagcc 323
            |||||||||||||| ||||||||||||||
Sbjct: 1143 ccgtagcagcggattgggtcgttgcagcc 1171
to top
>gb|AY914027.1| Hylaeus nivicola isolate niv_149 cytochrome oxidase subunit I (COI)
           gene, partial cds; tRNA-Leu gene, complete sequence; and
           cytochrome oxidase subunit II (COII) gene, partial cds;
           mitochondrial
          Length = 1199

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 5   aatttgataacataattcccgtaagtcct 33
           ||||||||||||||||||| |||||||||
Sbjct: 361 aatttgataacataattcctgtaagtcct 333
to top
>gb|AY914002.1| Hylaeus fuscipennis isolate fusMw_218_3C cytochrome oxidase subunit
           I (COI) gene, partial cds; tRNA-Leu gene, complete
           sequence; and cytochrome oxidase subunit II (COII) gene,
           partial cds; mitochondrial
          Length = 1201

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 5   aatttgataacataattcccgtaagtcct 33
           ||||||||||||||||||| |||||||||
Sbjct: 361 aatttgataacataattcctgtaagtcct 333
to top
>gb|AY913972.1| Hylaeus andrenoides isolate and_79 cytochrome oxidase subunit I
           (COI) gene, partial cds; tRNA-Leu gene, complete
           sequence; and cytochrome oxidase subunit II (COII) gene,
           partial cds; mitochondrial
          Length = 1200

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 5   aatttgataacataattcccgtaagtcct 33
           |||||||||| ||||||||||||||||||
Sbjct: 361 aatttgataatataattcccgtaagtcct 333
to top
>gb|AY530805.1| Populus balsamifera subsp. trichocarpa x Populus deltoides
           methionine sulfoxide reductase A mRNA, complete cds;
           nuclear gene for plastid product
          Length = 816

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 358 cccttcgcaaggtactgctggtggtactcttc 389
           ||||||||||| |||||||||||||| |||||
Sbjct: 749 cccttcgcaagatactgctggtggtattcttc 718
to top
>emb|BX248396.10| Zebrafish DNA sequence from clone CH211-219M13, complete sequence
          Length = 196673

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 266   ttgcaggtcaggtcaccaggcttg 289
             ||||||||||||||||||||||||
Sbjct: 43600 ttgcaggtcaggtcaccaggcttg 43623
to top
>gb|AY224208.1| Gossypium barbadense peptide methionine sulfoxide reductase (PMSR)
           mRNA, complete cds
          Length = 1059

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 346 ccaaagcgaccgcccttcgcaaggtactgctggtg 380
           ||||| ||||| ||||| |||||||||||||||||
Sbjct: 731 ccaaaacgacctccctttgcaaggtactgctggtg 697
to top
>emb|AJ617793.1| Secale cereale mRNA for peptide methionine sulfoxide reductase
           (msrA gene)
          Length = 807

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 290 ttcatccgtagcagcggatggggtcgttgcagcccttct 328
           |||| |||||||||||||||||||||  ||||| |||||
Sbjct: 609 ttcagccgtagcagcggatggggtcggagcagcgcttct 571



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 355 ccgcccttcgcaaggtactgctggtggta 383
           ||||||||| | |||||||||||||||||
Sbjct: 559 ccgcccttctcgaggtactgctggtggta 531
to top
>gb|AE000666.1| Methanothermobacter thermautotrophicus str. Delta H, complete genome
          Length = 1751377

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 360    cttcgcaaggtactgctggtggtactc 386
              |||| ||||||||||||||||||||||
Sbjct: 478764 cttctcaaggtactgctggtggtactc 478738
to top
>ref|XM_519601.1| PREDICTED: Pan troglodytes similar to Peptide methionine sulfoxide
            reductase (Protein-methionine-S-oxide reductase) (PMSR)
            (Peptide Met(O) reductase) (LOC463983), mRNA
          Length = 2295

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 367  aggtactgctggtggtactcttccgc 392
            ||||||||||||||||| ||||||||
Sbjct: 2222 aggtactgctggtggtagtcttccgc 2197
to top
>gb|BC054033.1| Homo sapiens methionine sulfoxide reductase A, mRNA (cDNA clone
           MGC:64957 IMAGE:6504055), complete cds
          Length = 1496

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 367 aggtactgctggtggtactcttccgc 392
           ||||||||||||||||| ||||||||
Sbjct: 832 aggtactgctggtggtagtcttccgc 807
to top
>gb|AY350714.1| Olimarabidopsis pumila clone BAC Op37I22, complete sequence
          Length = 84869

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 290   ttcatccgtagcagcggatggggtcgttgcagcc 323
             |||| |||||||||||||| ||||| ||||||||
Sbjct: 49940 ttcagccgtagcagcggatagggtcattgcagcc 49973



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 295   ccgtagcagcggatggggtcgttgcagc 322
             |||||||||||||| ||||| |||||||
Sbjct: 48388 ccgtagcagcggatagggtccttgcagc 48415



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 295   ccgtagcagcggatggggtcgttgcagc 322
             |||||||||||||| ||||| |||||||
Sbjct: 46112 ccgtagcagcggatagggtctttgcagc 46139
to top
>gb|BC047552.1| Homo sapiens methionine sulfoxide reductase A, mRNA (cDNA clone
            IMAGE:5302099), with apparent retained intron
          Length = 1722

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 367  aggtactgctggtggtactcttccgc 392
            ||||||||||||||||| ||||||||
Sbjct: 1056 aggtactgctggtggtagtcttccgc 1031
to top
>ref|NM_012331.2| Homo sapiens methionine sulfoxide reductase A (MSRA), mRNA
          Length = 1502

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 367 aggtactgctggtggtactcttccgc 392
           ||||||||||||||||| ||||||||
Sbjct: 847 aggtactgctggtggtagtcttccgc 822
to top
>gb|AF086925.1| Homo sapiens methionine sulfoxide reductase mRNA, complete cds
          Length = 1349

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 367 aggtactgctggtggtactcttccgc 392
           ||||||||||||||||| ||||||||
Sbjct: 702 aggtactgctggtggtagtcttccgc 677
to top
>emb|AJ242973.1|HSA242973 Homo sapiens mRNA for peptide methionine sulfoxide reductase (msrA
           gene)
          Length = 1350

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 367 aggtactgctggtggtactcttccgc 392
           ||||||||||||||||| ||||||||
Sbjct: 847 aggtactgctggtggtagtcttccgc 822
to top
>gb|AC112673.7| Homo sapiens chromosome 8, clone RP11-212F11, complete sequence
          Length = 167547

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 367  aggtactgctggtggtactcttccgc 392
            ||||||||||||||||| ||||||||
Sbjct: 7095 aggtactgctggtggtagtcttccgc 7120
to top
>gb|BC102980.1| Bos taurus methionine sulfoxide reductase A, mRNA (cDNA clone
           MGC:128238 IMAGE:7985018), complete cds
          Length = 1377

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 367 aggtactgctggtggtactcttccgc 392
           ||||||||||||||||| ||||||||
Sbjct: 690 aggtactgctggtggtaatcttccgc 665
to top
>dbj|AK123132.1| Homo sapiens cDNA FLJ41137 fis, clone BRACE2029849
          Length = 1919

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 367  aggtactgctggtggtactcttccgc 392
            ||||||||||||||||| ||||||||
Sbjct: 1275 aggtactgctggtggtagtcttccgc 1250
to top
>dbj|AB220441.1| Macaca fascicularis mRNA, clone QccE-19538: similar to Homo sapiens
           methionine sulfoxide reductase A (MSRA), NM_012331.2
          Length = 1455

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 367 aggtactgctggtggtactcttccgc 392
           ||||||||||||||||| ||||||||
Sbjct: 781 aggtactgctggtggtagtcttccgc 756
to top
>ref|NM_174114.2| Bos taurus methionine sulfoxide reductase A (MSRA), mRNA
          Length = 1370

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 367 aggtactgctggtggtactcttccgc 392
           ||||||||||||||||| ||||||||
Sbjct: 693 aggtactgctggtggtaatcttccgc 668
to top
>gb|AY958432.1| Homo sapiens methionine sulfoxide reductase gene, complete cds,
              alternatively spliced
          Length = 379048

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 367    aggtactgctggtggtactcttccgc 392
              ||||||||||||||||| ||||||||
Sbjct: 376398 aggtactgctggtggtagtcttccgc 376373
to top
>gb|AY958431.1| Homo sapiens methionine sulfoxide reductase A3 mRNA, complete cds,
           alternatively spliced
          Length = 1631

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 367 aggtactgctggtggtactcttccgc 392
           ||||||||||||||||| ||||||||
Sbjct: 981 aggtactgctggtggtagtcttccgc 956
to top
>gb|AY958430.1| Homo sapiens methionine sulfoxide reductase A2 mRNA, complete cds,
            alternatively spliced
          Length = 1706

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 367  aggtactgctggtggtactcttccgc 392
            ||||||||||||||||| ||||||||
Sbjct: 1056 aggtactgctggtggtagtcttccgc 1031
to top
>gb|AY958429.1| Homo sapiens methionine sulfoxide reductase A1 mRNA, complete cds,
           alternatively spliced
          Length = 1527

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 367 aggtactgctggtggtactcttccgc 392
           ||||||||||||||||| ||||||||
Sbjct: 883 aggtactgctggtggtagtcttccgc 858
to top
>gb|AF183420.1|AF183420 Homo sapiens peptide methionine sulfoxide reductase mRNA, complete
           cds
          Length = 1343

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 367 aggtactgctggtggtactcttccgc 392
           ||||||||||||||||| ||||||||
Sbjct: 689 aggtactgctggtggtagtcttccgc 664
to top
>gb|BT021044.1| Bos taurus methionine sulfoxide reductase A (MSRA), mRNA, complete
           cds
          Length = 1350

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 367 aggtactgctggtggtactcttccgc 392
           ||||||||||||||||| ||||||||
Sbjct: 678 aggtactgctggtggtaatcttccgc 653
to top
>gb|AY690665.1| Homo sapiens cytosolic methionine-S-sulfoxide reductase (MSRA)
           mRNA, complete cds, alternatively spliced
          Length = 1157

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 367 aggtactgctggtggtactcttccgc 392
           ||||||||||||||||| ||||||||
Sbjct: 652 aggtactgctggtggtagtcttccgc 627
to top
>gb|U37150.1|BTU37150 Bos taurus peptide methionine sulfoxide reductase (msrA) mRNA,
           complete cds
          Length = 1370

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 367 aggtactgctggtggtactcttccgc 392
           ||||||||||||||||| ||||||||
Sbjct: 693 aggtactgctggtggtaatcttccgc 668
to top
>ref|NM_120829.2| Arabidopsis thaliana PMSR3 (PEPTIDEMETHIONINE SULFOXIDE REDUCTASE
           3); protein-methionine-S-oxide reductase AT5G07470
           (PMSR3) mRNA, complete cds
          Length = 887

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 295 ccgtagcagcggatggggtcgttgcagcc 323
           ||||| |||||||| ||||||||||||||
Sbjct: 693 ccgtaacagcggattgggtcgttgcagcc 665
to top
>gb|AY754788.1| Protomognathus americanus haplotype Z cytochrome oxidase subunit I
           (COI) gene, partial cds; tRNA-Leu gene, complete
           sequence; and cytochrome oxidase subunit II (COII) gene,
           partial cds; mitochondrial
          Length = 1403

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 5   aatttgataacataattcccgtaag 29
           ||||||||||||||||||| |||||
Sbjct: 331 aatttgataacataattcctgtaag 307
to top
>gb|AY754787.1| Protomognathus americanus haplotype Y cytochrome oxidase subunit I
           (COI) gene, partial cds; tRNA-Leu gene, complete
           sequence; and cytochrome oxidase subunit II (COII) gene,
           partial cds; mitochondrial
          Length = 1403

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 5   aatttgataacataattcccgtaag 29
           ||||||||||||||||||| |||||
Sbjct: 331 aatttgataacataattcctgtaag 307
to top
>gb|AY754785.1| Protomognathus americanus haplotype W cytochrome oxidase subunit I
           (COI) gene, partial cds; tRNA-Leu gene, complete
           sequence; and cytochrome oxidase subunit II (COII) gene,
           partial cds; mitochondrial
          Length = 1403

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 5   aatttgataacataattcccgtaag 29
           ||||||||||||||||||| |||||
Sbjct: 331 aatttgataacataattcctgtaag 307
to top
>gb|AY754783.1| Protomognathus americanus haplotype U cytochrome oxidase subunit I
           (COI) gene, partial cds; tRNA-Leu gene, complete
           sequence; and cytochrome oxidase subunit II (COII) gene,
           partial cds; mitochondrial
          Length = 1402

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 5   aatttgataacataattcccgtaag 29
           ||||||||||||||||||| |||||
Sbjct: 331 aatttgataacataattcctgtaag 307
to top
>gb|AY754770.1| Protomognathus americanus haplotype H cytochrome oxidase subunit I
           (COI) gene, partial cds; tRNA-Leu gene, complete
           sequence; and cytochrome oxidase subunit II (COII) gene,
           partial cds; mitochondrial
          Length = 1403

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 5   aatttgataacataattcccgtaag 29
           ||||||||||||||||||| |||||
Sbjct: 331 aatttgataacataattcctgtaag 307
to top
>gb|AY754768.1| Protomognathus americanus haplotype F cytochrome oxidase subunit I
           (COI) gene, partial cds; tRNA-Leu gene, complete
           sequence; and cytochrome oxidase subunit II (COII) gene,
           partial cds; mitochondrial
          Length = 1403

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 5   aatttgataacataattcccgtaag 29
           ||||||||||||||||||| |||||
Sbjct: 331 aatttgataacataattcctgtaag 307
to top
>gb|AY754765.1| Protomognathus americanus haplotype C cytochrome oxidase subunit I
           (COI) gene, partial cds; tRNA-Leu gene, complete
           sequence; and cytochrome oxidase subunit II (COII) gene,
           partial cds; mitochondrial
          Length = 1403

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 5   aatttgataacataattcccgtaag 29
           ||||||||||||||||||| |||||
Sbjct: 331 aatttgataacataattcctgtaag 307
to top
>gb|AY754763.1| Protomognathus americanus haplotype A cytochrome oxidase subunit I
           (COI) gene, partial cds; tRNA-Leu gene, complete
           sequence; and cytochrome oxidase subunit II (COII) gene,
           partial cds; mitochondrial
          Length = 1403

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 5   aatttgataacataattcccgtaag 29
           ||||||||||||||||||| |||||
Sbjct: 331 aatttgataacataattcctgtaag 307
to top
>gb|AC140267.2| Mus musculus BAC clone RP24-303O5 from chromosome 15, complete sequence
          Length = 169842

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 315   gttgcagcccttctccgtgga 335
             |||||||||||||||||||||
Sbjct: 19695 gttgcagcccttctccgtgga 19675
to top
>gb|AY350710.1| Brassica oleracea clone BAC Bo37N21, partial sequence
          Length = 78346

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 295   ccgtagcagcggatggggtcgttgcagcc 323
             |||||||||||||| |||||| |||||||
Sbjct: 15425 ccgtagcagcggattgggtcggtgcagcc 15453
to top
>ref|XM_544163.2| PREDICTED: Canis familiaris similar to Copine-3 (Copine III)
            (LOC487034), mRNA
          Length = 2523

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 193  agtgaaattcagctgacatcc 213
            |||||||||||||||||||||
Sbjct: 1401 agtgaaattcagctgacatcc 1381
to top
>emb|Z98748.1|HS381E2 Human DNA sequence from clone RP3-381E2 on chromosome 6p12, complete
             sequence
          Length = 111398

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 51    acattaaaataaactttatta 71
             |||||||||||||||||||||
Sbjct: 60422 acattaaaataaactttatta 60402
to top
>emb|AL096678.8|HSDJ122O8 Human DNA sequence from clone RP1-122O8 on chromosome 6q14.2-16.1
              Contains the 3' end of the ANKRD6 gene for ankyrin repeat
              domain 6 (KIAA0957), the 5' end of a novel gene, the 3' end
              of the MDN1 gene for midasin homolog (yeast) (KIAA0301), a
              novel gene and a CpG island, complete sequence
          Length = 140211

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 42     atttttacgacattaaaataaactt 66
              ||||||| |||||||||||||||||
Sbjct: 123786 atttttatgacattaaaataaactt 123810
to top
>emb|AJ133754.1|ATH133754 Arabidopsis thaliana gene for peptide methionine sulfoxide reductase
          Length = 2650

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 295  ccgtagcagcggatggggtcgttgcagcc 323
            ||||| |||||||| ||||||||||||||
Sbjct: 2242 ccgtaacagcggattgggtcgttgcagcc 2214
to top
>emb|AJ133753.1|ATH133753 Arabidopsis thaliana mRNA for peptide methionine sulfoxide
           reductase
          Length = 907

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 295 ccgtagcagcggatggggtcgttgcagcc 323
           ||||| |||||||| ||||||||||||||
Sbjct: 699 ccgtaacagcggattgggtcgttgcagcc 671
to top
>gb|AC093913.2| Homo sapiens BAC clone RP11-768G3 from 4, complete sequence
          Length = 192059

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 190    tgtagtgaaattcagctgaca 210
              |||||||||||||||||||||
Sbjct: 115843 tgtagtgaaattcagctgaca 115823
to top
>gb|AC155313.2| Mus musculus BAC clone RP23-349D10 from chromosome 15, complete sequence
          Length = 213367

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 315    gttgcagcccttctccgtgga 335
              |||||||||||||||||||||
Sbjct: 158807 gttgcagcccttctccgtgga 158787
to top
>gb|AC154363.2| Mus musculus BAC clone RP23-154K12 from chromosome 13, complete sequence
          Length = 203241

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 27     aagtccttataatccattttt 47
              |||||||||||||||||||||
Sbjct: 168143 aagtccttataatccattttt 168123
to top
>gb|AY044316.1| Arabidopsis thaliana peptide methionine sulfoxide reductase (msr)
           (T2I1_180) mRNA, complete cds
          Length = 675

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 295 ccgtagcagcggatggggtcgttgcagcc 323
           ||||| |||||||| ||||||||||||||
Sbjct: 605 ccgtaacagcggattgggtcgttgcagcc 577
to top
>emb|BX831567.1|CNS09YSX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH16ZA01 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1689

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 295  ccgtagcagcggatggggtcgttgcagcc 323
            ||||| |||||||| ||||||||||||||
Sbjct: 1527 ccgtaacagcggattgggtcgttgcagcc 1499
to top
>gb|AY087046.1| Arabidopsis thaliana clone 31014 mRNA, complete sequence
          Length = 879

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 295 ccgtagcagcggatggggtcgttgcagcc 323
           ||||| |||||||| ||||||||||||||
Sbjct: 693 ccgtaacagcggattgggtcgttgcagcc 665
to top
>dbj|AK118353.1| Arabidopsis thaliana At5g07470 mRNA for putative peptide methionine
           sulfoxide reductase (msr), complete cds, clone:
           RAFL19-62-B14
          Length = 735

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 295 ccgtagcagcggatggggtcgttgcagcc 323
           ||||| |||||||| ||||||||||||||
Sbjct: 590 ccgtaacagcggattgggtcgttgcagcc 562
to top
>gb|AY913999.1| Hylaeus fuscipennis isolate fusL_83_1C cytochrome oxidase subunit I
           (COI) gene, partial cds; tRNA-Leu gene, complete
           sequence; and cytochrome oxidase subunit II (COII) gene,
           partial cds; mitochondrial
          Length = 1201

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 5   aatttgataacataattcccgtaagtcct 33
           ||||||| ||||||||||| |||||||||
Sbjct: 361 aatttgacaacataattcctgtaagtcct 333
to top
>gb|AY913982.1| Hylaeus connectens isolate conH_32 cytochrome oxidase subunit I
           (COI) gene, partial cds; tRNA-Leu gene, complete
           sequence; and cytochrome oxidase subunit II (COII) gene,
           partial cds; mitochondrial
          Length = 1199

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 5   aatttgataacataattcccgtaagtcct 33
           ||||||||||||||||||| || ||||||
Sbjct: 361 aatttgataacataattcctgtgagtcct 333
to top
>emb|AL163912.1|ATT2I1 Arabidopsis thaliana DNA chromosome 5, BAC clone T2I1 (ESSA project)
          Length = 116763

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 295   ccgtagcagcggatggggtcgttgcagcc 323
             ||||| |||||||| ||||||||||||||
Sbjct: 77933 ccgtaacagcggattgggtcgttgcagcc 77961
to top
>emb|AL669860.8| Mouse DNA sequence from clone RP23-227P19 on chromosome 4, complete
             sequence
          Length = 131275

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 273   tcaggtcaccaggcttgttca 293
             |||||||||||||||||||||
Sbjct: 53103 tcaggtcaccaggcttgttca 53123
to top
>gb|AC154113.1| Medicago truncatula chromosome 2 BAC clone mte1-25a23, complete
             sequence
          Length = 42983

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 185   aaaactgtagtgaaattcag 204
             ||||||||||||||||||||
Sbjct: 40143 aaaactgtagtgaaattcag 40124
to top
>gb|AY757207.1| Temnothorax longispinosus haplotype C cytochrome oxidase subunit I
           (COI) gene, partial cds; mitochondrial
          Length = 761

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 5   aatttgataacataattcccgtaagtcc 32
           |||||||||  |||||||||||||||||
Sbjct: 331 aatttgatagtataattcccgtaagtcc 304
to top
>gb|AY754792.1| Temnothorax longispinosus haplotype C cytochrome oxidase subunit I
           (COI) gene, partial cds; tRNA-Leu gene, complete
           sequence; and cytochrome oxidase subunit II (COII) gene,
           partial cds; mitochondrial
          Length = 1414

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 5   aatttgataacataattcccgtaagtcc 32
           |||||||||  |||||||||||||||||
Sbjct: 331 aatttgatagtataattcccgtaagtcc 304
to top
>gb|AY657538.1| Synthetic construct Peudomonas aeruginosa clone FLH040532.01F
           PA5018 gene, partial cds
          Length = 648

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 360 cttcgcaaggtactgctggtggta 383
           |||||| |||||||||||||||||
Sbjct: 594 cttcgccaggtactgctggtggta 571
to top
>gb|AC154746.2| Mus musculus BAC clone RP24-396N7 from chromosome 14, complete sequence
          Length = 184783

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 50    gacattaaaataaactttat 69
             ||||||||||||||||||||
Sbjct: 84160 gacattaaaataaactttat 84179
to top
>emb|AL358178.14| Human DNA sequence from clone RP11-812I20 on chromosome 6 Contains part
             of the gene for CD2-associated protein and a 40S ribosomal
             protein S12 (RPS12) pseudogene, complete sequence
          Length = 77432

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 45    tttacgacattaaaataaacttta 68
             ||||| ||||||||||||||||||
Sbjct: 49991 tttacaacattaaaataaacttta 49968
to top
>emb|AL139115.5| Human DNA sequence from clone RP11-335L15 on chromosome 9 Contains the
             3' end of the SH3GL2 gene for SH3-domain GRB2-like 2
             (CNSA2, SH3P4, EEN-B1, SH3D2A), complete sequence
          Length = 148082

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 266   ttgcaggtcaggtcaccaggcttg 289
             ||||||||||||||| ||||||||
Sbjct: 87120 ttgcaggtcaggtcagcaggcttg 87143
to top
>emb|BX067392.1|CNS09O5W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 37  aatccatttttacgacattaaaat 60
           ||||||||||||||||||| ||||
Sbjct: 916 aatccatttttacgacattcaaat 893
to top
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 360    cttcgcaaggtactgctggtggta 383
              |||||| |||||||||||||||||
Sbjct: 585513 cttcgccaggtactgctggtggta 585536
to top
>gb|AC141866.11| Medicago truncatula clone mth2-12p22, complete sequence
          Length = 126907

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 185    aaaactgtagtgaaattcag 204
              ||||||||||||||||||||
Sbjct: 113138 aaaactgtagtgaaattcag 113157
to top
>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome
          Length = 2696255

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 367     aggtactgctggtggtactc 386
               ||||||||||||||||||||
Sbjct: 2306487 aggtactgctggtggtactc 2306468
to top
>gb|AC154665.2| Mus musculus BAC clone RP24-284M11 from chromosome 13, complete sequence
          Length = 185286

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     ttttacgacattaaaataaacttt 67
              ||||| ||||||||||||||||||
Sbjct: 123773 ttttatgacattaaaataaacttt 123796
to top
>gb|AE004914.1| Pseudomonas aeruginosa PAO1, section 475 of 529 of the complete
            genome
          Length = 11650

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 360  cttcgcaaggtactgctggtggta 383
            |||||| |||||||||||||||||
Sbjct: 8412 cttcgccaggtactgctggtggta 8389
to top
>gb|AC010877.3|AC010877 Homo sapiens BAC clone RP11-218F6 from Y, complete sequence
          Length = 137229

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 331    gtggactgcttgaagccaaa 350
              ||||||||||||||||||||
Sbjct: 123548 gtggactgcttgaagccaaa 123529
to top
>emb|BX511094.6| Zebrafish DNA sequence from clone CH211-137G12 in linkage group 19,
             complete sequence
          Length = 154360

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 248   tgctgcttgtgtgcttcctt 267
             ||||||||||||||||||||
Sbjct: 46350 tgctgcttgtgtgcttcctt 46369
to top
>gb|AC139241.4| Mus musculus BAC clone RP24-79L4 from 3, complete sequence
          Length = 200361

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 273    tcaggtcaccaggcttgttc 292
              ||||||||||||||||||||
Sbjct: 141372 tcaggtcaccaggcttgttc 141391
to top
>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome
          Length = 2695903

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 367     aggtactgctggtggtactc 386
               ||||||||||||||||||||
Sbjct: 2010550 aggtactgctggtggtactc 2010569


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,515,059
Number of Sequences: 3902068
Number of extensions: 3515059
Number of successful extensions: 73740
Number of sequences better than 10.0: 93
Number of HSP's better than 10.0 without gapping: 93
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 73541
Number of HSP's gapped (non-prelim): 198
length of query: 397
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 375
effective length of database: 17,147,199,772
effective search space: 6430199914500
effective search space used: 6430199914500
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top