Clone Name | rbastl30f01 |
---|---|
Clone Library Name | barley_pub |
>ref|NM_189326.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 3042 Score = 101 bits (51), Expect = 2e-18 Identities = 72/79 (91%) Strand = Plus / Minus Query: 364 ggggccctgatgacctgcaggatctggaccacctccgccatggacggccggttcgacggg 423 |||||| |||||||||||||||||||||| ||||| ||||||||||| ||||| || ||| Sbjct: 3005 ggggccttgatgacctgcaggatctggacgacctcggccatggacgggcggttggatggg 2946 Query: 424 atctgcgacgtgcatacca 442 |||||||||||||| |||| Sbjct: 2945 atctgcgacgtgcacacca 2927
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 101 bits (51), Expect = 2e-18 Identities = 72/79 (91%) Strand = Plus / Minus Query: 364 ggggccctgatgacctgcaggatctggaccacctccgccatggacggccggttcgacggg 423 |||||| |||||||||||||||||||||| ||||| ||||||||||| ||||| || ||| Sbjct: 42179716 ggggccttgatgacctgcaggatctggacgacctcggccatggacgggcggttggatggg 42179657 Query: 424 atctgcgacgtgcatacca 442 |||||||||||||| |||| Sbjct: 42179656 atctgcgacgtgcacacca 42179638 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 208 atctatgcatgcatgcatgcatgg 231 ||||||| |||||||||||||||| Sbjct: 41184391 atctatgtatgcatgcatgcatgg 41184414 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 25999375 tatgcatgcatgcatgcatg 25999356 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 3171388 atgcatgcatgcatgcatgg 3171369 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 3155576 atgcatgcatgcatgcatgg 3155557
>dbj|AP004326.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ1294_F06 Length = 121088 Score = 101 bits (51), Expect = 2e-18 Identities = 72/79 (91%) Strand = Plus / Minus Query: 364 ggggccctgatgacctgcaggatctggaccacctccgccatggacggccggttcgacggg 423 |||||| |||||||||||||||||||||| ||||| ||||||||||| ||||| || ||| Sbjct: 52914 ggggccttgatgacctgcaggatctggacgacctcggccatggacgggcggttggatggg 52855 Query: 424 atctgcgacgtgcatacca 442 |||||||||||||| |||| Sbjct: 52854 atctgcgacgtgcacacca 52836
>dbj|AK122121.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033130J03, full insert sequence Length = 3036 Score = 93.7 bits (47), Expect = 5e-16 Identities = 71/79 (89%) Strand = Plus / Minus Query: 364 ggggccctgatgacctgcaggatctggaccacctccgccatggacggccggttcgacggg 423 |||||| |||||||||||||||||||||| ||||| ||||||||||| ||||| || ||| Sbjct: 2743 ggggccttgatgacctgcaggatctggacgacctcggccatggacgggcggttggatggg 2684 Query: 424 atctgcgacgtgcatacca 442 ||||| |||||||| |||| Sbjct: 2683 atctgtgacgtgcacacca 2665
>emb|AL663055.13| Mouse DNA sequence from clone RP23-102H8 on chromosome 11 Contains the 5' end of the Gria1 gene for glutamate receptor, ionotropic, AMPA1 (alpha 1), complete sequence Length = 202981 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatggacac 235 |||||||||||||||||||||||| Sbjct: 126076 atgcatgcatgcatgcatggacac 126099
>gb|AC165322.12| Mus musculus chromosome 1, clone RP23-127J15, complete sequence Length = 185278 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatggacac 235 |||||||||||||||||||||||| Sbjct: 24770 atgcatgcatgcatgcatggacac 24747
>emb|AL513351.26| Mouse DNA sequence from clone RP23-122P5 on chromosome 1, complete sequence Length = 224628 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatggacac 235 |||||||||||||||||||||||| Sbjct: 171050 atgcatgcatgcatgcatggacac 171027
>gb|AC151980.3| Mus musculus BAC clone RP24-83M3 from chromosome 8, complete sequence Length = 253457 Score = 46.1 bits (23), Expect = 0.097 Identities = 23/23 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatggaca 234 ||||||||||||||||||||||| Sbjct: 9178 atgcatgcatgcatgcatggaca 9200
>gb|AC122420.4| Mus musculus BAC clone RP24-167C5 from chromosome 8, complete sequence Length = 179058 Score = 46.1 bits (23), Expect = 0.097 Identities = 23/23 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatggaca 234 ||||||||||||||||||||||| Sbjct: 100231 atgcatgcatgcatgcatggaca 100253
>gb|AC127189.4| Rattus norvegicus 1 BAC CH230-266M16 (Children's Hospital Oakland Research Institute) complete sequence Length = 222423 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatggacacgg 237 ||||||||||||||||||| |||||| Sbjct: 24415 atgcatgcatgcatgcatgtacacgg 24440
>gb|AC117627.16| Mus musculus chromosome 1, clone RP23-116N6, complete sequence Length = 201995 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 208 atctatgcatgcatgcatgcat 229 |||||||||||||||||||||| Sbjct: 23394 atctatgcatgcatgcatgcat 23373
>gb|AC124348.5| Mus musculus BAC clone RP24-462O9 from chromosome 9, complete sequence Length = 187568 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 208 atctatgcatgcatgcatgcat 229 |||||||||||||||||||||| Sbjct: 123653 atctatgcatgcatgcatgcat 123632
>gb|AC132406.4| Mus musculus BAC clone RP23-340E1 from chromosome 9, complete sequence Length = 222617 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 208 atctatgcatgcatgcatgcat 229 |||||||||||||||||||||| Sbjct: 142467 atctatgcatgcatgcatgcat 142488
>gb|AC151281.3| Mus musculus BAC clone RP24-144E8 from chromosome 17, complete sequence Length = 171820 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 215 catgcatgcatgcatggacacg 236 |||||||||||||||||||||| Sbjct: 86687 catgcatgcatgcatggacacg 86666
>emb|AL354735.14| Human DNA sequence from clone RP11-738I14 on chromosome 9 Contains the 3' end of the DDX31 gene for DEAD/H box polypeptide 31, the BARHL1 gene for BarH-like 1 (Drosophila) protein, two novel genes and three CpG islands, complete sequence Length = 189821 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 208 atctatgcatgcatgcatgcat 229 |||||||||||||||||||||| Sbjct: 128152 atctatgcatgcatgcatgcat 128173
>gb|AC163282.3| Mus musculus BAC clone RP23-454I20 from chromosome 12, complete sequence Length = 202583 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 209 tctatgcatgcatgcatgcatg 230 |||||||||||||||||||||| Sbjct: 175281 tctatgcatgcatgcatgcatg 175302 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 175306 tatgcatgcatgcatgcatg 175287
>dbj|AK128451.1| Homo sapiens cDNA FLJ46594 fis, clone THYMU3045692 Length = 2819 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 208 atctatgcatgcatgcatgcat 229 |||||||||||||||||||||| Sbjct: 812 atctatgcatgcatgcatgcat 833
>gb|AC092936.9| Homo sapiens 12 BAC RP11-286J13 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 217112 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 208 atctatgcatgcatgcatgcat 229 |||||||||||||||||||||| Sbjct: 161412 atctatgcatgcatgcatgcat 161391 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 70250 atgcatgcatgcatgcatgga 70270
>gb|BC034932.1| Homo sapiens, clone IMAGE:4591517, mRNA Length = 2891 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 208 atctatgcatgcatgcatgcat 229 |||||||||||||||||||||| Sbjct: 2332 atctatgcatgcatgcatgcat 2311
>emb|CT030161.10| Mouse DNA sequence from clone RP23-235H10 on chromosome 12, complete sequence Length = 234471 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 209 tctatgcatgcatgcatgcatg 230 |||||||||||||||||||||| Sbjct: 204565 tctatgcatgcatgcatgcatg 204544 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 204540 tatgcatgcatgcatgcatg 204559
>gb|AC134594.5| Mus musculus BAC clone RP23-388B6 from 12, complete sequence Length = 194521 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 209 tctatgcatgcatgcatgcatg 230 |||||||||||||||||||||| Sbjct: 158639 tctatgcatgcatgcatgcatg 158618 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 158614 tatgcatgcatgcatgcatg 158633
>emb|AL929585.11| Mouse DNA sequence from clone RP23-97O7 on chromosome 4, complete sequence Length = 246011 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 tgcatgcatgcatgcatggaca 234 |||||||||||||||||||||| Sbjct: 41378 tgcatgcatgcatgcatggaca 41357
>gb|AC127297.4| Mus musculus BAC clone RP23-395B13 from chromosome 3, complete sequence Length = 222889 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 209 tctatgcatgcatgcatgcatg 230 |||||||||||||||||||||| Sbjct: 97907 tctatgcatgcatgcatgcatg 97928 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 97932 tatgcatgcatgcatgcatg 97913
>emb|AL627099.13| Mouse DNA sequence from clone RP23-306F22 on chromosome 4, complete sequence Length = 169469 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 214 gcatgcatgcatgcatggacac 235 |||||||||||||||||||||| Sbjct: 2849 gcatgcatgcatgcatggacac 2870
>gb|AC114494.2| Homo sapiens chromosome 1 clone RP11-439L8, complete sequence Length = 146301 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 208 atctatgcatgcatgcatgcat 229 |||||||||||||||||||||| Sbjct: 141050 atctatgcatgcatgcatgcat 141071 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 208 atctatgcatgcatgcatgcat 229 |||||||||||||||||||||| Sbjct: 140219 atctatgcatgcatgcatgcat 140240
>gb|AC154901.1| Prunus persica (peach) BAC clone 82I18, complete sequence Length = 73299 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 213 tgcatgcatgcatgcatggac 233 ||||||||||||||||||||| Sbjct: 25023 tgcatgcatgcatgcatggac 25003
>gb|AC108429.11| Mus musculus chromosome 7, clone RP23-161B5, complete sequence Length = 186903 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 26576 atgcatgcatgcatgcatgga 26596
>gb|AC111115.13| Mus musculus chromosome 5, clone RP23-213H20, complete sequence Length = 201694 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 118017 atgcatgcatgcatgcatgga 117997 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatggacac 235 ||||||||||| |||||||||||| Sbjct: 42546 atgcatgcatgaatgcatggacac 42523
>gb|AC154221.3| Mus musculus BAC clone RP24-373L7 from chromosome 13, complete sequence Length = 157332 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatggacac 235 |||||||||||||||||||| |||| Sbjct: 91455 tatgcatgcatgcatgcatgcacac 91431
>gb|AC116788.14| Mus musculus chromosome 8, clone RP24-296N13, complete sequence Length = 164158 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatgg 231 ||||||||||||||||||||| Sbjct: 34096 tatgcatgcatgcatgcatgg 34116
>gb|AC139574.4| Mus musculus BAC clone RP23-477I8 from chromosome 15, complete sequence Length = 190948 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 75268 atgcatgcatgcatgcatgga 75248
>ref|XM_469440.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2503 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 391 accacctccgccatggacggccggt 415 |||||||||| |||||||||||||| Sbjct: 2166 accacctccgacatggacggccggt 2142
>ref|XM_469439.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2387 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 391 accacctccgccatggacggccggt 415 |||||||||| |||||||||||||| Sbjct: 1976 accacctccgacatggacggccggt 1952
>gb|AC091670.7| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1212_C08 map R2847, complete sequence Length = 100918 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 391 accacctccgccatggacggccggt 415 |||||||||| |||||||||||||| Sbjct: 95631 accacctccgacatggacggccggt 95655
>gb|AY258809.1| Xiphophorus maculatus microsatellite Msc018 sequence Length = 724 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 490 atgcatgcatgcatgcatgga 470 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 495 tatgcatgcatgcatgcatg 476
>gb|AC165080.4| Mus musculus BAC clone RP24-93F20 from chromosome 9, complete sequence Length = 194427 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 11748 atgcatgcatgcatgcatgga 11768
>gb|AC099628.7| Mus musculus chromosome 1, clone RP24-82L18, complete sequence Length = 171875 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 210 ctatgcatgcatgcatgcatg 230 ||||||||||||||||||||| Sbjct: 141584 ctatgcatgcatgcatgcatg 141604
>gb|AC146430.4| Pan troglodytes BAC clone RP43-21F8 from 7, complete sequence Length = 179251 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 175171 atgcatgcatgcatgcatgga 175191 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 175123 atgcatgcatgcatgcatgga 175143
>gb|AC140680.4| Mus musculus BAC clone RP24-548A12 from chromosome Y, complete sequence Length = 222176 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 79308 atgcatgcatgcatgcatgga 79328
>gb|AC138260.7| Mus musculus chromosome 6, clone RP23-247I19, complete sequence Length = 197686 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 210 ctatgcatgcatgcatgcatg 230 ||||||||||||||||||||| Sbjct: 151030 ctatgcatgcatgcatgcatg 151050
>gb|AC122302.4| Mus musculus BAC clone RP23-276E10 from chromosome 12, complete sequence Length = 172985 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 126324 atgcatgcatgcatgcatgga 126304
>gb|AC165365.3| Mus musculus BAC clone RP23-28N13 from chromosome 6, complete sequence Length = 238262 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 210 ctatgcatgcatgcatgcatg 230 ||||||||||||||||||||| Sbjct: 107709 ctatgcatgcatgcatgcatg 107729
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 391 accacctccgccatggacggccggt 415 |||||||||| |||||||||||||| Sbjct: 27959903 accacctccgacatggacggccggt 27959927 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 213 tgcatgcatgcatgcatgga 232 |||||||||||||||||||| Sbjct: 33672033 tgcatgcatgcatgcatgga 33672052 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 30839956 tatgcatgcatgcatgcatg 30839937 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 23282487 atgcatgcatgcatgcatgg 23282506 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 15347876 atgcatgcatgcatgcatgg 15347857 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 8062240 tatgcatgcatgcatgcatg 8062221 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 3538626 atgcatgcatgcatgcatgg 3538607 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 210 ctatgcatgcatgcatgcat 229 |||||||||||||||||||| Sbjct: 3345080 ctatgcatgcatgcatgcat 3345099
>gb|AC158347.4| Mus musculus chromosome 3, clone RP23-380F8, complete sequence Length = 193489 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 155467 atgcatgcatgcatgcatgga 155487
>gb|AC141875.4| Mus musculus BAC clone RP24-316O22 from chromosome Y, complete sequence Length = 170988 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 17180 atgcatgcatgcatgcatgga 17200
>gb|AC099704.7| Mus musculus chromosome 15, clone RP23-256A2, complete sequence Length = 204704 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 210 ctatgcatgcatgcatgcatg 230 ||||||||||||||||||||| Sbjct: 126195 ctatgcatgcatgcatgcatg 126215 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 126119 tatgcatgcatgcatgcatg 126138
>gb|AC101830.7| Mus musculus chromosome 1, clone RP24-480B20, complete sequence Length = 158825 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 210 ctatgcatgcatgcatgcatg 230 ||||||||||||||||||||| Sbjct: 32280 ctatgcatgcatgcatgcatg 32300
>gb|AC133334.8| Oryza sativa chromosome 3 BAC OSJNBa0004L11 genomic sequence, complete sequence Length = 133889 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 391 accacctccgccatggacggccggt 415 |||||||||| |||||||||||||| Sbjct: 65123 accacctccgacatggacggccggt 65099
>gb|AC139572.4| Mus musculus BAC clone RP24-196P9 from chromosome 7, complete sequence Length = 165198 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 32051 atgcatgcatgcatgcatgga 32071
>gb|AC133950.4| Mus musculus BAC clone RP24-243C16 from chromosome 7, complete sequence Length = 176244 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 143185 atgcatgcatgcatgcatgga 143205
>gb|AC122375.4| Mus musculus BAC clone RP23-469G18 from chromosome 16, complete sequence Length = 189557 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 90177 atgcatgcatgcatgcatgga 90157 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatggacac 235 ||||||||||||||||||| |||| Sbjct: 90160 atgcatgcatgcatgcatgtacac 90183
>gb|AC127553.3| Mus musculus BAC clone RP24-553F11 from chromosome 5, complete sequence Length = 159693 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 87499 atgcatgcatgcatgcatgga 87479
>gb|AC116656.5| Mus musculus BAC clone RP23-10A7 from chromosome 15, complete sequence Length = 198019 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 13135 atgcatgcatgcatgcatgga 13115
>gb|AC126272.3| Mus musculus BAC clone RP23-48P22 from chromosome 14, complete sequence Length = 191606 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 84985 atgcatgcatgcatgcatgga 85005
>gb|AC124558.4| Mus musculus BAC clone RP23-248O8 from chromosome 10, complete sequence Length = 199938 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 55169 atgcatgcatgcatgcatgga 55149
>gb|AC073600.3| Genomic sequence for Mus musculus, clone RP23-119A19, complete sequence Length = 197456 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 33293 atgcatgcatgcatgcatgga 33273
>gb|AC131773.3| Mus musculus BAC clone RP24-308A19 from chromosome 15, complete sequence Length = 168423 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 210 ctatgcatgcatgcatgcatg 230 ||||||||||||||||||||| Sbjct: 13187 ctatgcatgcatgcatgcatg 13167 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 13263 tatgcatgcatgcatgcatg 13244
>gb|AC123826.4| Mus musculus BAC clone RP24-97K3 from chromosome 8, complete sequence Length = 188704 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 162527 atgcatgcatgcatgcatgga 162547 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 162439 atgcatgcatgcatgcatgga 162459
>gb|AC126032.4| Mus musculus BAC clone RP24-94B12 from chromosome 1, complete sequence Length = 207475 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatggacacg 236 ||||||||||||||||||| ||||| Sbjct: 182223 atgcatgcatgcatgcatgcacacg 182247
>gb|AC129606.4| Mus musculus BAC clone RP23-128L6 from 8, complete sequence Length = 235915 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 27984 atgcatgcatgcatgcatgga 28004 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 27896 atgcatgcatgcatgcatgga 27916
>gb|AC113527.8| Mus musculus chromosome 9, clone RP23-314E23, complete sequence Length = 202544 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 210 ctatgcatgcatgcatgcatg 230 ||||||||||||||||||||| Sbjct: 68445 ctatgcatgcatgcatgcatg 68465 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatggacac 235 ||||||||||||||||||| |||| Sbjct: 68451 atgcatgcatgcatgcatgcacac 68474
>gb|AC108423.10| Mus musculus chromosome 16, clone RP23-443N12, complete sequence Length = 192819 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatggacacg 236 ||||||||||||||||||| ||||| Sbjct: 184878 atgcatgcatgcatgcatgcacacg 184854
>gb|AC101810.5| Mus musculus chromosome 15, clone RP24-278M16, complete sequence Length = 178304 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 134715 atgcatgcatgcatgcatgga 134695
>gb|AC159140.10| Mus musculus chromosome 7, clone RP24-84I4, complete sequence Length = 202318 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 210 ctatgcatgcatgcatgcatg 230 ||||||||||||||||||||| Sbjct: 97213 ctatgcatgcatgcatgcatg 97233
>gb|AC105302.27| Mus musculus strain C57BL/6J clone rp23-45h18 map 17, complete sequence Length = 238088 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 210 ctatgcatgcatgcatgcatg 230 ||||||||||||||||||||| Sbjct: 11736 ctatgcatgcatgcatgcatg 11756
>emb|AL160032.14| Human DNA sequence from clone RP11-474L7 on chromosome 13 Contains the 3' end of the KLF12 gene for Kruppel-like factor 12, a novel gene and the 5' end of a novel gene and a CpG island, complete sequence Length = 181324 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 30725 atgcatgcatgcatgcatgga 30705
>emb|AL031279.1|HS163O16 Human DNA sequence from clone RP1-163O16 on chromosome 1p35.1-36.13 Contains CA repeat, STS, complete sequence Length = 135628 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 129169 atgcatgcatgcatgcatgga 129149
>gb|AC154601.3| Mus musculus BAC clone RP23-342J18 from chromosome 16, complete sequence Length = 189457 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatggacacg 236 ||||||||||||||||||| ||||| Sbjct: 4904 atgcatgcatgcatgcatgcacacg 4880
>emb|AL596103.22| Mouse DNA sequence from clone RP23-309E16 on chromosome 11 Contains the P4ha2 gene for procollagen-proline 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase) alpha II polypeptide, a novel pseudogene, two novel genes, a diazepam binding inhibitor (Dbi) pseudogene, the Csf2 gene for colony stimulating factor 2 (granulocyte-macrophage), the Il3 gene for interleukin 3 and a CpG island, complete sequence Length = 199500 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 215 catgcatgcatgcatggacac 235 ||||||||||||||||||||| Sbjct: 140495 catgcatgcatgcatggacac 140475
>gb|AC154413.3| Mus musculus BAC clone RP24-230J5 from chromosome 13, complete sequence Length = 174730 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatgg 231 ||||||||||||||||||||| Sbjct: 100996 tatgcatgcatgcatgcatgg 100976
>gb|AC126615.7| Homo sapiens 12 BAC RP11-129B9 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 67557 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 36171 atgcatgcatgcatgcatgga 36191
>emb|CR545472.6| Zebrafish DNA sequence from clone DKEYP-32B1 in linkage group 5, complete sequence Length = 75199 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 208 atctatgcatgcatgcatgca 228 ||||||||||||||||||||| Sbjct: 23315 atctatgcatgcatgcatgca 23295
>gb|AC109453.2| Homo sapiens chromosome 5 clone RP11-203G23, complete sequence Length = 62986 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 43412 atgcatgcatgcatgcatgga 43432
>gb|AC119072.1| Oryza sativa ssp. japonica cv. Nipponbare OSJNBa0073N20 BAC genomic sequence, complete sequence Length = 147289 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatggacac 235 |||||||||||||||||||| |||| Sbjct: 62438 tatgcatgcatgcatgcatgcacac 62414
>dbj|AB076248.1| Mus musculus DNA, BAC clone:No.251,465 Length = 158570 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatgg 231 ||||||||||||||||||||| Sbjct: 65468 tatgcatgcatgcatgcatgg 65448
>emb|AL929441.37| Mouse DNA sequence from clone RP23-418E20 on chromosome 4, complete sequence Length = 202920 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 67114 atgcatgcatgcatgcatgga 67094
>gb|AC008949.9| Homo sapiens chromosome 5 clone CTD-2335O24, complete sequence Length = 163731 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatggacac 235 |||||||||||||||||||| |||| Sbjct: 90961 tatgcatgcatgcatgcatgtacac 90985
>gb|AF249952.1|AF249952 Euterpe precatoria malate synthase gene, exons 2 and 3 and partial cds Length = 514 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatgg 231 ||||||||||||||||||||| Sbjct: 292 tatgcatgcatgcatgcatgg 312
>gb|AC004863.5|AC004863 Homo sapiens PAC clone RP4-708P22 from 7, complete sequence Length = 133030 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 77421 atgcatgcatgcatgcatgga 77401 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 77191 atgcatgcatgcatgcatgga 77171
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 35252061 atgcatgcatgcatgcatgga 35252041
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 214 gcatgcatgcatgcatggaca 234 ||||||||||||||||||||| Sbjct: 23594656 gcatgcatgcatgcatggaca 23594676 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 210 ctatgcatgcatgcatgcat 229 |||||||||||||||||||| Sbjct: 24829603 ctatgcatgcatgcatgcat 24829584 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 24133153 tatgcatgcatgcatgcatg 24133172 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 20033315 tatgcatgcatgcatgcatg 20033296 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 20033292 tatgcatgcatgcatgcatg 20033311
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatggacac 235 |||||||||||||||||||| |||| Sbjct: 6481792 tatgcatgcatgcatgcatgcacac 6481816 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 26702621 atgcatgcatgcatgcatgg 26702602 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 25703892 atgcatgcatgcatgcatgg 25703911 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 14496790 tatgcatgcatgcatgcatg 14496809 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 6149261 atgcatgcatgcatgcatgg 6149242
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 208 atctatgcatgcatgcatgcatgga 232 |||||| |||||||||||||||||| Sbjct: 7747974 atctatccatgcatgcatgcatgga 7747998 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 2564500 atgcatgcatgcatgcatgga 2564520 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 128 attaattttcactagcaaac 147 |||||||||||||||||||| Sbjct: 5263834 attaattttcactagcaaac 5263815 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 2564509 atgcatgcatgcatgcatgg 2564490
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 213 tgcatgcatgcatgcatggac 233 ||||||||||||||||||||| Sbjct: 5067499 tgcatgcatgcatgcatggac 5067519 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 22480727 atgcatgcatgcatgcatgg 22480746 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 215 catgcatgcatgcatggaca 234 |||||||||||||||||||| Sbjct: 11945245 catgcatgcatgcatggaca 11945264
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 391 accacctccgccatggacggccggt 415 |||||||||| |||||||||||||| Sbjct: 28051227 accacctccgacatggacggccggt 28051251 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 213 tgcatgcatgcatgcatgga 232 |||||||||||||||||||| Sbjct: 33762505 tgcatgcatgcatgcatgga 33762524 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 30930479 tatgcatgcatgcatgcatg 30930460 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 23275515 atgcatgcatgcatgcatgg 23275534 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 15342410 atgcatgcatgcatgcatgg 15342391 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 8060075 tatgcatgcatgcatgcatg 8060056 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 3538737 atgcatgcatgcatgcatgg 3538718 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 210 ctatgcatgcatgcatgcat 229 |||||||||||||||||||| Sbjct: 3345191 ctatgcatgcatgcatgcat 3345210
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 10124107 atgcatgcatgcatgcatgga 10124127 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 accacctccgccatggacgg 410 |||||||||||||||||||| Sbjct: 26109228 accacctccgccatggacgg 26109247 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 24837013 atgcatgcatgcatgcatgg 24837032 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 209 tctatgcatgcatgcatgca 228 |||||||||||||||||||| Sbjct: 22067930 tctatgcatgcatgcatgca 22067949 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 10124124 atgcatgcatgcatgcatgg 10124105
>gb|AC115949.13| Mus musculus chromosome 3, clone RP24-568B16, complete sequence Length = 177771 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 27273 atgcatgcatgcatgcatgga 27293
>gb|AC149590.5| Mus musculus BAC clone RP23-348L9 from chromosome 5, complete sequence Length = 196662 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 124264 atgcatgcatgcatgcatgga 124284 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 124160 atgcatgcatgcatgcatgga 124180
>gb|AC090963.32| Mus musculus strain C57BL/6J chromosome 17 clone rp23-435j12, complete sequence Length = 218107 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 210 ctatgcatgcatgcatgcatg 230 ||||||||||||||||||||| Sbjct: 168460 ctatgcatgcatgcatgcatg 168480
>gb|AC090653.36| Mus musculus strain C57BL/6J chromosome 17 clone rp23-260k1, complete sequence Length = 191844 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 210 ctatgcatgcatgcatgcatg 230 ||||||||||||||||||||| Sbjct: 114182 ctatgcatgcatgcatgcatg 114162
>gb|AC087593.6| Homo sapiens chromosome 15, clone RP11-247E14, complete sequence Length = 124394 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 38896 atgcatgcatgcatgcatgga 38876
>dbj|AP005526.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0571B09 Length = 147382 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 78857 atgcatgcatgcatgcatgga 78877 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 78866 atgcatgcatgcatgcatgg 78847
>dbj|AP005124.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0049I08 Length = 144379 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 213 tgcatgcatgcatgcatggac 233 ||||||||||||||||||||| Sbjct: 109188 tgcatgcatgcatgcatggac 109208
>dbj|AP003743.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1118_E12 Length = 119691 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 213 tgcatgcatgcatgcatggac 233 ||||||||||||||||||||| Sbjct: 23666 tgcatgcatgcatgcatggac 23686
>dbj|AP004770.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0017G06 Length = 150628 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 71801 atgcatgcatgcatgcatgga 71821 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 71818 atgcatgcatgcatgcatgg 71799
>emb|AL929254.12| Mouse DNA sequence from clone RP23-456I1 on chromosome 2, complete sequence Length = 222104 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 221023 atgcatgcatgcatgcatgga 221043
>dbj|AP005506.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0665F09 Length = 147102 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 126129 atgcatgcatgcatgcatgga 126149 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 126138 atgcatgcatgcatgcatgg 126119
>dbj|AP004183.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1221_H04 Length = 129387 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 208 atctatgcatgcatgcatgcatgga 232 |||||| |||||||||||||||||| Sbjct: 88697 atctatccatgcatgcatgcatgga 88721
>dbj|AK111846.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023143O14, full insert sequence Length = 2507 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 391 accacctccgccatggacggccggt 415 |||||||||| |||||||||||||| Sbjct: 2170 accacctccgacatggacggccggt 2146
>gb|AC147869.3| Monodelphis domestica clone VMRC6-113K21, complete sequence Length = 157763 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatggacac 235 |||||||||||||||||||| |||| Sbjct: 154378 tatgcatgcatgcatgcatgcacac 154354
>gb|AC131741.4| Mus musculus BAC clone RP23-66E21 from 7, complete sequence Length = 193738 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 209 tctatgcatgcatgcatgcatggacacgg 237 |||| ||||||||||||||||| |||||| Sbjct: 113190 tctacgcatgcatgcatgcatgcacacgg 113162
>gb|AC107631.20| Mus musculus chromosome 5, clone RP23-5M20, complete sequence Length = 225977 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 189775 atgcatgcatgcatgcatgga 189755 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 189671 atgcatgcatgcatgcatgga 189651
>gb|AC101838.17| Mus musculus chromosome 1, clone RP23-242B14, complete sequence Length = 178509 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 144210 atgcatgcatgcatgcatgga 144190
>gb|AC113464.17| Mus musculus chromosome 8, clone RP23-183P1, complete sequence Length = 191444 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 59835 atgcatgcatgcatgcatgga 59855
>gb|AC110037.13| Mus musculus chromosome 5, clone RP23-257E17, complete sequence Length = 177428 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 1204 atgcatgcatgcatgcatgga 1224
>emb|CT033775.6| Mouse DNA sequence from clone RP24-145H15 on chromosome 13, complete sequence Length = 168176 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 208 atctatgcatgcatgcatgca 228 ||||||||||||||||||||| Sbjct: 27973 atctatgcatgcatgcatgca 27993
>emb|AL591542.20| Mouse DNA sequence from clone RP23-321M14 on chromosome 2, complete sequence Length = 197190 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatggacacg 236 ||||||||||||||||||| ||||| Sbjct: 115947 atgcatgcatgcatgcatgcacacg 115971
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatggacac 235 |||||||||||||||||||| |||| Sbjct: 6548259 tatgcatgcatgcatgcatgcacac 6548283 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 27027684 atgcatgcatgcatgcatgg 27027665 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 26022562 atgcatgcatgcatgcatgg 26022581 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 14578791 tatgcatgcatgcatgcatg 14578810 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 6215728 atgcatgcatgcatgcatgg 6215709
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 214 gcatgcatgcatgcatggaca 234 ||||||||||||||||||||| Sbjct: 23522847 gcatgcatgcatgcatggaca 23522867 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 210 ctatgcatgcatgcatgcat 229 |||||||||||||||||||| Sbjct: 24757809 ctatgcatgcatgcatgcat 24757790 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 24061359 tatgcatgcatgcatgcatg 24061378 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 19959529 tatgcatgcatgcatgcatg 19959510 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 19959506 tatgcatgcatgcatgcatg 19959525
>emb|AL772425.7|CNS08CA3 Oryza sativa chromosome 12, . BAC OJ1396_C02 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 157690 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 214 gcatgcatgcatgcatggaca 234 ||||||||||||||||||||| Sbjct: 111754 gcatgcatgcatgcatggaca 111734
>emb|AL606637.3|OSJN00076 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0039K24, complete sequence Length = 173770 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 47906 atgcatgcatgcatgcatgga 47886
>gb|AC171896.2| Capitella capitata clone JGIBGZA-33J12, complete sequence Length = 31338 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 25831 atgcatgcatgcatgcatgga 25851 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 25848 atgcatgcatgcatgcatgg 25829
>gb|AC145597.4| Mus musculus BAC clone RP24-323M2 from Y, complete sequence Length = 199904 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 15121 atgcatgcatgcatgcatgga 15101
>gb|AC132589.4| Mus musculus BAC clone RP24-258M24 from 1, complete sequence Length = 168097 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 210 ctatgcatgcatgcatgcatg 230 ||||||||||||||||||||| Sbjct: 51729 ctatgcatgcatgcatgcatg 51749
>gb|AC145610.4| Mus musculus BAC clone RP24-281O20 from 18, complete sequence Length = 182640 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatggacacg 236 ||||||||||||||||||| ||||| Sbjct: 55373 atgcatgcatgcatgcatgcacacg 55349
>gb|AC140250.3| Mus musculus BAC clone RP24-288J3 from 1, complete sequence Length = 163490 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatggacacg 236 ||||||||||||||||||| ||||| Sbjct: 2052 atgcatgcatgcatgcatgcacacg 2076
>emb|AL844846.11| Mouse DNA sequence from clone RP23-358I19 on chromosome 2, complete sequence Length = 209013 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 72616 atgcatgcatgcatgcatgga 72636
>emb|CT009700.8| Mouse DNA sequence from clone RP23-114M15 on chromosome 13, complete sequence Length = 184143 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatgg 231 ||||||||||||||||||||| Sbjct: 4703 tatgcatgcatgcatgcatgg 4683
>gb|AC164092.3| Mus musculus BAC clone RP23-366E4 from chromosome 9, complete sequence Length = 203636 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 140574 atgcatgcatgcatgcatgga 140594
>gb|DP000021.1| Monodelphis domestica target 1 genomic scaffold Length = 1833844 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatggacac 235 |||||||||||||||||||| |||| Sbjct: 1582942 tatgcatgcatgcatgcatgcacac 1582918
>emb|AL662925.12| Mouse DNA sequence from clone RP23-226M12 on chromosome X, complete sequence Length = 199774 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatggacac 235 |||||||||||||||||||| |||| Sbjct: 154967 tatgcatgcatgcatgcatgcacac 154991
>emb|AL627214.15| Mouse DNA sequence from clone RP23-357K18 on chromosome 4, complete sequence Length = 182829 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 1316 atgcatgcatgcatgcatgga 1336
>emb|AL683893.26| Mouse DNA sequence from clone RP23-122N18 on chromosome 4, complete sequence Length = 204841 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 130739 atgcatgcatgcatgcatgga 130759 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 130734 tatgcatgcatgcatgcatg 130753
>emb|AL671910.9| Mouse DNA sequence from clone RP23-245M12 on chromosome X, complete sequence Length = 141713 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 39672 atgcatgcatgcatgcatgga 39652
>emb|AL671173.12| Mouse DNA sequence from clone RP23-426N4 on chromosome 4, complete sequence Length = 201741 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 180331 atgcatgcatgcatgcatgga 180311
>emb|AL691448.24| Mouse DNA sequence from clone RP23-103A1 on chromosome 11, complete sequence Length = 197959 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 107321 atgcatgcatgcatgcatgga 107301
>emb|AL671011.9| Mouse DNA sequence from clone RP23-95O23 on chromosome 4, complete sequence Length = 226950 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 84477 atgcatgcatgcatgcatgga 84457
>emb|AL732513.8| Mouse DNA sequence from clone RP23-344B24 on chromosome 2, complete sequence Length = 209452 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 91132 atgcatgcatgcatgcatgga 91112
>emb|AL645531.10| Mouse DNA sequence from clone RP23-191E19 on chromosome 4, complete sequence Length = 97801 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatgg 231 ||||||||||||||||||||| Sbjct: 81572 tatgcatgcatgcatgcatgg 81552
>emb|AL627345.11| Mouse DNA sequence from clone RP23-169E7 on chromosome 4, complete sequence Length = 73565 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgga 232 ||||||||||||||||||||| Sbjct: 72881 atgcatgcatgcatgcatgga 72901
>gb|AC102103.10| Mus musculus chromosome 15, clone RP23-82K1, complete sequence Length = 237423 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 221 tgcatgcatggacacggtac 240 |||||||||||||||||||| Sbjct: 129762 tgcatgcatggacacggtac 129743
>gb|AC105966.11| Mus musculus chromosome 3, clone RP23-403H2, complete sequence Length = 201376 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 119257 tatgcatgcatgcatgcatg 119276
>gb|AC164069.9| Mus musculus chromosome 15, clone RP23-422H17, complete sequence Length = 216364 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 59423 tatgcatgcatgcatgcatg 59404
>gb|AC153383.1| Mus musculus 6 BAC RP23-168L2 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 197962 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 190386 atgcatgcatgcatgcatgg 190367
>gb|AC124664.14| Mus musculus chromosome 1, clone RP23-103B18, complete sequence Length = 220456 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 205058 tatgcatgcatgcatgcatg 205077
>gb|AC113121.27| Mus musculus chromosome 8, clone RP23-347G12, complete sequence Length = 192877 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 191499 tatgcatgcatgcatgcatg 191480
>gb|AC163102.5| Mus musculus chromosome 18, clone RP23-270E10, complete sequence Length = 179127 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 173987 tatgcatgcatgcatgcatg 173968
>gb|DQ257594.1| Hordeum vulgare subsp. vulgare clone 33-23A-RB flanking T-DNA insertion sequence Length = 843 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 627 atgcatgcatgcatgcatgg 608
>gb|AC121942.2| Mus musculus chromosome 13 clone RP24-211D12, complete sequence Length = 164932 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 110347 tatgcatgcatgcatgcatg 110366
>gb|AC132830.12| Mus musculus chromosome 1, clone RP24-566B6, complete sequence Length = 205300 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 60506 tatgcatgcatgcatgcatg 60525
>gb|AC165162.4| Mus musculus BAC clone RP23-173L24 from chromosome 3, complete sequence Length = 211699 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 192392 tatgcatgcatgcatgcatg 192411
>gb|AC166158.3| Mus musculus BAC clone RP24-244P14 from chromosome 1, complete sequence Length = 170234 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 34654 tatgcatgcatgcatgcatg 34635
>gb|AC167971.3| Mus musculus BAC clone RP24-439I22 from chromosome 7, complete sequence Length = 198057 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 71240 tatgcatgcatgcatgcatg 71259
>gb|AC163097.11| Mus musculus chromosome 8, clone RP23-135D17, complete sequence Length = 170429 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 213 tgcatgcatgcatgcatgga 232 |||||||||||||||||||| Sbjct: 27999 tgcatgcatgcatgcatgga 28018
>ref|XM_467048.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1328 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 accacctccgccatggacgg 410 |||||||||||||||||||| Sbjct: 1030 accacctccgccatggacgg 1011
>gb|AC110214.7| Mus musculus chromosome 8, clone RP24-485L5, complete sequence Length = 213387 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 145874 tatgcatgcatgcatgcatg 145855
>gb|DP000017.1| Sus scrofa target 1 genomic scaffold Length = 1471440 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatggacac 235 ||||||||||||||||||| |||| Sbjct: 907465 atgcatgcatgcatgcatgcacac 907488
>gb|AC116853.12| Mus musculus chromosome 1, clone RP24-400M20, complete sequence Length = 188514 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 94224 tatgcatgcatgcatgcatg 94243
>gb|AC148611.1| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1007D10, complete sequence Length = 153366 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 107123 tatgcatgcatgcatgcatg 107104
>gb|CP000078.1| Leishmania major strain Friedlin chromosome 2, complete sequence Length = 355714 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 128637 atgcatgcatgcatgcatgg 128618
>gb|AF405701.1| Synthetic construct legume box RY repeat motif sequence Length = 82 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 52 atgcatgcatgcatgcatgg 71
>gb|AY024014.1| Oryza sativa microsatellite MRG6339 containing (CATG)X6, closest to marker Y6854L, genomic sequence Length = 224 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 119 atgcatgcatgcatgcatgg 100
>gb|AC147925.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0032N11 map near 50283S, complete sequence Length = 139217 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 111624 tatgcatgcatgcatgcatg 111643
>gb|AY258744.1| Xiphophorus maculatus microsatellite Msc045 sequence Length = 602 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 240 tatgcatgcatgcatgcatg 259
>gb|AC164649.4| Mus musculus BAC clone RP23-437D10 from chromosome 5, complete sequence Length = 215766 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 29247 atgcatgcatgcatgcatgg 29228
>gb|AC154641.2| Mus musculus BAC clone RP23-276C17 from chromosome 16, complete sequence Length = 190523 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 183729 tatgcatgcatgcatgcatg 183748
>gb|AC164703.3| Mus musculus BAC clone RP23-266K19 from chromosome 7, complete sequence Length = 238433 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 120048 tatgcatgcatgcatgcatg 120029
>gb|AC091677.12| Mus musculus chromosome 18, clone RP23-131E5, complete sequence Length = 222121 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 194799 tatgcatgcatgcatgcatg 194780
>gb|AC130598.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0056I11, complete sequence Length = 145796 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 101082 atgcatgcatgcatgcatgg 101063
>gb|AC120986.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1781_H11, complete sequence Length = 204649 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 213 tgcatgcatgcatgcatgga 232 |||||||||||||||||||| Sbjct: 133921 tgcatgcatgcatgcatgga 133902
>gb|AC116507.9| Mus musculus chromosome 19, clone RP24-309C17, complete sequence Length = 168364 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 11253 tatgcatgcatgcatgcatg 11234 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 11230 tatgcatgcatgcatgcatg 11249
>gb|AC102874.7| Mus musculus chromosome 1, clone RP24-500O1, complete sequence Length = 166507 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 69734 tatgcatgcatgcatgcatg 69715
>gb|AC135190.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0064H09, complete sequence Length = 146742 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 5079 atgcatgcatgcatgcatgg 5060
>gb|AY663543.1| Sus scrofa albumin gene, complete cds Length = 35317 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatggacac 235 ||||||||||||||||||| |||| Sbjct: 13762 atgcatgcatgcatgcatgcacac 13785
>gb|AC106169.5| Rattus norvegicus x BAC CH230-105D14 (Children's Hospital Oakland Research Institute) complete sequence Length = 227592 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 58559 tatgcatgcatgcatgcatg 58578
>gb|AF130357.2| Mus musculus chromosome X clone CT7-148C10, complete sequence Length = 106724 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatggacac 235 ||||||||||||||||||| |||| Sbjct: 23313 atgcatgcatgcatgcatgcacac 23336
>gb|AC102285.7| Mus musculus chromosome 19, clone RP24-329P13, complete sequence Length = 174894 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 125183 tatgcatgcatgcatgcatg 125164
>gb|AC136998.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0082P17, complete sequence Length = 157539 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 112697 atgcatgcatgcatgcatgg 112678
>gb|AY532747.1| Zea mays subsp. parviglumis isolate p5 chitinase (chiI) gene, complete cds Length = 1089 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 1009 atgcatgcatgcatgcatgg 990
>gb|AC115746.10| Mus musculus chromosome 15, clone RP23-3J8, complete sequence Length = 214765 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 29030 tatgcatgcatgcatgcatg 29049
>gb|AC124830.8| Mus musculus chromosome 17, clone RP24-165B21, complete sequence Length = 176889 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 83101 tatgcatgcatgcatgcatg 83120
>gb|AC124143.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0053D02, complete sequence Length = 157106 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 60595 atgcatgcatgcatgcatgg 60614
>gb|AC137592.2| Oryza sativa (Japonica cultiva-group) chromosome 9 BAC clone OSJNBa0035B22, complete sequence Length = 155788 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 391 accacctccgccatggacggccgg 414 |||||||||| ||||||||||||| Sbjct: 152526 accacctccgacatggacggccgg 152503
>gb|AC115036.10| Mus musculus chromosome 7, clone RP24-274F20, complete sequence Length = 173506 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 160760 atgcatgcatgcatgcatgg 160779
>gb|AC107206.4| Oryza sativa chromosome 3 BAC OSJNBa0063J18 genomic sequence, complete sequence Length = 154558 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 118968 atgcatgcatgcatgcatgg 118987
>gb|AC134839.3| Mus musculus BAC clone RP24-362O23 from chromosome 19, complete sequence Length = 178560 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 113739 tatgcatgcatgcatgcatg 113720
>gb|AC137156.3| Mus musculus BAC clone RP23-118K10 from chromosome 15, complete sequence Length = 205599 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 191412 tatgcatgcatgcatgcatg 191431
>gb|AC141565.3| Mus musculus BAC clone RP23-160M21 from chromosome 14, complete sequence Length = 210128 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 64924 tatgcatgcatgcatgcatg 64905
>gb|AC130546.4| Mus musculus BAC clone RP24-303D11 from chromosome 3, complete sequence Length = 171125 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 130820 tatgcatgcatgcatgcatg 130801
>gb|AC132107.3| Mus musculus BAC clone RP24-251C17 from chromosome 8, complete sequence Length = 141785 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatggacac 235 ||||||||||||||||||| |||| Sbjct: 57593 atgcatgcatgcatgcatgcacac 57616
>gb|AC135567.3| Mus musculus BAC clone RP23-312I24 from chromosome 16, complete sequence Length = 208603 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 14252 tatgcatgcatgcatgcatg 14271
>gb|AC140389.3| Mus musculus BAC clone RP24-202H2 from chromosome 18, complete sequence Length = 169195 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 132225 tatgcatgcatgcatgcatg 132244
>gb|AC145740.4| Mus musculus BAC clone RP24-233K8 from chromosome 12, complete sequence Length = 178285 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 130109 tatgcatgcatgcatgcatg 130090
>gb|AC119181.11| Mus musculus chromosome 18, clone RP24-111I16, complete sequence Length = 195506 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 52456 tatgcatgcatgcatgcatg 52437
>gb|AC134735.3| Rattus norvegicus 20 BAC CH230-1P16 (Children's Hospital Oakland Research Institute) complete sequence Length = 49899 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 17689 tatgcatgcatgcatgcatg 17670
>gb|AC145084.6| Mus musculus chromosome 18, clone RP24-175N20, complete sequence Length = 193640 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 112612 tatgcatgcatgcatgcatg 112593
>gb|AC124211.2| Mus musculus chromosome X clone CT7-497M13 map qA7.1, complete sequence Length = 114873 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatggacac 235 ||||||||||||||||||| |||| Sbjct: 70813 atgcatgcatgcatgcatgcacac 70836
>gb|AY372324.1| Diastema racemiferum internal transcribed spacer 1, complete sequence Length = 228 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 210 ctatgcatgcatgcatgcat 229 |||||||||||||||||||| Sbjct: 87 ctatgcatgcatgcatgcat 106
>gb|AC133902.12| Mus musculus chromosome 10, clone RP24-538B17, complete sequence Length = 199604 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 41357 tatgcatgcatgcatgcatg 41376
>gb|AC069309.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-154D15, complete sequence Length = 174754 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 169142 tatgcatgcatgcatgcatg 169161
>gb|AC115714.14| Mus musculus chromosome 12, clone RP23-477C24, complete sequence Length = 164272 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 111550 atgcatgcatgcatgcatgg 111569
>gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1525_A02, complete sequence Length = 93826 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 74486 tatgcatgcatgcatgcatg 74467
>gb|AC096884.2| Sus scrofa clone RP44-519O7, complete sequence Length = 146504 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatggacac 235 ||||||||||||||||||| |||| Sbjct: 76870 atgcatgcatgcatgcatgcacac 76893
>gb|AC146059.4| Pan troglodytes BAC clone RP43-14K1 from 7, complete sequence Length = 210466 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 122485 tatgcatgcatgcatgcatg 122466 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 122462 tatgcatgcatgcatgcatg 122481
>gb|AC131713.3| Mus musculus BAC clone RP23-193O18 from chromosome 18, complete sequence Length = 220193 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 22300 tatgcatgcatgcatgcatg 22319
>gb|AC145307.3| Mus musculus BAC clone RP24-400C6 from chromosome 17, complete sequence Length = 203180 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 176749 tatgcatgcatgcatgcatg 176730
>gb|AC161514.4| Mus musculus chromosome 7, clone RP23-378L12, complete sequence Length = 190426 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 113195 tatgcatgcatgcatgcatg 113214
>gb|AC140042.19| Mus musculus chromosome 5, clone RP23-437D10, complete sequence Length = 215786 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 186540 atgcatgcatgcatgcatgg 186559
>gb|DQ175932.1| Hordeum vulgare subsp. vulgare clone 33-25A-RB flanking T-DNA insertion sequence Length = 843 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 627 atgcatgcatgcatgcatgg 608
>gb|AC091464.8| Mus musculus chromosome 14, clone RP23-97N1, complete sequence Length = 237814 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 150670 tatgcatgcatgcatgcatg 150689
>gb|AC079957.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-144I17, complete sequence Length = 196474 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 34611 tatgcatgcatgcatgcatg 34592
>gb|AC116515.11| Mus musculus chromosome 7, clone RP24-331B9, complete sequence Length = 133179 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 112902 tatgcatgcatgcatgcatg 112883
>gb|AC161217.7| Mus musculus chromosome 8, clone RP23-80D9, complete sequence Length = 234127 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 179308 tatgcatgcatgcatgcatg 179327 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 56882 tatgcatgcatgcatgcatg 56901
>gb|AC153010.3| Mus musculus BAC clone RP23-325H1 from chromosome 15, complete sequence Length = 230097 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 189425 atgcatgcatgcatgcatgg 189444
>gb|AC166827.2| Mus musculus BAC clone RP23-359M9 from chromosome 12, complete sequence Length = 219729 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 89555 tatgcatgcatgcatgcatg 89574
>gb|AC109139.15| Mus musculus chromosome 8, clone RP23-47L13, complete sequence Length = 268904 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 253726 tatgcatgcatgcatgcatg 253745
>gb|AC104868.8| Mus musculus chromosome 1, clone RP24-532K6, complete sequence Length = 182376 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 174205 tatgcatgcatgcatgcatg 174186
>gb|AC163668.5| Mus musculus BAC clone RP23-32P22 from chromosome 1, complete sequence Length = 222156 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 163047 tatgcatgcatgcatgcatg 163066
>gb|AC159244.4| Mus musculus BAC clone RP24-309L4 from chromosome 12, complete sequence Length = 216500 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 168604 tatgcatgcatgcatgcatg 168623
>gb|AC121290.6| Mus musculus chromosome 16, clone RP23-84N4, complete sequence Length = 241184 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 99474 tatgcatgcatgcatgcatg 99493
>gb|DQ160222.1|DQ160222S1 Zea mays pericarp color 1 gene, pericarp color 1-P1rwCFS342 allele, 5' noncoding region Length = 5500 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 1791 atgcatgcatgcatgcatgg 1810 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 1786 tatgcatgcatgcatgcatg 1805
>gb|AC163616.3| Mus musculus BAC clone RP23-114P22 from chromosome 3, complete sequence Length = 212857 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 8994 tatgcatgcatgcatgcatg 9013
>gb|AC155823.8| Mus musculus BAC clone RP23-348C5 from chromosome 8, complete sequence Length = 219597 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatggacac 235 ||||||||||||||||||| |||| Sbjct: 173977 atgcatgcatgcatgcatgcacac 174000
>gb|AC161364.4| Mus musculus BAC clone RP24-353J16 from chromosome 6, complete sequence Length = 182872 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 20249 tatgcatgcatgcatgcatg 20268
>gb|AC164121.3| Mus musculus BAC clone RP24-406J12 from chromosome 12, complete sequence Length = 169925 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 911 atgcatgcatgcatgcatgg 930
>gb|AC158612.7| Mus musculus 10 BAC RP23-39I3 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 206234 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 91449 tatgcatgcatgcatgcatg 91468
>gb|AC131105.4| Mus musculus BAC clone RP23-280N9 from chromosome 19, complete sequence Length = 225527 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 269 ccctcccctacctctggctg 288 |||||||||||||||||||| Sbjct: 161274 ccctcccctacctctggctg 161255
>gb|AC137108.12| Mus musculus chromosome 9, clone RP23-277J20, complete sequence Length = 204108 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 185331 tatgcatgcatgcatgcatg 185312
>gb|AC121992.3| Mus musculus BAC clone RP24-300I17 from chromosome 12, complete sequence Length = 139943 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatggacac 235 ||||||||||||||||||| |||| Sbjct: 8461 atgcatgcatgcatgcatgcacac 8438
>gb|AC105066.12| Mus musculus chromosome 8, clone RP23-158A22, complete sequence Length = 238527 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatggacac 235 ||||||||||||||||||| |||| Sbjct: 31370 atgcatgcatgcatgcatgtacac 31347
>gb|AC123693.13| Mus musculus chromosome 3, clone RP23-326F23, complete sequence Length = 225242 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatggacac 235 ||||||||||||||||||| |||| Sbjct: 170925 atgcatgcatgcatgcatgcacac 170948 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 170942 atgcatgcatgcatgcatgg 170923
>gb|AC121079.20| Mus musculus chromosome 3, clone RP24-178P12, complete sequence Length = 177802 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 150380 tatgcatgcatgcatgcatg 150361
>gb|AC102392.8| Mus musculus chromosome 3, clone RP24-122I22, complete sequence Length = 201067 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 23906 tatgcatgcatgcatgcatg 23887
>gb|AC133967.2| Mus musculus BAC clone RP23-14J5 from chromosome 16, complete sequence Length = 195446 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 81389 tatgcatgcatgcatgcatg 81408
>gb|AC122376.4| Mus musculus BAC clone RP23-472G10 from chromosome 7, complete sequence Length = 183918 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 35389 tatgcatgcatgcatgcatg 35370
>gb|AC132590.3| Mus musculus BAC clone RP24-273G1 from chromosome 14, complete sequence Length = 161371 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 4656 tatgcatgcatgcatgcatg 4637
>gb|AC142474.4| Mus musculus BAC clone RP24-362N7 from chromosome 15, complete sequence Length = 172879 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 58757 atgcatgcatgcatgcatgg 58776
>emb|CT025649.7| Mouse DNA sequence from clone RP24-345B5 on chromosome 14, complete sequence Length = 175794 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 169675 tatgcatgcatgcatgcatg 169694
>emb|AL935124.31| Mouse DNA sequence from clone RP23-88C15 on chromosome 2, complete sequence Length = 193805 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 109505 tatgcatgcatgcatgcatg 109486
>emb|BX901970.11| Zebrafish DNA sequence from clone CH211-214I7 in linkage group 1, complete sequence Length = 22414 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 4893 tatgcatgcatgcatgcatg 4912
>emb|CT025643.4| Mouse DNA sequence from clone RP24-386L23 on chromosome 13, complete sequence Length = 148821 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 76454 tatgcatgcatgcatgcatg 76435 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 76418 tatgcatgcatgcatgcatg 76399 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 76374 tatgcatgcatgcatgcatg 76355
>emb|AJ578690.1|EGU578690 Elaeis guineensis microsatellite DNA, clone mEgCIR3593 Length = 440 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 338 tatgcatgcatgcatgcatg 319
>emb|AJ438040.1|TCH438040 Tetraselmis chui DNA containing repeats, strain CCAP 8/6 Length = 903 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 308 atgcatgcatgcatgcatgg 327
>emb|CT009546.4| Mouse DNA sequence from clone RP23-111H19 on chromosome 13, complete sequence Length = 207769 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 192240 tatgcatgcatgcatgcatg 192259
>emb|BX324230.15| Zebrafish DNA sequence from clone CH211-42C5 in linkage group 7, complete sequence Length = 179902 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 63519 tatgcatgcatgcatgcatg 63538
>gb|AC115361.5| Mus musculus BAC clone RP24-76P12 from chromosome 8, complete sequence Length = 235095 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 66182 tatgcatgcatgcatgcatg 66201
>gb|AC132272.3| Mus musculus BAC clone RP24-339P23 from chromosome 16, complete sequence Length = 147166 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 119629 tatgcatgcatgcatgcatg 119648
>gb|AC122000.3| Mus musculus BAC clone RP24-328N20 from chromosome 16, complete sequence Length = 188993 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 85054 tatgcatgcatgcatgcatg 85073
>gb|AC129198.3| Mus musculus BAC clone RP24-183I4 from chromosome 15, complete sequence Length = 165791 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 14050 tatgcatgcatgcatgcatg 14069
>gb|AC125096.3| Mus musculus BAC clone RP24-181K19 from chromosome 18, complete sequence Length = 154941 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 31407 tatgcatgcatgcatgcatg 31388
>gb|AC126671.3| Mus musculus BAC clone RP24-472G2 from chromosome 16, complete sequence Length = 172980 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 88884 tatgcatgcatgcatgcatg 88865
>gb|AC127557.5| Mus musculus BAC clone RP24-416I20 from chromosome 17, complete sequence Length = 148854 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 27145 tatgcatgcatgcatgcatg 27164
>gb|AC129590.4| Mus musculus BAC clone RP24-428B12 from chromosome 14, complete sequence Length = 180177 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 152324 tatgcatgcatgcatgcatg 152305
>gb|AC134441.4| Mus musculus BAC clone RP24-544J6 from chromosome 5, complete sequence Length = 177565 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 166940 tatgcatgcatgcatgcatg 166959
>gb|AC122299.5| Mus musculus BAC clone RP23-270L23 from chromosome 5, complete sequence Length = 209091 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 113548 tatgcatgcatgcatgcatg 113529
>gb|AC116319.4| Mus musculus BAC clone RP23-265J2 from chromosome 14, complete sequence Length = 170494 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatggacac 235 ||||||||||||||| |||||||| Sbjct: 115609 atgcatgcatgcatgtatggacac 115632
>gb|AC126447.3| Mus musculus BAC clone RP23-352G19 from chromosome 5, complete sequence Length = 196904 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 59387 atgcatgcatgcatgcatgg 59406 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 25780 tatgcatgcatgcatgcatg 25761 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 25775 atgcatgcatgcatgcatgg 25756
>gb|AC122365.4| Mus musculus BAC clone RP23-447A7 from chromosome 5, complete sequence Length = 195492 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 84322 tatgcatgcatgcatgcatg 84303
>gb|AC123842.4| Mus musculus BAC clone RP23-400N18 from chromosome 10, complete sequence Length = 200997 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 tatgcatgcatgcatgcatg 230 |||||||||||||||||||| Sbjct: 117198 tatgcatgcatgcatgcatg 117179
>gb|AC126442.4| Mus musculus BAC clone RP23-453M12 from chromosome 7, complete sequence Length = 204287 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgcatgcatgcatgcatgg 231 |||||||||||||||||||| Sbjct: 39608 atgcatgcatgcatgcatgg 39589 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,336,871 Number of Sequences: 3902068 Number of extensions: 3336871 Number of successful extensions: 103993 Number of sequences better than 10.0: 669 Number of HSP's better than 10.0 without gapping: 694 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 94942 Number of HSP's gapped (non-prelim): 7229 length of query: 443 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 421 effective length of database: 17,147,199,772 effective search space: 7218971104012 effective search space used: 7218971104012 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)