Clone Information

BLAST Search Result

Clone Name	rbastl30f01
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	ref\|NM_189326.1\| Oryza sativa (japonica cultivar-group), predic...	101	2e-18
2	dbj\|AP008207.1\| Oryza sativa (japonica cultivar-group) genomic D...	101	2e-18
3	dbj\|AP004326.3\| Oryza sativa (japonica cultivar-group) genomic D...	101	2e-18
4	dbj\|AK122121.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	94	5e-16
5	emb\|AL663055.13\| Mouse DNA sequence from clone RP23-102H8 on chr...	48	0.024
6	gb\|AC165322.12\| Mus musculus chromosome 1, clone RP23-127J15, co...	48	0.024
7	emb\|AL513351.26\| Mouse DNA sequence from clone RP23-122P5 on chr...	48	0.024
8	gb\|AC151980.3\| Mus musculus BAC clone RP24-83M3 from chromosome ...	46	0.097
9	gb\|AC122420.4\| Mus musculus BAC clone RP24-167C5 from chromosome...	46	0.097
10	gb\|AC127189.4\| Rattus norvegicus 1 BAC CH230-266M16 (Children's ...	44	0.38
11	gb\|AC117627.16\| Mus musculus chromosome 1, clone RP23-116N6, com...	44	0.38
12	gb\|AC124348.5\| Mus musculus BAC clone RP24-462O9 from chromosome...	44	0.38
13	gb\|AC132406.4\| Mus musculus BAC clone RP23-340E1 from chromosome...	44	0.38
14	gb\|AC151281.3\| Mus musculus BAC clone RP24-144E8 from chromosome...	44	0.38
15	emb\|AL354735.14\| Human DNA sequence from clone RP11-738I14 on ch...	44	0.38
16	gb\|AC163282.3\| Mus musculus BAC clone RP23-454I20 from chromosom...	44	0.38
17	dbj\|AK128451.1\| Homo sapiens cDNA FLJ46594 fis, clone THYMU3045692	44	0.38
18	gb\|AC092936.9\| Homo sapiens 12 BAC RP11-286J13 (Roswell Park Can...	44	0.38
19	gb\|BC034932.1\| Homo sapiens, clone IMAGE:4591517, mRNA	44	0.38
20	emb\|CT030161.10\| Mouse DNA sequence from clone RP23-235H10 on ch...	44	0.38
21	gb\|AC134594.5\| Mus musculus BAC clone RP23-388B6 from 12, comple...	44	0.38
22	emb\|AL929585.11\| Mouse DNA sequence from clone RP23-97O7 on chro...	44	0.38
23	gb\|AC127297.4\| Mus musculus BAC clone RP23-395B13 from chromosom...	44	0.38
24	emb\|AL627099.13\| Mouse DNA sequence from clone RP23-306F22 on ch...	44	0.38
25	gb\|AC114494.2\| Homo sapiens chromosome 1 clone RP11-439L8, compl...	44	0.38
26	gb\|AC154901.1\| Prunus persica (peach) BAC clone 82I18, complete ...	42	1.5
27	gb\|AC108429.11\| Mus musculus chromosome 7, clone RP23-161B5, com...	42	1.5
28	gb\|AC111115.13\| Mus musculus chromosome 5, clone RP23-213H20, co...	42	1.5
29	gb\|AC154221.3\| Mus musculus BAC clone RP24-373L7 from chromosome...	42	1.5
30	gb\|AC116788.14\| Mus musculus chromosome 8, clone RP24-296N13, co...	42	1.5
31	gb\|AC139574.4\| Mus musculus BAC clone RP23-477I8 from chromosome...	42	1.5
32	ref\|XM_469440.1\| Oryza sativa (japonica cultivar-group), mRNA	42	1.5
33	ref\|XM_469439.1\| Oryza sativa (japonica cultivar-group), mRNA	42	1.5
34	gb\|AC091670.7\| Oryza sativa (japonica cultivar-group) chromosome...	42	1.5
35	gb\|AY258809.1\| Xiphophorus maculatus microsatellite Msc018 sequence	42	1.5
36	gb\|AC165080.4\| Mus musculus BAC clone RP24-93F20 from chromosome...	42	1.5
37	gb\|AC099628.7\| Mus musculus chromosome 1, clone RP24-82L18, comp...	42	1.5
38	gb\|AC146430.4\| Pan troglodytes BAC clone RP43-21F8 from 7, compl...	42	1.5
39	gb\|AC140680.4\| Mus musculus BAC clone RP24-548A12 from chromosom...	42	1.5
40	gb\|AC138260.7\| Mus musculus chromosome 6, clone RP23-247I19, com...	42	1.5
41	gb\|AC122302.4\| Mus musculus BAC clone RP23-276E10 from chromosom...	42	1.5
42	gb\|AC165365.3\| Mus musculus BAC clone RP23-28N13 from chromosome...	42	1.5
43	gb\|DP000009.1\| Oryza sativa (japonica cultivar-group) chromosome 3	42	1.5
44	gb\|AC158347.4\| Mus musculus chromosome 3, clone RP23-380F8, comp...	42	1.5
45	gb\|AC141875.4\| Mus musculus BAC clone RP24-316O22 from chromosom...	42	1.5
46	gb\|AC099704.7\| Mus musculus chromosome 15, clone RP23-256A2, com...	42	1.5
47	gb\|AC101830.7\| Mus musculus chromosome 1, clone RP24-480B20, com...	42	1.5
48	gb\|AC133334.8\| Oryza sativa chromosome 3 BAC OSJNBa0004L11 genom...	42	1.5
49	gb\|AC139572.4\| Mus musculus BAC clone RP24-196P9 from chromosome...	42	1.5
50	gb\|AC133950.4\| Mus musculus BAC clone RP24-243C16 from chromosom...	42	1.5
51	gb\|AC122375.4\| Mus musculus BAC clone RP23-469G18 from chromosom...	42	1.5
52	gb\|AC127553.3\| Mus musculus BAC clone RP24-553F11 from chromosom...	42	1.5
53	gb\|AC116656.5\| Mus musculus BAC clone RP23-10A7 from chromosome ...	42	1.5
54	gb\|AC126272.3\| Mus musculus BAC clone RP23-48P22 from chromosome...	42	1.5
55	gb\|AC124558.4\| Mus musculus BAC clone RP23-248O8 from chromosome...	42	1.5
56	gb\|AC073600.3\| Genomic sequence for Mus musculus, clone RP23-119...	42	1.5
57	gb\|AC131773.3\| Mus musculus BAC clone RP24-308A19 from chromosom...	42	1.5
58	gb\|AC123826.4\| Mus musculus BAC clone RP24-97K3 from chromosome ...	42	1.5
59	gb\|AC126032.4\| Mus musculus BAC clone RP24-94B12 from chromosome...	42	1.5
60	gb\|AC129606.4\| Mus musculus BAC clone RP23-128L6 from 8, complet...	42	1.5
61	gb\|AC113527.8\| Mus musculus chromosome 9, clone RP23-314E23, com...	42	1.5
62	gb\|AC108423.10\| Mus musculus chromosome 16, clone RP23-443N12, c...	42	1.5
63	gb\|AC101810.5\| Mus musculus chromosome 15, clone RP24-278M16, co...	42	1.5
64	gb\|AC159140.10\| Mus musculus chromosome 7, clone RP24-84I4, comp...	42	1.5
65	gb\|AC105302.27\| Mus musculus strain C57BL/6J clone rp23-45h18 ma...	42	1.5
66	emb\|AL160032.14\| Human DNA sequence from clone RP11-474L7 on chr...	42	1.5
67	emb\|AL031279.1\|HS163O16 Human DNA sequence from clone RP1-163O16...	42	1.5
68	gb\|AC154601.3\| Mus musculus BAC clone RP23-342J18 from chromosom...	42	1.5
69	emb\|AL596103.22\| Mouse DNA sequence from clone RP23-309E16 on ch...	42	1.5
70	gb\|AC154413.3\| Mus musculus BAC clone RP24-230J5 from chromosome...	42	1.5
71	gb\|AC126615.7\| Homo sapiens 12 BAC RP11-129B9 (Roswell Park Canc...	42	1.5
72	emb\|CR545472.6\| Zebrafish DNA sequence from clone DKEYP-32B1 in ...	42	1.5
73	gb\|AC109453.2\| Homo sapiens chromosome 5 clone RP11-203G23, comp...	42	1.5
74	gb\|AC119072.1\| Oryza sativa ssp. japonica cv. Nipponbare OSJNBa0...	42	1.5
75	dbj\|AB076248.1\| Mus musculus DNA, BAC clone:No.251,465	42	1.5
76	emb\|AL929441.37\| Mouse DNA sequence from clone RP23-418E20 on ch...	42	1.5
77	gb\|AC008949.9\| Homo sapiens chromosome 5 clone CTD-2335O24, comp...	42	1.5
78	gb\|AF249952.1\|AF249952 Euterpe precatoria malate synthase gene, ...	42	1.5
79	gb\|AC004863.5\|AC004863 Homo sapiens PAC clone RP4-708P22 from 7,...	42	1.5
80	dbj\|AP008210.1\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
81	dbj\|AP008218.1\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
82	dbj\|AP008217.1\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
83	dbj\|AP008214.1\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
84	dbj\|AP008213.1\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
85	dbj\|AP008209.1\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
86	dbj\|AP008208.1\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
87	gb\|AC115949.13\| Mus musculus chromosome 3, clone RP24-568B16, co...	42	1.5
88	gb\|AC149590.5\| Mus musculus BAC clone RP23-348L9 from chromosome...	42	1.5
89	gb\|AC090963.32\| Mus musculus strain C57BL/6J chromosome 17 clone...	42	1.5
90	gb\|AC090653.36\| Mus musculus strain C57BL/6J chromosome 17 clone...	42	1.5
91	gb\|AC087593.6\| Homo sapiens chromosome 15, clone RP11-247E14, co...	42	1.5
92	dbj\|AP005526.3\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
93	dbj\|AP005124.5\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
94	dbj\|AP003743.4\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
95	dbj\|AP004770.3\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
96	emb\|AL929254.12\| Mouse DNA sequence from clone RP23-456I1 on chr...	42	1.5
97	dbj\|AP005506.3\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
98	dbj\|AP004183.3\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
99	dbj\|AK111846.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	42	1.5
100	gb\|AC147869.3\| Monodelphis domestica clone VMRC6-113K21, complet...	42	1.5
101	gb\|AC131741.4\| Mus musculus BAC clone RP23-66E21 from 7, complet...	42	1.5
102	gb\|AC107631.20\| Mus musculus chromosome 5, clone RP23-5M20, comp...	42	1.5
103	gb\|AC101838.17\| Mus musculus chromosome 1, clone RP23-242B14, co...	42	1.5
104	gb\|AC113464.17\| Mus musculus chromosome 8, clone RP23-183P1, com...	42	1.5
105	gb\|AC110037.13\| Mus musculus chromosome 5, clone RP23-257E17, co...	42	1.5
106	emb\|CT033775.6\| Mouse DNA sequence from clone RP24-145H15 on chr...	42	1.5
107	emb\|AL591542.20\| Mouse DNA sequence from clone RP23-321M14 on ch...	42	1.5
108	gb\|DP000010.1\| Oryza sativa (japonica cultivar-group) chromosome...	42	1.5
109	gb\|DP000011.1\| Oryza sativa (japonica cultivar-group) chromosome...	42	1.5
110	emb\|AL772425.7\|CNS08CA3 Oryza sativa chromosome 12, . BAC OJ1396...	42	1.5
111	emb\|AL606637.3\|OSJN00076 Oryza sativa genomic DNA, chromosome 4,...	42	1.5
112	gb\|AC171896.2\| Capitella capitata clone JGIBGZA-33J12, complete ...	42	1.5
113	gb\|AC145597.4\| Mus musculus BAC clone RP24-323M2 from Y, complet...	42	1.5
114	gb\|AC132589.4\| Mus musculus BAC clone RP24-258M24 from 1, comple...	42	1.5
115	gb\|AC145610.4\| Mus musculus BAC clone RP24-281O20 from 18, compl...	42	1.5
116	gb\|AC140250.3\| Mus musculus BAC clone RP24-288J3 from 1, complet...	42	1.5
117	emb\|AL844846.11\| Mouse DNA sequence from clone RP23-358I19 on ch...	42	1.5
118	emb\|CT009700.8\| Mouse DNA sequence from clone RP23-114M15 on chr...	42	1.5
119	gb\|AC164092.3\| Mus musculus BAC clone RP23-366E4 from chromosome...	42	1.5
120	gb\|DP000021.1\| Monodelphis domestica target 1 genomic scaffold	42	1.5
121	emb\|AL662925.12\| Mouse DNA sequence from clone RP23-226M12 on ch...	42	1.5
122	emb\|AL627214.15\| Mouse DNA sequence from clone RP23-357K18 on ch...	42	1.5
123	emb\|AL683893.26\| Mouse DNA sequence from clone RP23-122N18 on ch...	42	1.5
124	emb\|AL671910.9\| Mouse DNA sequence from clone RP23-245M12 on chr...	42	1.5
125	emb\|AL671173.12\| Mouse DNA sequence from clone RP23-426N4 on chr...	42	1.5
126	emb\|AL691448.24\| Mouse DNA sequence from clone RP23-103A1 on chr...	42	1.5
127	emb\|AL671011.9\| Mouse DNA sequence from clone RP23-95O23 on chro...	42	1.5
128	emb\|AL732513.8\| Mouse DNA sequence from clone RP23-344B24 on chr...	42	1.5
129	emb\|AL645531.10\| Mouse DNA sequence from clone RP23-191E19 on ch...	42	1.5
130	emb\|AL627345.11\| Mouse DNA sequence from clone RP23-169E7 on chr...	42	1.5
131	gb\|AC102103.10\| Mus musculus chromosome 15, clone RP23-82K1, com...	40	6.0
132	gb\|AC105966.11\| Mus musculus chromosome 3, clone RP23-403H2, com...	40	6.0
133	gb\|AC164069.9\| Mus musculus chromosome 15, clone RP23-422H17, co...	40	6.0
134	gb\|AC153383.1\| Mus musculus 6 BAC RP23-168L2 (Roswell Park Cance...	40	6.0
135	gb\|AC124664.14\| Mus musculus chromosome 1, clone RP23-103B18, co...	40	6.0
136	gb\|AC113121.27\| Mus musculus chromosome 8, clone RP23-347G12, co...	40	6.0
137	gb\|AC163102.5\| Mus musculus chromosome 18, clone RP23-270E10, co...	40	6.0
138	gb\|DQ257594.1\| Hordeum vulgare subsp. vulgare clone 33-23A-RB fl...	40	6.0
139	gb\|AC121942.2\| Mus musculus chromosome 13 clone RP24-211D12, com...	40	6.0
140	gb\|AC132830.12\| Mus musculus chromosome 1, clone RP24-566B6, com...	40	6.0
141	gb\|AC165162.4\| Mus musculus BAC clone RP23-173L24 from chromosom...	40	6.0
142	gb\|AC166158.3\| Mus musculus BAC clone RP24-244P14 from chromosom...	40	6.0
143	gb\|AC167971.3\| Mus musculus BAC clone RP24-439I22 from chromosom...	40	6.0
144	gb\|AC163097.11\| Mus musculus chromosome 8, clone RP23-135D17, co...	40	6.0
145	ref\|XM_467048.1\| Oryza sativa (japonica cultivar-group), mRNA	40	6.0
146	gb\|AC110214.7\| Mus musculus chromosome 8, clone RP24-485L5, comp...	40	6.0
147	gb\|DP000017.1\| Sus scrofa target 1 genomic scaffold	40	6.0
148	gb\|AC116853.12\| Mus musculus chromosome 1, clone RP24-400M20, co...	40	6.0
149	gb\|AC148611.1\| Oryza sativa (japonica cultivar-group) chromosome...	40	6.0
150	gb\|CP000078.1\| Leishmania major strain Friedlin chromosome 2, co...	40	6.0
151	gb\|AF405701.1\| Synthetic construct legume box RY repeat motif se...	40	6.0
152	gb\|AY024014.1\| Oryza sativa microsatellite MRG6339 containing (C...	40	6.0
153	gb\|AC147925.2\| Oryza sativa (japonica cultivar-group) chromosome...	40	6.0
154	gb\|AY258744.1\| Xiphophorus maculatus microsatellite Msc045 sequence	40	6.0
155	gb\|AC164649.4\| Mus musculus BAC clone RP23-437D10 from chromosom...	40	6.0
156	gb\|AC154641.2\| Mus musculus BAC clone RP23-276C17 from chromosom...	40	6.0
157	gb\|AC164703.3\| Mus musculus BAC clone RP23-266K19 from chromosom...	40	6.0
158	gb\|AC091677.12\| Mus musculus chromosome 18, clone RP23-131E5, co...	40	6.0
159	gb\|AC130598.2\| Oryza sativa (japonica cultivar-group) chromosome...	40	6.0
160	gb\|AC120986.2\| Oryza sativa (japonica cultivar-group) chromosome...	40	6.0
161	gb\|AC116507.9\| Mus musculus chromosome 19, clone RP24-309C17, co...	40	6.0
162	gb\|AC102874.7\| Mus musculus chromosome 1, clone RP24-500O1, comp...	40	6.0
163	gb\|AC135190.2\| Oryza sativa (japonica cultivar-group) chromosome...	40	6.0
164	gb\|AY663543.1\| Sus scrofa albumin gene, complete cds	40	6.0
165	gb\|AC106169.5\| Rattus norvegicus x BAC CH230-105D14 (Children's ...	40	6.0
166	gb\|AF130357.2\| Mus musculus chromosome X clone CT7-148C10, compl...	40	6.0
167	gb\|AC102285.7\| Mus musculus chromosome 19, clone RP24-329P13, co...	40	6.0
168	gb\|AC136998.2\| Oryza sativa (japonica cultivar-group) chromosome...	40	6.0
169	gb\|AY532747.1\| Zea mays subsp. parviglumis isolate p5 chitinase ...	40	6.0
170	gb\|AC115746.10\| Mus musculus chromosome 15, clone RP23-3J8, comp...	40	6.0
171	gb\|AC124830.8\| Mus musculus chromosome 17, clone RP24-165B21, co...	40	6.0
172	gb\|AC124143.2\| Oryza sativa (japonica cultivar-group) chromosome...	40	6.0
173	gb\|AC137592.2\| Oryza sativa (Japonica cultiva-group) chromosome ...	40	6.0
174	gb\|AC115036.10\| Mus musculus chromosome 7, clone RP24-274F20, co...	40	6.0
175	gb\|AC107206.4\| Oryza sativa chromosome 3 BAC OSJNBa0063J18 genom...	40	6.0
176	gb\|AC134839.3\| Mus musculus BAC clone RP24-362O23 from chromosom...	40	6.0
177	gb\|AC137156.3\| Mus musculus BAC clone RP23-118K10 from chromosom...	40	6.0
178	gb\|AC141565.3\| Mus musculus BAC clone RP23-160M21 from chromosom...	40	6.0
179	gb\|AC130546.4\| Mus musculus BAC clone RP24-303D11 from chromosom...	40	6.0
180	gb\|AC132107.3\| Mus musculus BAC clone RP24-251C17 from chromosom...	40	6.0
181	gb\|AC135567.3\| Mus musculus BAC clone RP23-312I24 from chromosom...	40	6.0
182	gb\|AC140389.3\| Mus musculus BAC clone RP24-202H2 from chromosome...	40	6.0
183	gb\|AC145740.4\| Mus musculus BAC clone RP24-233K8 from chromosome...	40	6.0
184	gb\|AC119181.11\| Mus musculus chromosome 18, clone RP24-111I16, c...	40	6.0
185	gb\|AC134735.3\| Rattus norvegicus 20 BAC CH230-1P16 (Children's H...	40	6.0
186	gb\|AC145084.6\| Mus musculus chromosome 18, clone RP24-175N20, co...	40	6.0
187	gb\|AC124211.2\| Mus musculus chromosome X clone CT7-497M13 map qA...	40	6.0
188	gb\|AY372324.1\| Diastema racemiferum internal transcribed spacer ...	40	6.0
189	gb\|AC133902.12\| Mus musculus chromosome 10, clone RP24-538B17, c...	40	6.0
190	gb\|AC069309.4\| Mus musculus strain C57BL6/J chromosome 6 clone R...	40	6.0
191	gb\|AC115714.14\| Mus musculus chromosome 12, clone RP23-477C24, c...	40	6.0
192	gb\|AC108876.2\| Oryza sativa (japonica cultivar-group) chromosome...	40	6.0
193	gb\|AC096884.2\| Sus scrofa clone RP44-519O7, complete sequence	40	6.0
194	gb\|AC146059.4\| Pan troglodytes BAC clone RP43-14K1 from 7, compl...	40	6.0
195	gb\|AC131713.3\| Mus musculus BAC clone RP23-193O18 from chromosom...	40	6.0
196	gb\|AC145307.3\| Mus musculus BAC clone RP24-400C6 from chromosome...	40	6.0
197	gb\|AC161514.4\| Mus musculus chromosome 7, clone RP23-378L12, com...	40	6.0
198	gb\|AC140042.19\| Mus musculus chromosome 5, clone RP23-437D10, co...	40	6.0
199	gb\|DQ175932.1\| Hordeum vulgare subsp. vulgare clone 33-25A-RB fl...	40	6.0
200	gb\|AC091464.8\| Mus musculus chromosome 14, clone RP23-97N1, comp...	40	6.0
201	gb\|AC079957.5\| Mus musculus strain C57BL6/J chromosome 6 clone R...	40	6.0
202	gb\|AC116515.11\| Mus musculus chromosome 7, clone RP24-331B9, com...	40	6.0
203	gb\|AC161217.7\| Mus musculus chromosome 8, clone RP23-80D9, compl...	40	6.0
204	gb\|AC153010.3\| Mus musculus BAC clone RP23-325H1 from chromosome...	40	6.0
205	gb\|AC166827.2\| Mus musculus BAC clone RP23-359M9 from chromosome...	40	6.0
206	gb\|AC109139.15\| Mus musculus chromosome 8, clone RP23-47L13, com...	40	6.0
207	gb\|AC104868.8\| Mus musculus chromosome 1, clone RP24-532K6, comp...	40	6.0
208	gb\|AC163668.5\| Mus musculus BAC clone RP23-32P22 from chromosome...	40	6.0
209	gb\|AC159244.4\| Mus musculus BAC clone RP24-309L4 from chromosome...	40	6.0
210	gb\|AC121290.6\| Mus musculus chromosome 16, clone RP23-84N4, comp...	40	6.0
211	gb\|DQ160222.1\|DQ160222S1 Zea mays pericarp color 1 gene, pericar...	40	6.0
212	gb\|AC163616.3\| Mus musculus BAC clone RP23-114P22 from chromosom...	40	6.0
213	gb\|AC155823.8\| Mus musculus BAC clone RP23-348C5 from chromosome...	40	6.0
214	gb\|AC161364.4\| Mus musculus BAC clone RP24-353J16 from chromosom...	40	6.0
215	gb\|AC164121.3\| Mus musculus BAC clone RP24-406J12 from chromosom...	40	6.0
216	gb\|AC158612.7\| Mus musculus 10 BAC RP23-39I3 (Roswell Park Cance...	40	6.0
217	gb\|AC131105.4\| Mus musculus BAC clone RP23-280N9 from chromosome...	40	6.0
218	gb\|AC137108.12\| Mus musculus chromosome 9, clone RP23-277J20, co...	40	6.0
219	gb\|AC121992.3\| Mus musculus BAC clone RP24-300I17 from chromosom...	40	6.0
220	gb\|AC105066.12\| Mus musculus chromosome 8, clone RP23-158A22, co...	40	6.0
221	gb\|AC123693.13\| Mus musculus chromosome 3, clone RP23-326F23, co...	40	6.0
222	gb\|AC121079.20\| Mus musculus chromosome 3, clone RP24-178P12, co...	40	6.0
223	gb\|AC102392.8\| Mus musculus chromosome 3, clone RP24-122I22, com...	40	6.0
224	gb\|AC133967.2\| Mus musculus BAC clone RP23-14J5 from chromosome ...	40	6.0
225	gb\|AC122376.4\| Mus musculus BAC clone RP23-472G10 from chromosom...	40	6.0
226	gb\|AC132590.3\| Mus musculus BAC clone RP24-273G1 from chromosome...	40	6.0
227	gb\|AC142474.4\| Mus musculus BAC clone RP24-362N7 from chromosome...	40	6.0
228	emb\|CT025649.7\| Mouse DNA sequence from clone RP24-345B5 on chro...	40	6.0
229	emb\|AL935124.31\| Mouse DNA sequence from clone RP23-88C15 on chr...	40	6.0
230	emb\|BX901970.11\| Zebrafish DNA sequence from clone CH211-214I7 i...	40	6.0
231	emb\|CT025643.4\| Mouse DNA sequence from clone RP24-386L23 on chr...	40	6.0
232	emb\|AJ578690.1\|EGU578690 Elaeis guineensis microsatellite DNA, c...	40	6.0
233	emb\|AJ438040.1\|TCH438040 Tetraselmis chui DNA containing repeats...	40	6.0
234	emb\|CT009546.4\| Mouse DNA sequence from clone RP23-111H19 on chr...	40	6.0
235	emb\|BX324230.15\| Zebrafish DNA sequence from clone CH211-42C5 in...	40	6.0
236	gb\|AC115361.5\| Mus musculus BAC clone RP24-76P12 from chromosome...	40	6.0
237	gb\|AC132272.3\| Mus musculus BAC clone RP24-339P23 from chromosom...	40	6.0
238	gb\|AC122000.3\| Mus musculus BAC clone RP24-328N20 from chromosom...	40	6.0
239	gb\|AC129198.3\| Mus musculus BAC clone RP24-183I4 from chromosome...	40	6.0
240	gb\|AC125096.3\| Mus musculus BAC clone RP24-181K19 from chromosom...	40	6.0
241	gb\|AC126671.3\| Mus musculus BAC clone RP24-472G2 from chromosome...	40	6.0
242	gb\|AC127557.5\| Mus musculus BAC clone RP24-416I20 from chromosom...	40	6.0
243	gb\|AC129590.4\| Mus musculus BAC clone RP24-428B12 from chromosom...	40	6.0
244	gb\|AC134441.4\| Mus musculus BAC clone RP24-544J6 from chromosome...	40	6.0
245	gb\|AC122299.5\| Mus musculus BAC clone RP23-270L23 from chromosom...	40	6.0
246	gb\|AC116319.4\| Mus musculus BAC clone RP23-265J2 from chromosome...	40	6.0
247	gb\|AC126447.3\| Mus musculus BAC clone RP23-352G19 from chromosom...	40	6.0
248	gb\|AC122365.4\| Mus musculus BAC clone RP23-447A7 from chromosome...	40	6.0
249	gb\|AC123842.4\| Mus musculus BAC clone RP23-400N18 from chromosom...	40	6.0
250	gb\|AC126442.4\| Mus musculus BAC clone RP23-453M12 from chromosom...	40	6.0
251	emb\|AL929389.9\| Zebrafish DNA sequence from clone CH211-51H4 in ...	40	6.0
252	gb\|AF441733.2\| Mus musculus clone RP23-225M6 45S pre-ribosomal R...	40	6.0
253	gb\|AC129305.4\| Mus musculus BAC clone RP24-472F1 from chromosome...	40	6.0
254	gb\|AC118248.11\| Mus musculus chromosome 8, clone RP23-379H17, co...	40	6.0
255	gb\|AC127419.3\| Mus musculus BAC clone RP24-242N1 from chromosome...	40	6.0
256	gb\|AC124683.3\| Mus musculus BAC clone RP24-349E11 from chromosom...	40	6.0
257	gb\|AC123053.4\| Mus musculus BAC clone RP24-374O20 from chromosom...	40	6.0
258	gb\|AC125157.4\| Mus musculus BAC clone RP24-390G17 from chromosom...	40	6.0
259	gb\|AC122505.4\| Mus musculus BAC clone RP24-419P3 from chromosome...	40	6.0
260	gb\|AC125130.3\| Mus musculus BAC clone RP24-309C7 from chromosome...	40	6.0
261	gb\|AC127549.3\| Mus musculus BAC clone RP24-510G5 from chromosome...	40	6.0
262	gb\|AC122524.3\| Mus musculus BAC clone RP24-494L9 from chromosome...	40	6.0
263	gb\|AC121816.3\| Mus musculus BAC clone RP23-458H21 from chromosom...	40	6.0
264	gb\|AC125074.3\| Mus musculus BAC clone RP23-464N18 from chromosom...	40	6.0
265	gb\|AC129313.4\| Mus musculus BAC clone RP23-342K4 from chromosome...	40	6.0
266	gb\|AC121882.3\| Mus musculus BAC clone RP24-135M19 from chromosom...	40	6.0
267	gb\|AC122422.4\| Mus musculus BAC clone RP24-169N11 from chromosom...	40	6.0
268	gb\|AC122919.3\| Mus musculus BAC clone RP23-30C12 from 10, comple...	40	6.0
269	gb\|AC126548.4\| Mus musculus BAC clone RP24-199M7 from chromosome...	40	6.0
270	gb\|AC124699.4\| Mus musculus BAC clone RP24-187B13 from chromosom...	40	6.0
271	gb\|AC129603.3\| Mus musculus BAC clone RP23-63E1 from 18, complet...	40	6.0
272	emb\|BX950203.15\| Zebrafish DNA sequence from clone CH211-108P22,...	40	6.0
273	gb\|AC084162.3\| Mus musculus strain C57BL6/J chromosome 5 clone R...	40	6.0
274	emb\|CR956416.5\| Pig DNA sequence from clone PigI-464E6 on chromo...	40	6.0
275	gb\|AC124170.3\| Mus musculus BAC clone RP23-155H5 from 8, complet...	40	6.0
276	gb\|AC122850.4\| Mus musculus BAC clone RP23-167J19 from 10, compl...	40	6.0
277	gb\|AC122836.4\| Mus musculus BAC clone RP23-188B13 from 7, comple...	40	6.0
278	gb\|AC131652.2\| Mus musculus BAC clone RP23-216A20 from 16, compl...	40	6.0
279	gb\|AC123870.3\| Mus musculus BAC clone RP23-246A19 from 15, compl...	40	6.0
280	gb\|AC127326.4\| Mus musculus BAC clone RP23-251C4 from 8, complet...	40	6.0
281	gb\|AC122799.4\| Mus musculus BAC clone RP23-308K11 from 16, compl...	40	6.0
282	gb\|AC100149.12\| Mus musculus chromosome 10, clone RP23-43F3, com...	40	6.0
283	gb\|AC114916.5\| Mus musculus BAC clone RP23-68E10 from 15, comple...	40	6.0
284	gb\|AC105407.5\| Mus musculus BAC clone RP24-196J17 from 13, compl...	40	6.0
285	gb\|AC115305.4\| Mus musculus BAC clone RP24-372L1 from 18, comple...	40	6.0
286	emb\|AL512587.13\| Mouse DNA sequence from clone RP23-467P7 on chr...	40	6.0
287	emb\|CR293534.5\| Zebrafish DNA sequence from clone CH211-13J1 in ...	40	6.0
288	emb\|CR734256.1\| Tetraodon nigroviridis full-length cDNA	40	6.0
289	gb\|AC118681.6\| Mus musculus chromosome 16, clone RP23-473M11, co...	40	6.0
290	gb\|AC092075.7\| Oryza sativa chromosome 3 BAC OSJNBa0017N12 genom...	40	6.0
291	gb\|AC120509.3\| Oryza sativa chromosome 3 BAC OSJNBb0081K01 genom...	40	6.0
292	gb\|AC110554.10\| Mus musculus chromosome 8, clone RP23-249H16, co...	40	6.0
293	ref\|XM_673558.1\| Plasmodium berghei strain ANKA hypothetical pro...	40	6.0
294	gb\|AC113501.7\| Mus musculus chromosome 6, clone RP23-367E20, com...	40	6.0
295	gb\|AC023248.20\| Mus musculus chromosome 7, clone RP23-124B2, com...	40	6.0
296	gb\|AC102626.9\| Mus musculus chromosome 12, clone RP23-456E21, co...	40	6.0
297	gb\|AC160106.2\| Mus musculus BAC clone RP24-300H23 from chromosom...	40	6.0
298	gb\|AC151904.6\| Mus musculus BAC clone RP23-233K6 from chromosome...	40	6.0
299	gb\|AC166755.2\| Mus musculus BAC clone RP24-220N14 from chromosom...	40	6.0
300	gb\|AC107231.9\| Mus musculus chromosome 14, clone RP23-475A2, com...	40	6.0
301	gb\|AC145867.2\| Pan troglodytes BAC clone RP43-21B15 from 7, comp...	40	6.0
302	gb\|AC124732.5\| Mus musculus BAC clone RP23-300J20 from chromosom...	40	6.0
303	gb\|AC139214.12\| Mus musculus chromosome 17, clone RP23-345D6, co...	40	6.0
304	gb\|AC104329.22\| Mus musculus strain C57BL/6J clone rp23-418c12 m...	40	6.0
305	gb\|AC109603.8\| Mus musculus strain 129/Sv clone ct7-534h6 map 5,...	40	6.0
306	gb\|AC144389.22\| Medicago truncatula clone mth2-25e14, complete s...	40	6.0
307	gb\|AC159272.2\| Mus musculus BAC clone RP23-423J20 from chromosom...	40	6.0
308	gb\|AC153583.10\| Mus musculus 6 BAC RP23-349K15 (Roswell Park Can...	40	6.0
309	gb\|AC144483.10\| Medicago truncatula clone mth2-12f13, complete s...	40	6.0
310	gb\|AC125452.7\| Mus musculus, clone RP23-43F6, complete sequence	40	6.0
311	gb\|AC139045.7\| Mus musculus chromosome 7, clone RP23-466H15, com...	40	6.0
312	gb\|AC163637.4\| Mus musculus BAC clone RP23-186O3 from chromosome...	40	6.0
313	gb\|AC154556.2\| Mus musculus BAC clone RP23-423F3 from chromosome...	40	6.0
314	gb\|AC154836.2\| Mus musculus BAC clone RP24-574D17 from chromosom...	40	6.0
315	emb\|BX927158.14\| Zebrafish DNA sequence from clone DKEY-106K1 in...	40	6.0
316	gb\|AC157912.4\| Mus musculus chromosome 19, clone RP24-241F10, co...	40	6.0
317	gb\|AC158914.4\| Mus musculus chromosome 5, clone RP24-249F11, com...	40	6.0
318	gb\|AC163440.3\| Mus musculus chromosome 1, clone RP23-445K8, comp...	40	6.0
319	gb\|AC112342.14\| Rattus norvegicus 14 BAC CH230-253H12 (Children'...	40	6.0
320	gb\|AC110255.10\| Mus musculus, clone RP23-274K7, complete sequence	40	6.0
321	emb\|CR457452.12\| Zebrafish DNA sequence from clone DKEY-52H10 in...	40	6.0
322	emb\|CR788262.4\| Zebrafish DNA sequence from clone DKEY-231J24 in...	40	6.0
323	emb\|CR381696.5\| Human DNA sequence from clone RP13-858C7 on chro...	40	6.0
324	emb\|AL807757.9\| Human DNA sequence from clone RP11-49O14 on chro...	40	6.0
325	emb\|AL390066.5\| Human DNA sequence from clone RP5-1086K13 on chr...	40	6.0
326	emb\|AL357934.29\| Human DNA sequence from clone RP11-565P9 on chr...	40	6.0
327	gb\|AY338965.1\| Arisaema heterophyllum mannose-binding lectin AHA...	40	6.0
328	gb\|AC122091.6\| Rattus norvegicus 9 BAC CH230-375L16 (Children's ...	40	6.0
329	emb\|AL157392.18\| Human DNA sequence from clone RP11-295P9 on chr...	40	6.0
330	gb\|AC137989.2\| Oryza sativa (japonica cultivar-group) chromosome...	40	6.0
331	emb\|AL022170.1\|HS501N12 Human DNA sequence from clone RP3-501N12...	40	6.0
332	gb\|AC137507.3\| Oryza sativa chromosome 3 BAC OSJNBb0033J23 genom...	40	6.0
333	emb\|CR354557.9\| Zebrafish DNA sequence from clone DKEY-34I7 in l...	40	6.0
334	gb\|AC133618.3\| Rattus norvegicus 18 BAC CH230-71N8 (Children's H...	40	6.0
335	gb\|AC175313.5\| Mus musculus chromosome 5, clone wi1-1204C16, com...	40	6.0
336	gb\|AC175314.3\| Mus musculus chromosome 5, clone wi1-1538A18, com...	40	6.0
337	gb\|AC074335.11\| Mus Musculus Strain C57BL6/J Chromosome 18 BAC, ...	40	6.0
338	gb\|AC166574.1\| Mus musculus BAC clone RP23-131O4 from chromosome...	40	6.0
339	gb\|AC105729.2\| Oryza sativa (japonica cultivar-group) chromosome...	40	6.0
340	gb\|AC159199.3\| Mus musculus BAC clone RP23-401H23 from chromosom...	40	6.0
341	gb\|AC156555.8\| Mus musculus chromosome 7, clone RP23-59P20, comp...	40	6.0
342	emb\|BX883046.1\| Rattus norvegicus chromosome 20, major histocomp...	40	6.0
343	emb\|AL646088.23\| Mouse DNA sequence from clone RP23-58E13 on chr...	40	6.0
344	gb\|AY702354.1\| Diastema comiferum internal transcribed spacer 1,...	40	6.0
345	gb\|AC162918.3\| Mus musculus BAC clone RP23-370K14 from chromosom...	40	6.0
346	gb\|AC163344.2\| Mus musculus BAC clone RP24-66I20 from chromosome...	40	6.0
347	gb\|AC166247.3\| Mus musculus BAC RP23-426E9 (Roswell Park Cancer...	40	6.0
348	emb\|BX538352.1\| Cryptosporidium parvum chromosome 6, complete se...	40	6.0
349	emb\|BX538350.1\| Cryptosporidium parvum chromosome 6, complete se...	40	6.0
350	emb\|AL606724.17\| Mouse DNA sequence from clone RP23-285D3 on chr...	40	6.0
351	emb\|AL627187.13\| Mouse DNA sequence from clone RP23-319B15 on ch...	40	6.0
352	emb\|AL645802.11\| Mouse DNA sequence from clone RP23-128D9 on chr...	40	6.0
353	emb\|AL161533.2\|ATCHRIV33 Arabidopsis thaliana DNA chromosome 4, ...	40	6.0
354	emb\|AL161532.2\|ATCHRIV32 Arabidopsis thaliana DNA chromosome 4, ...	40	6.0
355	emb\|AL078606.1\|ATT26M18 Arabidopsis thaliana DNA chromosome 4, B...	40	6.0
356	gb\|AC115870.18\| Mus musculus chromosome 1, clone RP24-339L17, co...	40	6.0
357	emb\|AJ314857.1\|RNO314857 Rattus norvegicus Nfkbil1 gene (partial...	40	6.0
358	emb\|CR762497.17\| Zebrafish DNA sequence from clone DKEY-162B3 in...	40	6.0
359	emb\|CR559945.12\| Zebrafish DNA sequence from clone CH211-195E19 ...	40	6.0
360	gb\|AC007995.23\| Mus musculus, clone RP23-266E9, complete sequence	40	6.0
361	gb\|AC161890.4\| Mus musculus 6 BAC RP23-356P12 (Roswell Park Canc...	40	6.0
362	emb\|AL662868.15\| Mouse DNA sequence from clone RP23-144P24 on ch...	40	6.0
363	emb\|AL646096.8\| Mouse DNA sequence from clone RP23-176J13 on chr...	40	6.0
364	emb\|AL772409.4\| Mouse DNA sequence from clone RP23-323L8 on chro...	40	6.0
365	emb\|BX897733.8\| Zebrafish DNA sequence from clone CH211-105D4 in...	40	6.0
366	emb\|BX005025.16\| Zebrafish DNA sequence from clone DKEY-67K20 in...	40	6.0
367	emb\|AL806524.10\| Mouse DNA sequence from clone RP23-158E10 on ch...	40	6.0
368	gb\|AF280813.3\| Homo sapiens chromosome 8 clone RP1-144M5 map 8p2...	40	6.0
369	gb\|AC093004.2\| Homo sapiens 3 BAC RP11-129J11 (Roswell Park Canc...	40	6.0
370	gb\|AC102076.9\| Mus musculus chromosome 7, clone RP23-401P12, com...	40	6.0
371	emb\|AL607131.15\| Mouse DNA sequence from clone RP23-372H19 on ch...	40	6.0
372	emb\|BX510646.5\| Zebrafish DNA sequence from clone CH211-221B16 i...	40	6.0
373	emb\|BX511171.13\| Zebrafish DNA sequence from clone DKEY-264K15 i...	40	6.0
374	gb\|AC165445.1\| Mus musculus BAC clone RP23-10J16 from chromosome...	40	6.0
375	gb\|AC063968.5\| Genomic sequence for Mus musculus, clone RP23-105...	40	6.0
376	emb\|BX571792.9\| Zebrafish DNA sequence from clone CH211-177D9 in...	40	6.0
377	emb\|BX957309.6\| Zebrafish DNA sequence from clone CH211-113P19 i...	40	6.0
378	gb\|AC163292.2\| Mus musculus BAC clone RP23-241P22 from chromosom...	40	6.0
379	gb\|AC084826.4\| Genomic sequence for Mus musculus, clone RP23-146...	40	6.0
380	gb\|AC022780.19\| Mus musculus chromosome 11, clone RP23-179C3, co...	40	6.0
381	gb\|AC091236.8\| Mus Musculus Strain C57BL6/J Chromosome 14 BAC, R...	40	6.0
382	gb\|AC092472.3\| Homo sapiens chromosome 8 clone RP1-96P7 map map ...	40	6.0
383	emb\|AL935056.18\| Mouse DNA sequence from clone RP23-185F7 on chr...	40	6.0
384	gb\|AF279892.1\| Rattus norvegicus 7-dehydrocholesterol reductase ...	40	6.0
385	gb\|AC090259.5\| Homo sapiens chromosome 15, clone RP11-424E9, com...	40	6.0
386	gb\|AC009137.8\| Homo sapiens chromosome 16 clone RP11-521L9, comp...	40	6.0
387	gb\|AC100825.2\| Homo sapiens chromosome 15, clone RP11-1152M12, c...	40	6.0
388	gb\|AC068496.7\| Mus musculus chromosome 3 clone RP23-75F13 clone ...	40	6.0
389	gb\|AC090274.6\| Homo sapiens chromosome 8, clone RP1-144M5, compl...	40	6.0
390	gb\|AY013245.2\| Oryza sativa (japonica cultivar-group) chromosome...	40	6.0
391	gb\|AC157667.11\| Mus musculus 6 BAC RP24-86B22 (Roswell Park Canc...	40	6.0
392	dbj\|AB036512.1\| Mus musculus gene for synaptotagmin II, exons 1 ...	40	6.0
393	dbj\|AK133657.1\| Mus musculus adult male pituitary gland cDNA, RI...	40	6.0
394	gb\|AY047069.1\| Diastema racemiferum internal transcribed spacer ...	40	6.0
395	dbj\|AK154886.1\| Mus musculus NOD-derived CD11c +ve dendritic cel...	40	6.0
396	gb\|AC006082.22\| Mus musculus strain 129/Sv ES cell line CJ7 chro...	40	6.0
397	gb\|AC125783.2\| Oryza sativa (japonica cultivar-group) chromosome...	40	6.0
398	gb\|AC160980.5\| Mus musculus BAC clone RP23-386F19 from chromosom...	40	6.0
399	gb\|AC079772.6\| Homo sapiens BAC clone RP11-256F13 from 4, comple...	40	6.0
400	dbj\|AK162641.1\| Mus musculus adult male bone cDNA, RIKEN full-le...	40	6.0
401	dbj\|AK153618.1\| Mus musculus 3 days neonate thymus cDNA, RIKEN f...	40	6.0
402	gb\|AC092547.7\| Homo sapiens 3q BAC RP11-371L14 (Roswell Park Can...	40	6.0
403	gb\|AC096636.1\| Homo sapiens chromosome 1 clone RP11-75I2, comple...	40	6.0
404	dbj\|AK161900.1\| Mus musculus adult male medulla oblongata cDNA, ...	40	6.0
405	gb\|AC131405.5\| Rattus norvegicus BAC CH230-179I7 (Children's Ho...	40	6.0
406	gb\|AC110377.5\| Mus musculus BAC clone RP23-460A13 from chromosom...	40	6.0
407	gb\|AC113499.12\| Mus musculus chromosome 8, clone RP23-366O23, co...	40	6.0
408	gb\|AC158299.7\| Mus musculus chromosome 7, clone RP24-271L24, com...	40	6.0
409	emb\|BX571770.5\| Zebrafish DNA sequence from clone DKEY-276I5 in ...	40	6.0
410	emb\|AL935334.14\| Zebrafish DNA sequence from clone CH211-199B20 ...	40	6.0
411	emb\|BX005020.7\| Zebrafish DNA sequence from clone DKEY-237D7 in ...	40	6.0
412	gb\|S52712.1\| Tnfr-2=tumor necrosis factor receptor type 2 {(GT)2...	40	6.0
413	gb\|AC159745.5\| Mus musculus 6 BAC RP23-394N3 (Roswell Park Cance...	40	6.0
414	gb\|AC156386.7\| Mus musculus chromosome 3, clone RP23-224L6, comp...	40	6.0
415	gb\|AC161867.6\| Mus musculus chromosome 8, clone RP24-281E22, com...	40	6.0
416	gb\|AC122209.5\| Mus musculus BAC clone RP23-96B17 from chromosome...	40	6.0
417	gb\|AC160759.4\| Mus musculus BAC clone RP23-333K15 from chromosom...	40	6.0
418	gb\|AC116574.6\| Mus musculus BAC clone RP23-234F20 from chromosom...	40	6.0
419	gb\|AC132390.4\| Mus musculus BAC clone RP23-453P1 from chromosome...	40	6.0
420	gb\|AC139332.5\| Mus musculus BAC clone RP24-113C21 from chromosom...	40	6.0
421	gb\|AC157948.5\| Mus musculus BAC clone RP23-197K17 from chromosom...	40	6.0
422	gb\|AC154454.2\| Mus musculus BAC clone RP24-173H15 from chromosom...	40	6.0
423	gb\|AC154687.2\| Mus musculus BAC clone RP24-327L23 from chromosom...	40	6.0
424	gb\|AC151906.3\| Mus musculus BAC clone RP23-177B17 from chromosom...	40	6.0
425	gb\|AY224423.1\| Oryza sativa (japonica cultivar-group) isolate 20...	40	6.0
426	dbj\|AK029122.1\| Mus musculus 10 days neonate skin cDNA, RIKEN fu...	40	6.0
427	gb\|AC153626.5\| Mus musculus 6 BAC RP23-245J24 (Roswell Park Canc...	40	6.0
428	gb\|AC079869.22\|AC079869 Mus musculus 9 BAC RP23-49M18 (Roswell P...	40	6.0
429	gb\|AC016370.17\|AC016370 Homo sapiens chromosome 15 clone RP11-42...	40	6.0
430	gb\|AC026440.4\|AC026440 Homo sapiens chromosome 5 clone CTD-2269F...	40	6.0
431	gb\|BC096766.1\| Mus musculus MAS-related GPR, member E, mRNA (cDN...	40	6.0
432	dbj\|AK048528.1\| Mus musculus 16 days embryo head cDNA, RIKEN ful...	40	6.0
433	tpg\|BK000964.1\| TPA: TPA_exp: Mus musculus ribosomal DNA, comple...	40	6.0
434	dbj\|AK018028.1\| Mus musculus adult male thymus cDNA, RIKEN full-...	40	6.0
435	gb\|AC153576.3\| Mus musculus 6 BAC RP23-330J17 (Roswell Park Canc...	40	6.0
436	dbj\|AK030035.1\| Mus musculus adult male testis cDNA, RIKEN full-...	40	6.0
437	emb\|BX323810.8\| Zebrafish DNA sequence from clone CH211-153K16 i...	40	6.0
438	gb\|AF257303.1\|AF257303 Mus musculus synaptotagmin II (Syt2) gene...	40	6.0
439	dbj\|AP008215.1\| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
440	dbj\|AP008212.1\| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
441	dbj\|AP008211.1\| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
442	gb\|AC158937.4\| Mus musculus chromosome 3, clone RP23-290L18, com...	40	6.0
443	gb\|AC137875.13\| Mus musculus chromosome 15, clone RP23-62B15, co...	40	6.0
444	emb\|AL805896.12\| Mouse DNA sequence from clone RP23-402I8 on chr...	40	6.0
445	gb\|AC161615.4\| Pan troglodytes BAC clone CH251-549K12 from chrom...	40	6.0
446	gb\|AC156280.5\| Mus musculus 6 BAC RP24-314B4 (Roswell Park Cance...	40	6.0
447	gb\|AC155640.5\| Mus musculus 10 BAC RP24-87H21 (Roswell Park Canc...	40	6.0
448	gb\|AC119271.11\| Mus musculus chromosome 7, clone RP24-373F15, co...	40	6.0
449	gb\|AC102555.11\| Mus musculus chromosome 8, clone RP23-163N19, co...	40	6.0
450	gb\|AC159131.2\| Pan troglodytes BAC clone CH251-316K21 from chrom...	40	6.0
451	gb\|AC154470.2\| Mus musculus BAC clone RP23-193P13 from chromosom...	40	6.0
452	gb\|AC154610.3\| Mus musculus BAC clone RP23-335A11 from chromosom...	40	6.0
453	gb\|AC007433.16\|AC007433 Mus musculus chromosome 10, clone RP21-3...	40	6.0
454	gb\|AC151901.3\| Mus musculus BAC clone RP23-271E15 from chromosom...	40	6.0
455	gb\|AC149053.3\| Mus musculus BAC clone RP24-502E20 from chromosom...	40	6.0
456	gb\|AF090447.2\| Zea mays 22 kDa alpha zein gene cluster, complete...	40	6.0
457	gb\|AC027026.11\| Homo sapiens chromosome 11, clone RP11-589F4, co...	40	6.0
458	gb\|AC009720.19\| Homo sapiens chromosome 17, clone RP11-1094H24, ...	40	6.0
459	gb\|AC079602.15\| Homo sapiens 12 BAC RP11-216P16 (Roswell Park Ca...	40	6.0
460	gb\|AC134240.2\| Oryza sativa (japonica cultivar-group) chromosome...	40	6.0
461	dbj\|AP003412.4\| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
462	dbj\|AP002910.1\| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
463	dbj\|AP003234.3\| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
464	dbj\|AP003269.2\| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
465	emb\|BX005056.7\| Zebrafish DNA sequence from clone CH211-77A11 in...	40	6.0
466	emb\|BX649334.5\| Zebrafish DNA sequence from clone DKEYP-6A3 in l...	40	6.0
467	gb\|AC020547.7\| Homo sapiens BAC clone RP11-134F3 from 2, complet...	40	6.0
468	gb\|AC006431.9\| Homo sapiens 12 BAC RP11-451H11 (Roswell Park Can...	40	6.0
469	gb\|AC079043.27\| Mus musculus strain C57BL/6J chromosome 16 clone...	40	6.0
470	gb\|AC122129.9\| Homo sapiens chromosome 17, clone RP1-253P7, comp...	40	6.0
471	gb\|AF456480.1\| Mus musculus fibroblast growth factor receptor su...	40	6.0
472	emb\|BX664619.13\| Mouse DNA sequence from clone RP23-349B9 on chr...	40	6.0
473	gb\|AC107225.2\| Oryza sativa (japonica cultivar-group) chromosome...	40	6.0
474	gb\|AF289667.1\|AF289667 Mus musculus GTF2IRD1 and CYLN2 genes, co...	40	6.0
475	gb\|AC092855.39\| Mus musculus strain C57BL/6J chromosome 3 clone ...	40	6.0
476	gb\|AC090430.7\| Mus Musculus Strain C57BL6/J chromosome 10 BAC, R...	40	6.0
477	dbj\|AP005862.2\| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
478	gb\|AF023123.1\|AF023123 Austramphilina elongata 28S ribosomal RNA...	40	6.0
479	gb\|AC131662.4\| Mus musculus BAC clone RP23-257H24 from chromosom...	40	6.0
480	gb\|AC154302.1\| Mus musculus BAC clone RP23-378K2 from chromosome...	40	6.0
481	gb\|AC118542.20\| Mus musculus strain C57BL/6J chromosome 16 clone...	40	6.0
482	dbj\|AP005116.3\| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
483	dbj\|AP004270.3\| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
484	emb\|AJ311612.1\|MMU311612 Mus musculus partial gene for NH3-depen...	40	6.0
485	emb\|AJ320231.1\|MMU320231 Mus musculus domesticus partial mRNA fo...	40	6.0
486	dbj\|AP002521.1\| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
487	dbj\|AP005450.3\| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
488	dbj\|AP005090.3\| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
489	emb\|AL929404.19\| Mouse DNA sequence from clone RP23-71H9 on chro...	40	6.0
490	emb\|AJ251568.1\|ZMA251568 Zea mays PAO gene for flavin containing...	40	6.0
491	emb\|AJ251018.1\|ZMA251018 Zea mays pao gene for polyamine oxidase...	40	6.0
492	dbj\|AP005296.5\| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
493	gb\|AC155646.4\| Mus musculus 6 BAC RP24-195P20 (Roswell Park Canc...	40	6.0
494	gb\|AC153534.2\| Mus musculus 10 BAC RP23-360K7 (Roswell Park Canc...	40	6.0
495	gb\|AC153863.6\| Mus musculus 10 BAC RP23-149M7 (Roswell Park Canc...	40	6.0
496	dbj\|AP006529.2\| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
497	emb\|AL831780.12\| Mouse DNA sequence from clone RP23-394B8 on chr...	40	6.0
498	emb\|AL606971.22\| Mouse DNA sequence from clone RP23-123I20 on ch...	40	6.0
499	gb\|AC153629.3\| Mus musculus 6 BAC RP23-462O13 (Roswell Park Canc...	40	6.0
500	gb\|AC153981.5\| Mus musculus 10 BAC RP24-112H16 (Roswell Park Can...	40	6.0

>ref|NM_189326.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 3042

 Score =  101 bits (51), Expect = 2e-18
 Identities = 72/79 (91%)
 Strand = Plus / Minus

                                                                        
Query: 364  ggggccctgatgacctgcaggatctggaccacctccgccatggacggccggttcgacggg 423
            |||||| |||||||||||||||||||||| ||||| ||||||||||| ||||| || |||
Sbjct: 3005 ggggccttgatgacctgcaggatctggacgacctcggccatggacgggcggttggatggg 2946

                               
Query: 424  atctgcgacgtgcatacca 442
            |||||||||||||| ||||
Sbjct: 2945 atctgcgacgtgcacacca 2927

to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  101 bits (51), Expect = 2e-18
 Identities = 72/79 (91%)
 Strand = Plus / Minus

                                                                            
Query: 364      ggggccctgatgacctgcaggatctggaccacctccgccatggacggccggttcgacggg 423
                |||||| |||||||||||||||||||||| ||||| ||||||||||| ||||| || |||
Sbjct: 42179716 ggggccttgatgacctgcaggatctggacgacctcggccatggacgggcggttggatggg 42179657

                                   
Query: 424      atctgcgacgtgcatacca 442
                |||||||||||||| ||||
Sbjct: 42179656 atctgcgacgtgcacacca 42179638



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 208      atctatgcatgcatgcatgcatgg 231
                ||||||| ||||||||||||||||
Sbjct: 41184391 atctatgtatgcatgcatgcatgg 41184414



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 211      tatgcatgcatgcatgcatg 230
                ||||||||||||||||||||
Sbjct: 25999375 tatgcatgcatgcatgcatg 25999356



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 212     atgcatgcatgcatgcatgg 231
               ||||||||||||||||||||
Sbjct: 3171388 atgcatgcatgcatgcatgg 3171369



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 212     atgcatgcatgcatgcatgg 231
               ||||||||||||||||||||
Sbjct: 3155576 atgcatgcatgcatgcatgg 3155557

to top

>dbj|AP004326.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OJ1294_F06
          Length = 121088

 Score =  101 bits (51), Expect = 2e-18
 Identities = 72/79 (91%)
 Strand = Plus / Minus

                                                                         
Query: 364   ggggccctgatgacctgcaggatctggaccacctccgccatggacggccggttcgacggg 423
             |||||| |||||||||||||||||||||| ||||| ||||||||||| ||||| || |||
Sbjct: 52914 ggggccttgatgacctgcaggatctggacgacctcggccatggacgggcggttggatggg 52855

                                
Query: 424   atctgcgacgtgcatacca 442
             |||||||||||||| ||||
Sbjct: 52854 atctgcgacgtgcacacca 52836

to top

>dbj|AK122121.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033130J03, full
            insert sequence
          Length = 3036

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                        
Query: 364  ggggccctgatgacctgcaggatctggaccacctccgccatggacggccggttcgacggg 423
            |||||| |||||||||||||||||||||| ||||| ||||||||||| ||||| || |||
Sbjct: 2743 ggggccttgatgacctgcaggatctggacgacctcggccatggacgggcggttggatggg 2684

                               
Query: 424  atctgcgacgtgcatacca 442
            ||||| |||||||| ||||
Sbjct: 2683 atctgtgacgtgcacacca 2665

to top

>emb|AL663055.13| Mouse DNA sequence from clone RP23-102H8 on chromosome 11 Contains the 5'
              end of the Gria1 gene for glutamate receptor, ionotropic,
              AMPA1 (alpha 1), complete sequence
          Length = 202981

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 212    atgcatgcatgcatgcatggacac 235
              ||||||||||||||||||||||||
Sbjct: 126076 atgcatgcatgcatgcatggacac 126099

to top

>gb|AC165322.12| Mus musculus chromosome 1, clone RP23-127J15, complete sequence
          Length = 185278

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 212   atgcatgcatgcatgcatggacac 235
             ||||||||||||||||||||||||
Sbjct: 24770 atgcatgcatgcatgcatggacac 24747

to top

>emb|AL513351.26| Mouse DNA sequence from clone RP23-122P5 on chromosome 1, complete
              sequence
          Length = 224628

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 212    atgcatgcatgcatgcatggacac 235
              ||||||||||||||||||||||||
Sbjct: 171050 atgcatgcatgcatgcatggacac 171027

to top

>gb|AC151980.3| Mus musculus BAC clone RP24-83M3 from chromosome 8, complete sequence
          Length = 253457

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 212  atgcatgcatgcatgcatggaca 234
            |||||||||||||||||||||||
Sbjct: 9178 atgcatgcatgcatgcatggaca 9200

to top

>gb|AC122420.4| Mus musculus BAC clone RP24-167C5 from chromosome 8, complete sequence
          Length = 179058

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 212    atgcatgcatgcatgcatggaca 234
              |||||||||||||||||||||||
Sbjct: 100231 atgcatgcatgcatgcatggaca 100253

to top

>gb|AC127189.4| Rattus norvegicus 1 BAC CH230-266M16 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 222423

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 212   atgcatgcatgcatgcatggacacgg 237
             ||||||||||||||||||| ||||||
Sbjct: 24415 atgcatgcatgcatgcatgtacacgg 24440

to top

>gb|AC117627.16| Mus musculus chromosome 1, clone RP23-116N6, complete sequence
          Length = 201995

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 208   atctatgcatgcatgcatgcat 229
             ||||||||||||||||||||||
Sbjct: 23394 atctatgcatgcatgcatgcat 23373

to top

>gb|AC124348.5| Mus musculus BAC clone RP24-462O9 from chromosome 9, complete sequence
          Length = 187568

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 208    atctatgcatgcatgcatgcat 229
              ||||||||||||||||||||||
Sbjct: 123653 atctatgcatgcatgcatgcat 123632

to top

>gb|AC132406.4| Mus musculus BAC clone RP23-340E1 from chromosome 9, complete sequence
          Length = 222617

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 208    atctatgcatgcatgcatgcat 229
              ||||||||||||||||||||||
Sbjct: 142467 atctatgcatgcatgcatgcat 142488

to top

>gb|AC151281.3| Mus musculus BAC clone RP24-144E8 from chromosome 17, complete sequence
          Length = 171820

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 215   catgcatgcatgcatggacacg 236
             ||||||||||||||||||||||
Sbjct: 86687 catgcatgcatgcatggacacg 86666

to top

>emb|AL354735.14| Human DNA sequence from clone RP11-738I14 on chromosome 9 Contains the 3'
              end of the DDX31 gene for DEAD/H box polypeptide 31, the
              BARHL1 gene for BarH-like 1 (Drosophila) protein, two novel
              genes and three CpG islands, complete sequence
          Length = 189821

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 208    atctatgcatgcatgcatgcat 229
              ||||||||||||||||||||||
Sbjct: 128152 atctatgcatgcatgcatgcat 128173

to top

>gb|AC163282.3| Mus musculus BAC clone RP23-454I20 from chromosome 12, complete sequence
          Length = 202583

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 209    tctatgcatgcatgcatgcatg 230
              ||||||||||||||||||||||
Sbjct: 175281 tctatgcatgcatgcatgcatg 175302



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 175306 tatgcatgcatgcatgcatg 175287

to top

>dbj|AK128451.1| Homo sapiens cDNA FLJ46594 fis, clone THYMU3045692
          Length = 2819

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 208 atctatgcatgcatgcatgcat 229
           ||||||||||||||||||||||
Sbjct: 812 atctatgcatgcatgcatgcat 833

to top

>gb|AC092936.9| Homo sapiens 12 BAC RP11-286J13 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 217112

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 208    atctatgcatgcatgcatgcat 229
              ||||||||||||||||||||||
Sbjct: 161412 atctatgcatgcatgcatgcat 161391



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 70250 atgcatgcatgcatgcatgga 70270

to top

>gb|BC034932.1| Homo sapiens, clone IMAGE:4591517, mRNA
          Length = 2891

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 208  atctatgcatgcatgcatgcat 229
            ||||||||||||||||||||||
Sbjct: 2332 atctatgcatgcatgcatgcat 2311

to top

>emb|CT030161.10| Mouse DNA sequence from clone RP23-235H10 on chromosome 12, complete
              sequence
          Length = 234471

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 209    tctatgcatgcatgcatgcatg 230
              ||||||||||||||||||||||
Sbjct: 204565 tctatgcatgcatgcatgcatg 204544



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 204540 tatgcatgcatgcatgcatg 204559

to top

>gb|AC134594.5| Mus musculus BAC clone RP23-388B6 from 12, complete sequence
          Length = 194521

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 209    tctatgcatgcatgcatgcatg 230
              ||||||||||||||||||||||
Sbjct: 158639 tctatgcatgcatgcatgcatg 158618



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 158614 tatgcatgcatgcatgcatg 158633

to top

>emb|AL929585.11| Mouse DNA sequence from clone RP23-97O7 on chromosome 4, complete
             sequence
          Length = 246011

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 213   tgcatgcatgcatgcatggaca 234
             ||||||||||||||||||||||
Sbjct: 41378 tgcatgcatgcatgcatggaca 41357

to top

>gb|AC127297.4| Mus musculus BAC clone RP23-395B13 from chromosome 3, complete sequence
          Length = 222889

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 209   tctatgcatgcatgcatgcatg 230
             ||||||||||||||||||||||
Sbjct: 97907 tctatgcatgcatgcatgcatg 97928



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 97932 tatgcatgcatgcatgcatg 97913

to top

>emb|AL627099.13| Mouse DNA sequence from clone RP23-306F22 on chromosome 4, complete
            sequence
          Length = 169469

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 214  gcatgcatgcatgcatggacac 235
            ||||||||||||||||||||||
Sbjct: 2849 gcatgcatgcatgcatggacac 2870

to top

>gb|AC114494.2| Homo sapiens chromosome 1 clone RP11-439L8, complete sequence
          Length = 146301

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 208    atctatgcatgcatgcatgcat 229
              ||||||||||||||||||||||
Sbjct: 141050 atctatgcatgcatgcatgcat 141071



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 208    atctatgcatgcatgcatgcat 229
              ||||||||||||||||||||||
Sbjct: 140219 atctatgcatgcatgcatgcat 140240

to top

>gb|AC154901.1| Prunus persica (peach) BAC clone 82I18, complete sequence
          Length = 73299

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 213   tgcatgcatgcatgcatggac 233
             |||||||||||||||||||||
Sbjct: 25023 tgcatgcatgcatgcatggac 25003

to top

>gb|AC108429.11| Mus musculus chromosome 7, clone RP23-161B5, complete sequence
          Length = 186903

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 26576 atgcatgcatgcatgcatgga 26596

to top

>gb|AC111115.13| Mus musculus chromosome 5, clone RP23-213H20, complete sequence
          Length = 201694

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 212    atgcatgcatgcatgcatgga 232
              |||||||||||||||||||||
Sbjct: 118017 atgcatgcatgcatgcatgga 117997



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 212   atgcatgcatgcatgcatggacac 235
             ||||||||||| ||||||||||||
Sbjct: 42546 atgcatgcatgaatgcatggacac 42523

to top

>gb|AC154221.3| Mus musculus BAC clone RP24-373L7 from chromosome 13, complete sequence
          Length = 157332

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 211   tatgcatgcatgcatgcatggacac 235
             |||||||||||||||||||| ||||
Sbjct: 91455 tatgcatgcatgcatgcatgcacac 91431

to top

>gb|AC116788.14| Mus musculus chromosome 8, clone RP24-296N13, complete sequence
          Length = 164158

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   tatgcatgcatgcatgcatgg 231
             |||||||||||||||||||||
Sbjct: 34096 tatgcatgcatgcatgcatgg 34116

to top

>gb|AC139574.4| Mus musculus BAC clone RP23-477I8 from chromosome 15, complete sequence
          Length = 190948

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 75268 atgcatgcatgcatgcatgga 75248

to top

>ref|XM_469440.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2503

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 391  accacctccgccatggacggccggt 415
            |||||||||| ||||||||||||||
Sbjct: 2166 accacctccgacatggacggccggt 2142

to top

>ref|XM_469439.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2387

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 391  accacctccgccatggacggccggt 415
            |||||||||| ||||||||||||||
Sbjct: 1976 accacctccgacatggacggccggt 1952

to top

>gb|AC091670.7| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1212_C08
             map R2847, complete sequence
          Length = 100918

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 391   accacctccgccatggacggccggt 415
             |||||||||| ||||||||||||||
Sbjct: 95631 accacctccgacatggacggccggt 95655

to top

>gb|AY258809.1| Xiphophorus maculatus microsatellite Msc018 sequence
          Length = 724

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 212 atgcatgcatgcatgcatgga 232
           |||||||||||||||||||||
Sbjct: 490 atgcatgcatgcatgcatgga 470



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 211 tatgcatgcatgcatgcatg 230
           ||||||||||||||||||||
Sbjct: 495 tatgcatgcatgcatgcatg 476

to top

>gb|AC165080.4| Mus musculus BAC clone RP24-93F20 from chromosome 9, complete sequence
          Length = 194427

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 11748 atgcatgcatgcatgcatgga 11768

to top

>gb|AC099628.7| Mus musculus chromosome 1, clone RP24-82L18, complete sequence
          Length = 171875

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 210    ctatgcatgcatgcatgcatg 230
              |||||||||||||||||||||
Sbjct: 141584 ctatgcatgcatgcatgcatg 141604

to top

>gb|AC146430.4| Pan troglodytes BAC clone RP43-21F8 from 7, complete sequence
          Length = 179251

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 212    atgcatgcatgcatgcatgga 232
              |||||||||||||||||||||
Sbjct: 175171 atgcatgcatgcatgcatgga 175191



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 212    atgcatgcatgcatgcatgga 232
              |||||||||||||||||||||
Sbjct: 175123 atgcatgcatgcatgcatgga 175143

to top

>gb|AC140680.4| Mus musculus BAC clone RP24-548A12 from chromosome Y, complete sequence
          Length = 222176

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 79308 atgcatgcatgcatgcatgga 79328

to top

>gb|AC138260.7| Mus musculus chromosome 6, clone RP23-247I19, complete sequence
          Length = 197686

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 210    ctatgcatgcatgcatgcatg 230
              |||||||||||||||||||||
Sbjct: 151030 ctatgcatgcatgcatgcatg 151050

to top

>gb|AC122302.4| Mus musculus BAC clone RP23-276E10 from chromosome 12, complete sequence
          Length = 172985

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 212    atgcatgcatgcatgcatgga 232
              |||||||||||||||||||||
Sbjct: 126324 atgcatgcatgcatgcatgga 126304

to top

>gb|AC165365.3| Mus musculus BAC clone RP23-28N13 from chromosome 6, complete sequence
          Length = 238262

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 210    ctatgcatgcatgcatgcatg 230
              |||||||||||||||||||||
Sbjct: 107709 ctatgcatgcatgcatgcatg 107729

to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 391      accacctccgccatggacggccggt 415
                |||||||||| ||||||||||||||
Sbjct: 27959903 accacctccgacatggacggccggt 27959927



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 213      tgcatgcatgcatgcatgga 232
                ||||||||||||||||||||
Sbjct: 33672033 tgcatgcatgcatgcatgga 33672052



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 211      tatgcatgcatgcatgcatg 230
                ||||||||||||||||||||
Sbjct: 30839956 tatgcatgcatgcatgcatg 30839937



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 212      atgcatgcatgcatgcatgg 231
                ||||||||||||||||||||
Sbjct: 23282487 atgcatgcatgcatgcatgg 23282506



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 212      atgcatgcatgcatgcatgg 231
                ||||||||||||||||||||
Sbjct: 15347876 atgcatgcatgcatgcatgg 15347857



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 211     tatgcatgcatgcatgcatg 230
               ||||||||||||||||||||
Sbjct: 8062240 tatgcatgcatgcatgcatg 8062221



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 212     atgcatgcatgcatgcatgg 231
               ||||||||||||||||||||
Sbjct: 3538626 atgcatgcatgcatgcatgg 3538607



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 210     ctatgcatgcatgcatgcat 229
               ||||||||||||||||||||
Sbjct: 3345080 ctatgcatgcatgcatgcat 3345099

to top

>gb|AC158347.4| Mus musculus chromosome 3, clone RP23-380F8, complete sequence
          Length = 193489

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 212    atgcatgcatgcatgcatgga 232
              |||||||||||||||||||||
Sbjct: 155467 atgcatgcatgcatgcatgga 155487

to top

>gb|AC141875.4| Mus musculus BAC clone RP24-316O22 from chromosome Y, complete sequence
          Length = 170988

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 17180 atgcatgcatgcatgcatgga 17200

to top

>gb|AC099704.7| Mus musculus chromosome 15, clone RP23-256A2, complete sequence
          Length = 204704

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 210    ctatgcatgcatgcatgcatg 230
              |||||||||||||||||||||
Sbjct: 126195 ctatgcatgcatgcatgcatg 126215



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 126119 tatgcatgcatgcatgcatg 126138

to top

>gb|AC101830.7| Mus musculus chromosome 1, clone RP24-480B20, complete sequence
          Length = 158825

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 210   ctatgcatgcatgcatgcatg 230
             |||||||||||||||||||||
Sbjct: 32280 ctatgcatgcatgcatgcatg 32300

to top

>gb|AC133334.8| Oryza sativa chromosome 3 BAC OSJNBa0004L11 genomic sequence, complete
             sequence
          Length = 133889

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 391   accacctccgccatggacggccggt 415
             |||||||||| ||||||||||||||
Sbjct: 65123 accacctccgacatggacggccggt 65099

to top

>gb|AC139572.4| Mus musculus BAC clone RP24-196P9 from chromosome 7, complete sequence
          Length = 165198

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 32051 atgcatgcatgcatgcatgga 32071

to top

>gb|AC133950.4| Mus musculus BAC clone RP24-243C16 from chromosome 7, complete sequence
          Length = 176244

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 212    atgcatgcatgcatgcatgga 232
              |||||||||||||||||||||
Sbjct: 143185 atgcatgcatgcatgcatgga 143205

to top

>gb|AC122375.4| Mus musculus BAC clone RP23-469G18 from chromosome 16, complete
             sequence
          Length = 189557

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 90177 atgcatgcatgcatgcatgga 90157



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 212   atgcatgcatgcatgcatggacac 235
             ||||||||||||||||||| ||||
Sbjct: 90160 atgcatgcatgcatgcatgtacac 90183

to top

>gb|AC127553.3| Mus musculus BAC clone RP24-553F11 from chromosome 5, complete sequence
          Length = 159693

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 87499 atgcatgcatgcatgcatgga 87479

to top

>gb|AC116656.5| Mus musculus BAC clone RP23-10A7 from chromosome 15, complete sequence
          Length = 198019

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 13135 atgcatgcatgcatgcatgga 13115

to top

>gb|AC126272.3| Mus musculus BAC clone RP23-48P22 from chromosome 14, complete sequence
          Length = 191606

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 84985 atgcatgcatgcatgcatgga 85005

to top

>gb|AC124558.4| Mus musculus BAC clone RP23-248O8 from chromosome 10, complete sequence
          Length = 199938

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 55169 atgcatgcatgcatgcatgga 55149

to top

>gb|AC073600.3| Genomic sequence for Mus musculus, clone RP23-119A19, complete sequence
          Length = 197456

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 33293 atgcatgcatgcatgcatgga 33273

to top

>gb|AC131773.3| Mus musculus BAC clone RP24-308A19 from chromosome 15, complete
             sequence
          Length = 168423

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 210   ctatgcatgcatgcatgcatg 230
             |||||||||||||||||||||
Sbjct: 13187 ctatgcatgcatgcatgcatg 13167



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 13263 tatgcatgcatgcatgcatg 13244

to top

>gb|AC123826.4| Mus musculus BAC clone RP24-97K3 from chromosome 8, complete sequence
          Length = 188704

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 212    atgcatgcatgcatgcatgga 232
              |||||||||||||||||||||
Sbjct: 162527 atgcatgcatgcatgcatgga 162547



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 212    atgcatgcatgcatgcatgga 232
              |||||||||||||||||||||
Sbjct: 162439 atgcatgcatgcatgcatgga 162459

to top

>gb|AC126032.4| Mus musculus BAC clone RP24-94B12 from chromosome 1, complete sequence
          Length = 207475

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 212    atgcatgcatgcatgcatggacacg 236
              ||||||||||||||||||| |||||
Sbjct: 182223 atgcatgcatgcatgcatgcacacg 182247

to top

>gb|AC129606.4| Mus musculus BAC clone RP23-128L6 from 8, complete sequence
          Length = 235915

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 27984 atgcatgcatgcatgcatgga 28004



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 27896 atgcatgcatgcatgcatgga 27916

to top

>gb|AC113527.8| Mus musculus chromosome 9, clone RP23-314E23, complete sequence
          Length = 202544

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 210   ctatgcatgcatgcatgcatg 230
             |||||||||||||||||||||
Sbjct: 68445 ctatgcatgcatgcatgcatg 68465



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 212   atgcatgcatgcatgcatggacac 235
             ||||||||||||||||||| ||||
Sbjct: 68451 atgcatgcatgcatgcatgcacac 68474

to top

>gb|AC108423.10| Mus musculus chromosome 16, clone RP23-443N12, complete sequence
          Length = 192819

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 212    atgcatgcatgcatgcatggacacg 236
              ||||||||||||||||||| |||||
Sbjct: 184878 atgcatgcatgcatgcatgcacacg 184854

to top

>gb|AC101810.5| Mus musculus chromosome 15, clone RP24-278M16, complete sequence
          Length = 178304

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 212    atgcatgcatgcatgcatgga 232
              |||||||||||||||||||||
Sbjct: 134715 atgcatgcatgcatgcatgga 134695

to top

>gb|AC159140.10| Mus musculus chromosome 7, clone RP24-84I4, complete sequence
          Length = 202318

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 210   ctatgcatgcatgcatgcatg 230
             |||||||||||||||||||||
Sbjct: 97213 ctatgcatgcatgcatgcatg 97233

to top

>gb|AC105302.27| Mus musculus strain C57BL/6J clone rp23-45h18 map 17, complete sequence
          Length = 238088

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 210   ctatgcatgcatgcatgcatg 230
             |||||||||||||||||||||
Sbjct: 11736 ctatgcatgcatgcatgcatg 11756

to top

>emb|AL160032.14| Human DNA sequence from clone RP11-474L7 on chromosome 13 Contains the
             3' end of the KLF12 gene for Kruppel-like factor 12, a
             novel gene and the 5' end of a novel gene and a CpG
             island, complete sequence
          Length = 181324

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 30725 atgcatgcatgcatgcatgga 30705

to top

>emb|AL031279.1|HS163O16 Human DNA sequence from clone RP1-163O16 on chromosome 1p35.1-36.13
              Contains CA repeat, STS, complete sequence
          Length = 135628

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 212    atgcatgcatgcatgcatgga 232
              |||||||||||||||||||||
Sbjct: 129169 atgcatgcatgcatgcatgga 129149

to top

>gb|AC154601.3| Mus musculus BAC clone RP23-342J18 from chromosome 16, complete
            sequence
          Length = 189457

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 212  atgcatgcatgcatgcatggacacg 236
            ||||||||||||||||||| |||||
Sbjct: 4904 atgcatgcatgcatgcatgcacacg 4880

to top

>emb|AL596103.22| Mouse DNA sequence from clone RP23-309E16 on chromosome 11 Contains the
              P4ha2 gene for procollagen-proline 2-oxoglutarate
              4-dioxygenase (proline 4-hydroxylase) alpha II polypeptide,
              a novel pseudogene, two novel genes, a diazepam binding
              inhibitor (Dbi) pseudogene, the Csf2 gene for colony
              stimulating factor 2 (granulocyte-macrophage), the Il3 gene
              for interleukin 3 and a CpG island, complete sequence
          Length = 199500

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 215    catgcatgcatgcatggacac 235
              |||||||||||||||||||||
Sbjct: 140495 catgcatgcatgcatggacac 140475

to top

>gb|AC154413.3| Mus musculus BAC clone RP24-230J5 from chromosome 13, complete sequence
          Length = 174730

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    tatgcatgcatgcatgcatgg 231
              |||||||||||||||||||||
Sbjct: 100996 tatgcatgcatgcatgcatgg 100976

to top

>gb|AC126615.7| Homo sapiens 12 BAC RP11-129B9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 67557

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 36171 atgcatgcatgcatgcatgga 36191

to top

>emb|CR545472.6| Zebrafish DNA sequence from clone DKEYP-32B1 in linkage group 5,
             complete sequence
          Length = 75199

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 208   atctatgcatgcatgcatgca 228
             |||||||||||||||||||||
Sbjct: 23315 atctatgcatgcatgcatgca 23295

to top

>gb|AC109453.2| Homo sapiens chromosome 5 clone RP11-203G23, complete sequence
          Length = 62986

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 43412 atgcatgcatgcatgcatgga 43432

to top

>gb|AC119072.1| Oryza sativa ssp. japonica cv. Nipponbare OSJNBa0073N20 BAC genomic
             sequence, complete sequence
          Length = 147289

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 211   tatgcatgcatgcatgcatggacac 235
             |||||||||||||||||||| ||||
Sbjct: 62438 tatgcatgcatgcatgcatgcacac 62414

to top

>dbj|AB076248.1| Mus musculus DNA, BAC clone:No.251,465
          Length = 158570

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   tatgcatgcatgcatgcatgg 231
             |||||||||||||||||||||
Sbjct: 65468 tatgcatgcatgcatgcatgg 65448

to top

>emb|AL929441.37| Mouse DNA sequence from clone RP23-418E20 on chromosome 4, complete
             sequence
          Length = 202920

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 67114 atgcatgcatgcatgcatgga 67094

to top

>gb|AC008949.9| Homo sapiens chromosome 5 clone CTD-2335O24, complete sequence
          Length = 163731

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 211   tatgcatgcatgcatgcatggacac 235
             |||||||||||||||||||| ||||
Sbjct: 90961 tatgcatgcatgcatgcatgtacac 90985

to top

>gb|AF249952.1|AF249952 Euterpe precatoria malate synthase gene, exons 2 and 3 and partial
           cds
          Length = 514

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 211 tatgcatgcatgcatgcatgg 231
           |||||||||||||||||||||
Sbjct: 292 tatgcatgcatgcatgcatgg 312

to top

>gb|AC004863.5|AC004863 Homo sapiens PAC clone RP4-708P22 from 7, complete sequence
          Length = 133030

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 77421 atgcatgcatgcatgcatgga 77401



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 77191 atgcatgcatgcatgcatgga 77171

to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 212      atgcatgcatgcatgcatgga 232
                |||||||||||||||||||||
Sbjct: 35252061 atgcatgcatgcatgcatgga 35252041

to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 214      gcatgcatgcatgcatggaca 234
                |||||||||||||||||||||
Sbjct: 23594656 gcatgcatgcatgcatggaca 23594676



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 210      ctatgcatgcatgcatgcat 229
                ||||||||||||||||||||
Sbjct: 24829603 ctatgcatgcatgcatgcat 24829584



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 211      tatgcatgcatgcatgcatg 230
                ||||||||||||||||||||
Sbjct: 24133153 tatgcatgcatgcatgcatg 24133172



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 211      tatgcatgcatgcatgcatg 230
                ||||||||||||||||||||
Sbjct: 20033315 tatgcatgcatgcatgcatg 20033296



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 211      tatgcatgcatgcatgcatg 230
                ||||||||||||||||||||
Sbjct: 20033292 tatgcatgcatgcatgcatg 20033311

to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 211     tatgcatgcatgcatgcatggacac 235
               |||||||||||||||||||| ||||
Sbjct: 6481792 tatgcatgcatgcatgcatgcacac 6481816



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 212      atgcatgcatgcatgcatgg 231
                ||||||||||||||||||||
Sbjct: 26702621 atgcatgcatgcatgcatgg 26702602



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 212      atgcatgcatgcatgcatgg 231
                ||||||||||||||||||||
Sbjct: 25703892 atgcatgcatgcatgcatgg 25703911



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 211      tatgcatgcatgcatgcatg 230
                ||||||||||||||||||||
Sbjct: 14496790 tatgcatgcatgcatgcatg 14496809



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 212     atgcatgcatgcatgcatgg 231
               ||||||||||||||||||||
Sbjct: 6149261 atgcatgcatgcatgcatgg 6149242

to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 208     atctatgcatgcatgcatgcatgga 232
               |||||| ||||||||||||||||||
Sbjct: 7747974 atctatccatgcatgcatgcatgga 7747998



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 212     atgcatgcatgcatgcatgga 232
               |||||||||||||||||||||
Sbjct: 2564500 atgcatgcatgcatgcatgga 2564520



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 128     attaattttcactagcaaac 147
               ||||||||||||||||||||
Sbjct: 5263834 attaattttcactagcaaac 5263815



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 212     atgcatgcatgcatgcatgg 231
               ||||||||||||||||||||
Sbjct: 2564509 atgcatgcatgcatgcatgg 2564490

to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
               sequence
          Length = 29644043

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 213     tgcatgcatgcatgcatggac 233
               |||||||||||||||||||||
Sbjct: 5067499 tgcatgcatgcatgcatggac 5067519



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 212      atgcatgcatgcatgcatgg 231
                ||||||||||||||||||||
Sbjct: 22480727 atgcatgcatgcatgcatgg 22480746



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 215      catgcatgcatgcatggaca 234
                ||||||||||||||||||||
Sbjct: 11945245 catgcatgcatgcatggaca 11945264

to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 391      accacctccgccatggacggccggt 415
                |||||||||| ||||||||||||||
Sbjct: 28051227 accacctccgacatggacggccggt 28051251



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 213      tgcatgcatgcatgcatgga 232
                ||||||||||||||||||||
Sbjct: 33762505 tgcatgcatgcatgcatgga 33762524



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 211      tatgcatgcatgcatgcatg 230
                ||||||||||||||||||||
Sbjct: 30930479 tatgcatgcatgcatgcatg 30930460



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 212      atgcatgcatgcatgcatgg 231
                ||||||||||||||||||||
Sbjct: 23275515 atgcatgcatgcatgcatgg 23275534



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 212      atgcatgcatgcatgcatgg 231
                ||||||||||||||||||||
Sbjct: 15342410 atgcatgcatgcatgcatgg 15342391



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 211     tatgcatgcatgcatgcatg 230
               ||||||||||||||||||||
Sbjct: 8060075 tatgcatgcatgcatgcatg 8060056



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 212     atgcatgcatgcatgcatgg 231
               ||||||||||||||||||||
Sbjct: 3538737 atgcatgcatgcatgcatgg 3538718



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 210     ctatgcatgcatgcatgcat 229
               ||||||||||||||||||||
Sbjct: 3345191 ctatgcatgcatgcatgcat 3345210

to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 212      atgcatgcatgcatgcatgga 232
                |||||||||||||||||||||
Sbjct: 10124107 atgcatgcatgcatgcatgga 10124127



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 391      accacctccgccatggacgg 410
                ||||||||||||||||||||
Sbjct: 26109228 accacctccgccatggacgg 26109247



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 212      atgcatgcatgcatgcatgg 231
                ||||||||||||||||||||
Sbjct: 24837013 atgcatgcatgcatgcatgg 24837032



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 209      tctatgcatgcatgcatgca 228
                ||||||||||||||||||||
Sbjct: 22067930 tctatgcatgcatgcatgca 22067949



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 212      atgcatgcatgcatgcatgg 231
                ||||||||||||||||||||
Sbjct: 10124124 atgcatgcatgcatgcatgg 10124105

to top

>gb|AC115949.13| Mus musculus chromosome 3, clone RP24-568B16, complete sequence
          Length = 177771

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 27273 atgcatgcatgcatgcatgga 27293

to top

>gb|AC149590.5| Mus musculus BAC clone RP23-348L9 from chromosome 5, complete sequence
          Length = 196662

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 212    atgcatgcatgcatgcatgga 232
              |||||||||||||||||||||
Sbjct: 124264 atgcatgcatgcatgcatgga 124284



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 212    atgcatgcatgcatgcatgga 232
              |||||||||||||||||||||
Sbjct: 124160 atgcatgcatgcatgcatgga 124180

to top

>gb|AC090963.32| Mus musculus strain C57BL/6J chromosome 17 clone rp23-435j12, complete
              sequence
          Length = 218107

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 210    ctatgcatgcatgcatgcatg 230
              |||||||||||||||||||||
Sbjct: 168460 ctatgcatgcatgcatgcatg 168480

to top

>gb|AC090653.36| Mus musculus strain C57BL/6J chromosome 17 clone rp23-260k1, complete
              sequence
          Length = 191844

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 210    ctatgcatgcatgcatgcatg 230
              |||||||||||||||||||||
Sbjct: 114182 ctatgcatgcatgcatgcatg 114162

to top

>gb|AC087593.6| Homo sapiens chromosome 15, clone RP11-247E14, complete sequence
          Length = 124394

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 38896 atgcatgcatgcatgcatgga 38876

to top

>dbj|AP005526.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0571B09
          Length = 147382

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 78857 atgcatgcatgcatgcatgga 78877



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 212   atgcatgcatgcatgcatgg 231
             ||||||||||||||||||||
Sbjct: 78866 atgcatgcatgcatgcatgg 78847

to top

>dbj|AP005124.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OSJNBa0049I08
          Length = 144379

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 213    tgcatgcatgcatgcatggac 233
              |||||||||||||||||||||
Sbjct: 109188 tgcatgcatgcatgcatggac 109208

to top

>dbj|AP003743.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1118_E12
          Length = 119691

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 213   tgcatgcatgcatgcatggac 233
             |||||||||||||||||||||
Sbjct: 23666 tgcatgcatgcatgcatggac 23686

to top

>dbj|AP004770.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0017G06
          Length = 150628

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 71801 atgcatgcatgcatgcatgga 71821



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 212   atgcatgcatgcatgcatgg 231
             ||||||||||||||||||||
Sbjct: 71818 atgcatgcatgcatgcatgg 71799

to top

>emb|AL929254.12| Mouse DNA sequence from clone RP23-456I1 on chromosome 2, complete
              sequence
          Length = 222104

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 212    atgcatgcatgcatgcatgga 232
              |||||||||||||||||||||
Sbjct: 221023 atgcatgcatgcatgcatgga 221043

to top

>dbj|AP005506.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0665F09
          Length = 147102

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 212    atgcatgcatgcatgcatgga 232
              |||||||||||||||||||||
Sbjct: 126129 atgcatgcatgcatgcatgga 126149



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 212    atgcatgcatgcatgcatgg 231
              ||||||||||||||||||||
Sbjct: 126138 atgcatgcatgcatgcatgg 126119

to top

>dbj|AP004183.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1221_H04
          Length = 129387

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 208   atctatgcatgcatgcatgcatgga 232
             |||||| ||||||||||||||||||
Sbjct: 88697 atctatccatgcatgcatgcatgga 88721

to top

>dbj|AK111846.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023143O14, full
            insert sequence
          Length = 2507

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 391  accacctccgccatggacggccggt 415
            |||||||||| ||||||||||||||
Sbjct: 2170 accacctccgacatggacggccggt 2146

to top

>gb|AC147869.3| Monodelphis domestica clone VMRC6-113K21, complete sequence
          Length = 157763

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 211    tatgcatgcatgcatgcatggacac 235
              |||||||||||||||||||| ||||
Sbjct: 154378 tatgcatgcatgcatgcatgcacac 154354

to top

>gb|AC131741.4| Mus musculus BAC clone RP23-66E21 from 7, complete sequence
          Length = 193738

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 209    tctatgcatgcatgcatgcatggacacgg 237
              |||| ||||||||||||||||| ||||||
Sbjct: 113190 tctacgcatgcatgcatgcatgcacacgg 113162

to top

>gb|AC107631.20| Mus musculus chromosome 5, clone RP23-5M20, complete sequence
          Length = 225977

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 212    atgcatgcatgcatgcatgga 232
              |||||||||||||||||||||
Sbjct: 189775 atgcatgcatgcatgcatgga 189755



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 212    atgcatgcatgcatgcatgga 232
              |||||||||||||||||||||
Sbjct: 189671 atgcatgcatgcatgcatgga 189651

to top

>gb|AC101838.17| Mus musculus chromosome 1, clone RP23-242B14, complete sequence
          Length = 178509

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 212    atgcatgcatgcatgcatgga 232
              |||||||||||||||||||||
Sbjct: 144210 atgcatgcatgcatgcatgga 144190

to top

>gb|AC113464.17| Mus musculus chromosome 8, clone RP23-183P1, complete sequence
          Length = 191444

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 59835 atgcatgcatgcatgcatgga 59855

to top

>gb|AC110037.13| Mus musculus chromosome 5, clone RP23-257E17, complete sequence
          Length = 177428

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 212  atgcatgcatgcatgcatgga 232
            |||||||||||||||||||||
Sbjct: 1204 atgcatgcatgcatgcatgga 1224

to top

>emb|CT033775.6| Mouse DNA sequence from clone RP24-145H15 on chromosome 13, complete
             sequence
          Length = 168176

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 208   atctatgcatgcatgcatgca 228
             |||||||||||||||||||||
Sbjct: 27973 atctatgcatgcatgcatgca 27993

to top

>emb|AL591542.20| Mouse DNA sequence from clone RP23-321M14 on chromosome 2, complete
              sequence
          Length = 197190

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 212    atgcatgcatgcatgcatggacacg 236
              ||||||||||||||||||| |||||
Sbjct: 115947 atgcatgcatgcatgcatgcacacg 115971

to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 211     tatgcatgcatgcatgcatggacac 235
               |||||||||||||||||||| ||||
Sbjct: 6548259 tatgcatgcatgcatgcatgcacac 6548283



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 212      atgcatgcatgcatgcatgg 231
                ||||||||||||||||||||
Sbjct: 27027684 atgcatgcatgcatgcatgg 27027665



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 212      atgcatgcatgcatgcatgg 231
                ||||||||||||||||||||
Sbjct: 26022562 atgcatgcatgcatgcatgg 26022581



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 211      tatgcatgcatgcatgcatg 230
                ||||||||||||||||||||
Sbjct: 14578791 tatgcatgcatgcatgcatg 14578810



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 212     atgcatgcatgcatgcatgg 231
               ||||||||||||||||||||
Sbjct: 6215728 atgcatgcatgcatgcatgg 6215709

to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 214      gcatgcatgcatgcatggaca 234
                |||||||||||||||||||||
Sbjct: 23522847 gcatgcatgcatgcatggaca 23522867



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 210      ctatgcatgcatgcatgcat 229
                ||||||||||||||||||||
Sbjct: 24757809 ctatgcatgcatgcatgcat 24757790



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 211      tatgcatgcatgcatgcatg 230
                ||||||||||||||||||||
Sbjct: 24061359 tatgcatgcatgcatgcatg 24061378



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 211      tatgcatgcatgcatgcatg 230
                ||||||||||||||||||||
Sbjct: 19959529 tatgcatgcatgcatgcatg 19959510



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 211      tatgcatgcatgcatgcatg 230
                ||||||||||||||||||||
Sbjct: 19959506 tatgcatgcatgcatgcatg 19959525

to top

>emb|AL772425.7|CNS08CA3 Oryza sativa chromosome 12, . BAC OJ1396_C02 of library Monsanto from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 157690

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 214    gcatgcatgcatgcatggaca 234
              |||||||||||||||||||||
Sbjct: 111754 gcatgcatgcatgcatggaca 111734

to top

>emb|AL606637.3|OSJN00076 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0039K24,
             complete sequence
          Length = 173770

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 47906 atgcatgcatgcatgcatgga 47886

to top

>gb|AC171896.2| Capitella capitata clone JGIBGZA-33J12, complete sequence
          Length = 31338

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 25831 atgcatgcatgcatgcatgga 25851



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 212   atgcatgcatgcatgcatgg 231
             ||||||||||||||||||||
Sbjct: 25848 atgcatgcatgcatgcatgg 25829

to top

>gb|AC145597.4| Mus musculus BAC clone RP24-323M2 from Y, complete sequence
          Length = 199904

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 15121 atgcatgcatgcatgcatgga 15101

to top

>gb|AC132589.4| Mus musculus BAC clone RP24-258M24 from 1, complete sequence
          Length = 168097

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 210   ctatgcatgcatgcatgcatg 230
             |||||||||||||||||||||
Sbjct: 51729 ctatgcatgcatgcatgcatg 51749

to top

>gb|AC145610.4| Mus musculus BAC clone RP24-281O20 from 18, complete sequence
          Length = 182640

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 212   atgcatgcatgcatgcatggacacg 236
             ||||||||||||||||||| |||||
Sbjct: 55373 atgcatgcatgcatgcatgcacacg 55349

to top

>gb|AC140250.3| Mus musculus BAC clone RP24-288J3 from 1, complete sequence
          Length = 163490

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 212  atgcatgcatgcatgcatggacacg 236
            ||||||||||||||||||| |||||
Sbjct: 2052 atgcatgcatgcatgcatgcacacg 2076

to top

>emb|AL844846.11| Mouse DNA sequence from clone RP23-358I19 on chromosome 2, complete
             sequence
          Length = 209013

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 72616 atgcatgcatgcatgcatgga 72636

to top

>emb|CT009700.8| Mouse DNA sequence from clone RP23-114M15 on chromosome 13, complete
            sequence
          Length = 184143

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 211  tatgcatgcatgcatgcatgg 231
            |||||||||||||||||||||
Sbjct: 4703 tatgcatgcatgcatgcatgg 4683

to top

>gb|AC164092.3| Mus musculus BAC clone RP23-366E4 from chromosome 9, complete sequence
          Length = 203636

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 212    atgcatgcatgcatgcatgga 232
              |||||||||||||||||||||
Sbjct: 140574 atgcatgcatgcatgcatgga 140594

to top

>gb|DP000021.1| Monodelphis domestica target 1 genomic scaffold
          Length = 1833844

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 211     tatgcatgcatgcatgcatggacac 235
               |||||||||||||||||||| ||||
Sbjct: 1582942 tatgcatgcatgcatgcatgcacac 1582918

to top

>emb|AL662925.12| Mouse DNA sequence from clone RP23-226M12 on chromosome X, complete
              sequence
          Length = 199774

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 211    tatgcatgcatgcatgcatggacac 235
              |||||||||||||||||||| ||||
Sbjct: 154967 tatgcatgcatgcatgcatgcacac 154991

to top

>emb|AL627214.15| Mouse DNA sequence from clone RP23-357K18 on chromosome 4, complete
            sequence
          Length = 182829

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 212  atgcatgcatgcatgcatgga 232
            |||||||||||||||||||||
Sbjct: 1316 atgcatgcatgcatgcatgga 1336

to top

>emb|AL683893.26| Mouse DNA sequence from clone RP23-122N18 on chromosome 4, complete
              sequence
          Length = 204841

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 212    atgcatgcatgcatgcatgga 232
              |||||||||||||||||||||
Sbjct: 130739 atgcatgcatgcatgcatgga 130759



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 130734 tatgcatgcatgcatgcatg 130753

to top

>emb|AL671910.9| Mouse DNA sequence from clone RP23-245M12 on chromosome X, complete
             sequence
          Length = 141713

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 39672 atgcatgcatgcatgcatgga 39652

to top

>emb|AL671173.12| Mouse DNA sequence from clone RP23-426N4 on chromosome 4, complete
              sequence
          Length = 201741

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 212    atgcatgcatgcatgcatgga 232
              |||||||||||||||||||||
Sbjct: 180331 atgcatgcatgcatgcatgga 180311

to top

>emb|AL691448.24| Mouse DNA sequence from clone RP23-103A1 on chromosome 11, complete
              sequence
          Length = 197959

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 212    atgcatgcatgcatgcatgga 232
              |||||||||||||||||||||
Sbjct: 107321 atgcatgcatgcatgcatgga 107301

to top

>emb|AL671011.9| Mouse DNA sequence from clone RP23-95O23 on chromosome 4, complete
             sequence
          Length = 226950

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 84477 atgcatgcatgcatgcatgga 84457

to top

>emb|AL732513.8| Mouse DNA sequence from clone RP23-344B24 on chromosome 2, complete
             sequence
          Length = 209452

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 91132 atgcatgcatgcatgcatgga 91112

to top

>emb|AL645531.10| Mouse DNA sequence from clone RP23-191E19 on chromosome 4, complete
             sequence
          Length = 97801

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   tatgcatgcatgcatgcatgg 231
             |||||||||||||||||||||
Sbjct: 81572 tatgcatgcatgcatgcatgg 81552

to top

>emb|AL627345.11| Mouse DNA sequence from clone RP23-169E7 on chromosome 4, complete
             sequence
          Length = 73565

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 212   atgcatgcatgcatgcatgga 232
             |||||||||||||||||||||
Sbjct: 72881 atgcatgcatgcatgcatgga 72901

to top

>gb|AC102103.10| Mus musculus chromosome 15, clone RP23-82K1, complete sequence
          Length = 237423

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 221    tgcatgcatggacacggtac 240
              ||||||||||||||||||||
Sbjct: 129762 tgcatgcatggacacggtac 129743

to top

>gb|AC105966.11| Mus musculus chromosome 3, clone RP23-403H2, complete sequence
          Length = 201376

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 119257 tatgcatgcatgcatgcatg 119276

to top

>gb|AC164069.9| Mus musculus chromosome 15, clone RP23-422H17, complete sequence
          Length = 216364

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 59423 tatgcatgcatgcatgcatg 59404

to top

>gb|AC153383.1| Mus musculus 6 BAC RP23-168L2 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 197962

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 212    atgcatgcatgcatgcatgg 231
              ||||||||||||||||||||
Sbjct: 190386 atgcatgcatgcatgcatgg 190367

to top

>gb|AC124664.14| Mus musculus chromosome 1, clone RP23-103B18, complete sequence
          Length = 220456

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 205058 tatgcatgcatgcatgcatg 205077

to top

>gb|AC113121.27| Mus musculus chromosome 8, clone RP23-347G12, complete sequence
          Length = 192877

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 191499 tatgcatgcatgcatgcatg 191480

to top

>gb|AC163102.5| Mus musculus chromosome 18, clone RP23-270E10, complete sequence
          Length = 179127

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 173987 tatgcatgcatgcatgcatg 173968

to top

>gb|DQ257594.1| Hordeum vulgare subsp. vulgare clone 33-23A-RB flanking T-DNA
           insertion sequence
          Length = 843

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 212 atgcatgcatgcatgcatgg 231
           ||||||||||||||||||||
Sbjct: 627 atgcatgcatgcatgcatgg 608

to top

>gb|AC121942.2| Mus musculus chromosome 13 clone RP24-211D12, complete sequence
          Length = 164932

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 110347 tatgcatgcatgcatgcatg 110366

to top

>gb|AC132830.12| Mus musculus chromosome 1, clone RP24-566B6, complete sequence
          Length = 205300

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 60506 tatgcatgcatgcatgcatg 60525

to top

>gb|AC165162.4| Mus musculus BAC clone RP23-173L24 from chromosome 3, complete sequence
          Length = 211699

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 192392 tatgcatgcatgcatgcatg 192411

to top

>gb|AC166158.3| Mus musculus BAC clone RP24-244P14 from chromosome 1, complete sequence
          Length = 170234

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 34654 tatgcatgcatgcatgcatg 34635

to top

>gb|AC167971.3| Mus musculus BAC clone RP24-439I22 from chromosome 7, complete sequence
          Length = 198057

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 71240 tatgcatgcatgcatgcatg 71259

to top

>gb|AC163097.11| Mus musculus chromosome 8, clone RP23-135D17, complete sequence
          Length = 170429

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 213   tgcatgcatgcatgcatgga 232
             ||||||||||||||||||||
Sbjct: 27999 tgcatgcatgcatgcatgga 28018

to top

>ref|XM_467048.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1328

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 391  accacctccgccatggacgg 410
            ||||||||||||||||||||
Sbjct: 1030 accacctccgccatggacgg 1011

to top

>gb|AC110214.7| Mus musculus chromosome 8, clone RP24-485L5, complete sequence
          Length = 213387

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 145874 tatgcatgcatgcatgcatg 145855

to top

>gb|DP000017.1| Sus scrofa target 1 genomic scaffold
          Length = 1471440

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 212    atgcatgcatgcatgcatggacac 235
              ||||||||||||||||||| ||||
Sbjct: 907465 atgcatgcatgcatgcatgcacac 907488

to top

>gb|AC116853.12| Mus musculus chromosome 1, clone RP24-400M20, complete sequence
          Length = 188514

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 94224 tatgcatgcatgcatgcatg 94243

to top

>gb|AC148611.1| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1007D10,
              complete sequence
          Length = 153366

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 107123 tatgcatgcatgcatgcatg 107104

to top

>gb|CP000078.1| Leishmania major strain Friedlin chromosome 2, complete sequence
          Length = 355714

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 212    atgcatgcatgcatgcatgg 231
              ||||||||||||||||||||
Sbjct: 128637 atgcatgcatgcatgcatgg 128618

to top

>gb|AF405701.1| Synthetic construct legume box RY repeat motif sequence
          Length = 82

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 212 atgcatgcatgcatgcatgg 231
           ||||||||||||||||||||
Sbjct: 52  atgcatgcatgcatgcatgg 71

to top

>gb|AY024014.1| Oryza sativa microsatellite MRG6339 containing (CATG)X6, closest to
           marker Y6854L, genomic sequence
          Length = 224

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 212 atgcatgcatgcatgcatgg 231
           ||||||||||||||||||||
Sbjct: 119 atgcatgcatgcatgcatgg 100

to top

>gb|AC147925.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0032N11
              map near 50283S, complete sequence
          Length = 139217

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 111624 tatgcatgcatgcatgcatg 111643

to top

>gb|AY258744.1| Xiphophorus maculatus microsatellite Msc045 sequence
          Length = 602

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 211 tatgcatgcatgcatgcatg 230
           ||||||||||||||||||||
Sbjct: 240 tatgcatgcatgcatgcatg 259

to top

>gb|AC164649.4| Mus musculus BAC clone RP23-437D10 from chromosome 5, complete sequence
          Length = 215766

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 212   atgcatgcatgcatgcatgg 231
             ||||||||||||||||||||
Sbjct: 29247 atgcatgcatgcatgcatgg 29228

to top

>gb|AC154641.2| Mus musculus BAC clone RP23-276C17 from chromosome 16, complete sequence
          Length = 190523

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 183729 tatgcatgcatgcatgcatg 183748

to top

>gb|AC164703.3| Mus musculus BAC clone RP23-266K19 from chromosome 7, complete sequence
          Length = 238433

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 120048 tatgcatgcatgcatgcatg 120029

to top

>gb|AC091677.12| Mus musculus chromosome 18, clone RP23-131E5, complete sequence
          Length = 222121

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 194799 tatgcatgcatgcatgcatg 194780

to top

>gb|AC130598.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0056I11,
              complete sequence
          Length = 145796

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 212    atgcatgcatgcatgcatgg 231
              ||||||||||||||||||||
Sbjct: 101082 atgcatgcatgcatgcatgg 101063

to top

>gb|AC120986.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1781_H11,
              complete sequence
          Length = 204649

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 213    tgcatgcatgcatgcatgga 232
              ||||||||||||||||||||
Sbjct: 133921 tgcatgcatgcatgcatgga 133902

to top

>gb|AC116507.9| Mus musculus chromosome 19, clone RP24-309C17, complete sequence
          Length = 168364

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 11253 tatgcatgcatgcatgcatg 11234



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 11230 tatgcatgcatgcatgcatg 11249

to top

>gb|AC102874.7| Mus musculus chromosome 1, clone RP24-500O1, complete sequence
          Length = 166507

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 69734 tatgcatgcatgcatgcatg 69715

to top

>gb|AC135190.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
            OSJNBa0064H09, complete sequence
          Length = 146742

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 212  atgcatgcatgcatgcatgg 231
            ||||||||||||||||||||
Sbjct: 5079 atgcatgcatgcatgcatgg 5060

to top

>gb|AY663543.1| Sus scrofa albumin gene, complete cds
          Length = 35317

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 212   atgcatgcatgcatgcatggacac 235
             ||||||||||||||||||| ||||
Sbjct: 13762 atgcatgcatgcatgcatgcacac 13785

to top

>gb|AC106169.5| Rattus norvegicus x BAC CH230-105D14 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 227592

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 58559 tatgcatgcatgcatgcatg 58578

to top

>gb|AF130357.2| Mus musculus chromosome X clone CT7-148C10, complete sequence
          Length = 106724

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 212   atgcatgcatgcatgcatggacac 235
             ||||||||||||||||||| ||||
Sbjct: 23313 atgcatgcatgcatgcatgcacac 23336

to top

>gb|AC102285.7| Mus musculus chromosome 19, clone RP24-329P13, complete sequence
          Length = 174894

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 125183 tatgcatgcatgcatgcatg 125164

to top

>gb|AC136998.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
              OSJNBa0082P17, complete sequence
          Length = 157539

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 212    atgcatgcatgcatgcatgg 231
              ||||||||||||||||||||
Sbjct: 112697 atgcatgcatgcatgcatgg 112678

to top

>gb|AY532747.1| Zea mays subsp. parviglumis isolate p5 chitinase (chiI) gene,
            complete cds
          Length = 1089

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 212  atgcatgcatgcatgcatgg 231
            ||||||||||||||||||||
Sbjct: 1009 atgcatgcatgcatgcatgg 990

to top

>gb|AC115746.10| Mus musculus chromosome 15, clone RP23-3J8, complete sequence
          Length = 214765

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 29030 tatgcatgcatgcatgcatg 29049

to top

>gb|AC124830.8| Mus musculus chromosome 17, clone RP24-165B21, complete sequence
          Length = 176889

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 83101 tatgcatgcatgcatgcatg 83120

to top

>gb|AC124143.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0053D02, complete sequence
          Length = 157106

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 212   atgcatgcatgcatgcatgg 231
             ||||||||||||||||||||
Sbjct: 60595 atgcatgcatgcatgcatgg 60614

to top

>gb|AC137592.2| Oryza sativa (Japonica cultiva-group) chromosome 9 BAC clone
              OSJNBa0035B22, complete sequence
          Length = 155788

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 391    accacctccgccatggacggccgg 414
              |||||||||| |||||||||||||
Sbjct: 152526 accacctccgacatggacggccgg 152503

to top

>gb|AC115036.10| Mus musculus chromosome 7, clone RP24-274F20, complete sequence
          Length = 173506

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 212    atgcatgcatgcatgcatgg 231
              ||||||||||||||||||||
Sbjct: 160760 atgcatgcatgcatgcatgg 160779

to top

>gb|AC107206.4| Oryza sativa chromosome 3 BAC OSJNBa0063J18 genomic sequence, complete
              sequence
          Length = 154558

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 212    atgcatgcatgcatgcatgg 231
              ||||||||||||||||||||
Sbjct: 118968 atgcatgcatgcatgcatgg 118987

to top

>gb|AC134839.3| Mus musculus BAC clone RP24-362O23 from chromosome 19, complete sequence
          Length = 178560

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 113739 tatgcatgcatgcatgcatg 113720

to top

>gb|AC137156.3| Mus musculus BAC clone RP23-118K10 from chromosome 15, complete sequence
          Length = 205599

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 191412 tatgcatgcatgcatgcatg 191431

to top

>gb|AC141565.3| Mus musculus BAC clone RP23-160M21 from chromosome 14, complete
             sequence
          Length = 210128

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 64924 tatgcatgcatgcatgcatg 64905

to top

>gb|AC130546.4| Mus musculus BAC clone RP24-303D11 from chromosome 3, complete sequence
          Length = 171125

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 130820 tatgcatgcatgcatgcatg 130801

to top

>gb|AC132107.3| Mus musculus BAC clone RP24-251C17 from chromosome 8, complete sequence
          Length = 141785

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 212   atgcatgcatgcatgcatggacac 235
             ||||||||||||||||||| ||||
Sbjct: 57593 atgcatgcatgcatgcatgcacac 57616

to top

>gb|AC135567.3| Mus musculus BAC clone RP23-312I24 from chromosome 16, complete
             sequence
          Length = 208603

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 14252 tatgcatgcatgcatgcatg 14271

to top

>gb|AC140389.3| Mus musculus BAC clone RP24-202H2 from chromosome 18, complete sequence
          Length = 169195

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 132225 tatgcatgcatgcatgcatg 132244

to top

>gb|AC145740.4| Mus musculus BAC clone RP24-233K8 from chromosome 12, complete sequence
          Length = 178285

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 130109 tatgcatgcatgcatgcatg 130090

to top

>gb|AC119181.11| Mus musculus chromosome 18, clone RP24-111I16, complete sequence
          Length = 195506

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 52456 tatgcatgcatgcatgcatg 52437

to top

>gb|AC134735.3| Rattus norvegicus 20 BAC CH230-1P16 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 49899

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 17689 tatgcatgcatgcatgcatg 17670

to top

>gb|AC145084.6| Mus musculus chromosome 18, clone RP24-175N20, complete sequence
          Length = 193640

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 112612 tatgcatgcatgcatgcatg 112593

to top

>gb|AC124211.2| Mus musculus chromosome X clone CT7-497M13 map qA7.1, complete sequence
          Length = 114873

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 212   atgcatgcatgcatgcatggacac 235
             ||||||||||||||||||| ||||
Sbjct: 70813 atgcatgcatgcatgcatgcacac 70836

to top

>gb|AY372324.1| Diastema racemiferum internal transcribed spacer 1, complete
           sequence
          Length = 228

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 210 ctatgcatgcatgcatgcat 229
           ||||||||||||||||||||
Sbjct: 87  ctatgcatgcatgcatgcat 106

to top

>gb|AC133902.12| Mus musculus chromosome 10, clone RP24-538B17, complete sequence
          Length = 199604

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 41357 tatgcatgcatgcatgcatg 41376

to top

>gb|AC069309.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-154D15, complete
              sequence
          Length = 174754

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 169142 tatgcatgcatgcatgcatg 169161

to top

>gb|AC115714.14| Mus musculus chromosome 12, clone RP23-477C24, complete sequence
          Length = 164272

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 212    atgcatgcatgcatgcatgg 231
              ||||||||||||||||||||
Sbjct: 111550 atgcatgcatgcatgcatgg 111569

to top

>gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1525_A02,
             complete sequence
          Length = 93826

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 74486 tatgcatgcatgcatgcatg 74467

to top

>gb|AC096884.2| Sus scrofa clone RP44-519O7, complete sequence
          Length = 146504

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 212   atgcatgcatgcatgcatggacac 235
             ||||||||||||||||||| ||||
Sbjct: 76870 atgcatgcatgcatgcatgcacac 76893

to top

>gb|AC146059.4| Pan troglodytes BAC clone RP43-14K1 from 7, complete sequence
          Length = 210466

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 122485 tatgcatgcatgcatgcatg 122466



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 122462 tatgcatgcatgcatgcatg 122481

to top

>gb|AC131713.3| Mus musculus BAC clone RP23-193O18 from chromosome 18, complete
             sequence
          Length = 220193

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 22300 tatgcatgcatgcatgcatg 22319

to top

>gb|AC145307.3| Mus musculus BAC clone RP24-400C6 from chromosome 17, complete sequence
          Length = 203180

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 176749 tatgcatgcatgcatgcatg 176730

to top

>gb|AC161514.4| Mus musculus chromosome 7, clone RP23-378L12, complete sequence
          Length = 190426

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 113195 tatgcatgcatgcatgcatg 113214

to top

>gb|AC140042.19| Mus musculus chromosome 5, clone RP23-437D10, complete sequence
          Length = 215786

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 212    atgcatgcatgcatgcatgg 231
              ||||||||||||||||||||
Sbjct: 186540 atgcatgcatgcatgcatgg 186559

to top

>gb|DQ175932.1| Hordeum vulgare subsp. vulgare clone 33-25A-RB flanking T-DNA
           insertion sequence
          Length = 843

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 212 atgcatgcatgcatgcatgg 231
           ||||||||||||||||||||
Sbjct: 627 atgcatgcatgcatgcatgg 608

to top

>gb|AC091464.8| Mus musculus chromosome 14, clone RP23-97N1, complete sequence
          Length = 237814

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 150670 tatgcatgcatgcatgcatg 150689

to top

>gb|AC079957.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-144I17, complete
             sequence
          Length = 196474

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 34611 tatgcatgcatgcatgcatg 34592

to top

>gb|AC116515.11| Mus musculus chromosome 7, clone RP24-331B9, complete sequence
          Length = 133179

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 112902 tatgcatgcatgcatgcatg 112883

to top

>gb|AC161217.7| Mus musculus chromosome 8, clone RP23-80D9, complete sequence
          Length = 234127

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 179308 tatgcatgcatgcatgcatg 179327



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 56882 tatgcatgcatgcatgcatg 56901

to top

>gb|AC153010.3| Mus musculus BAC clone RP23-325H1 from chromosome 15, complete sequence
          Length = 230097

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 212    atgcatgcatgcatgcatgg 231
              ||||||||||||||||||||
Sbjct: 189425 atgcatgcatgcatgcatgg 189444

to top

>gb|AC166827.2| Mus musculus BAC clone RP23-359M9 from chromosome 12, complete sequence
          Length = 219729

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 89555 tatgcatgcatgcatgcatg 89574

to top

>gb|AC109139.15| Mus musculus chromosome 8, clone RP23-47L13, complete sequence
          Length = 268904

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 253726 tatgcatgcatgcatgcatg 253745

to top

>gb|AC104868.8| Mus musculus chromosome 1, clone RP24-532K6, complete sequence
          Length = 182376

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 174205 tatgcatgcatgcatgcatg 174186

to top

>gb|AC163668.5| Mus musculus BAC clone RP23-32P22 from chromosome 1, complete sequence
          Length = 222156

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 163047 tatgcatgcatgcatgcatg 163066

to top

>gb|AC159244.4| Mus musculus BAC clone RP24-309L4 from chromosome 12, complete sequence
          Length = 216500

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 168604 tatgcatgcatgcatgcatg 168623

to top

>gb|AC121290.6| Mus musculus chromosome 16, clone RP23-84N4, complete sequence
          Length = 241184

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 99474 tatgcatgcatgcatgcatg 99493

to top

>gb|DQ160222.1|DQ160222S1 Zea mays pericarp color 1 gene, pericarp color 1-P1rwCFS342 allele,
            5' noncoding region
          Length = 5500

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 212  atgcatgcatgcatgcatgg 231
            ||||||||||||||||||||
Sbjct: 1791 atgcatgcatgcatgcatgg 1810



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 211  tatgcatgcatgcatgcatg 230
            ||||||||||||||||||||
Sbjct: 1786 tatgcatgcatgcatgcatg 1805

to top

>gb|AC163616.3| Mus musculus BAC clone RP23-114P22 from chromosome 3, complete
            sequence
          Length = 212857

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 211  tatgcatgcatgcatgcatg 230
            ||||||||||||||||||||
Sbjct: 8994 tatgcatgcatgcatgcatg 9013

to top

>gb|AC155823.8| Mus musculus BAC clone RP23-348C5 from chromosome 8, complete sequence
          Length = 219597

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 212    atgcatgcatgcatgcatggacac 235
              ||||||||||||||||||| ||||
Sbjct: 173977 atgcatgcatgcatgcatgcacac 174000

to top

>gb|AC161364.4| Mus musculus BAC clone RP24-353J16 from chromosome 6, complete sequence
          Length = 182872

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 20249 tatgcatgcatgcatgcatg 20268

to top

>gb|AC164121.3| Mus musculus BAC clone RP24-406J12 from chromosome 12, complete
           sequence
          Length = 169925

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 212 atgcatgcatgcatgcatgg 231
           ||||||||||||||||||||
Sbjct: 911 atgcatgcatgcatgcatgg 930

to top

>gb|AC158612.7| Mus musculus 10 BAC RP23-39I3 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 206234

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 91449 tatgcatgcatgcatgcatg 91468

to top

>gb|AC131105.4| Mus musculus BAC clone RP23-280N9 from chromosome 19, complete sequence
          Length = 225527

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 269    ccctcccctacctctggctg 288
              ||||||||||||||||||||
Sbjct: 161274 ccctcccctacctctggctg 161255

to top

>gb|AC137108.12| Mus musculus chromosome 9, clone RP23-277J20, complete sequence
          Length = 204108

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 185331 tatgcatgcatgcatgcatg 185312

to top

>gb|AC121992.3| Mus musculus BAC clone RP24-300I17 from chromosome 12, complete
            sequence
          Length = 139943

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 212  atgcatgcatgcatgcatggacac 235
            ||||||||||||||||||| ||||
Sbjct: 8461 atgcatgcatgcatgcatgcacac 8438

to top

>gb|AC105066.12| Mus musculus chromosome 8, clone RP23-158A22, complete sequence
          Length = 238527

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 212   atgcatgcatgcatgcatggacac 235
             ||||||||||||||||||| ||||
Sbjct: 31370 atgcatgcatgcatgcatgtacac 31347

to top

>gb|AC123693.13| Mus musculus chromosome 3, clone RP23-326F23, complete sequence
          Length = 225242

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 212    atgcatgcatgcatgcatggacac 235
              ||||||||||||||||||| ||||
Sbjct: 170925 atgcatgcatgcatgcatgcacac 170948



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 212    atgcatgcatgcatgcatgg 231
              ||||||||||||||||||||
Sbjct: 170942 atgcatgcatgcatgcatgg 170923

to top

>gb|AC121079.20| Mus musculus chromosome 3, clone RP24-178P12, complete sequence
          Length = 177802

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 150380 tatgcatgcatgcatgcatg 150361

to top

>gb|AC102392.8| Mus musculus chromosome 3, clone RP24-122I22, complete sequence
          Length = 201067

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 23906 tatgcatgcatgcatgcatg 23887

to top

>gb|AC133967.2| Mus musculus BAC clone RP23-14J5 from chromosome 16, complete sequence
          Length = 195446

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 81389 tatgcatgcatgcatgcatg 81408

to top

>gb|AC122376.4| Mus musculus BAC clone RP23-472G10 from chromosome 7, complete sequence
          Length = 183918

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 35389 tatgcatgcatgcatgcatg 35370

to top

>gb|AC132590.3| Mus musculus BAC clone RP24-273G1 from chromosome 14, complete
            sequence
          Length = 161371

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 211  tatgcatgcatgcatgcatg 230
            ||||||||||||||||||||
Sbjct: 4656 tatgcatgcatgcatgcatg 4637

to top

>gb|AC142474.4| Mus musculus BAC clone RP24-362N7 from chromosome 15, complete sequence
          Length = 172879

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 212   atgcatgcatgcatgcatgg 231
             ||||||||||||||||||||
Sbjct: 58757 atgcatgcatgcatgcatgg 58776

to top

>emb|CT025649.7| Mouse DNA sequence from clone RP24-345B5 on chromosome 14, complete
              sequence
          Length = 175794

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 169675 tatgcatgcatgcatgcatg 169694

to top

>emb|AL935124.31| Mouse DNA sequence from clone RP23-88C15 on chromosome 2, complete
              sequence
          Length = 193805

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 109505 tatgcatgcatgcatgcatg 109486

to top

>emb|BX901970.11| Zebrafish DNA sequence from clone CH211-214I7 in linkage group 1,
            complete sequence
          Length = 22414

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 211  tatgcatgcatgcatgcatg 230
            ||||||||||||||||||||
Sbjct: 4893 tatgcatgcatgcatgcatg 4912

to top

>emb|CT025643.4| Mouse DNA sequence from clone RP24-386L23 on chromosome 13, complete
             sequence
          Length = 148821

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 76454 tatgcatgcatgcatgcatg 76435



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 76418 tatgcatgcatgcatgcatg 76399



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 76374 tatgcatgcatgcatgcatg 76355

to top

>emb|AJ578690.1|EGU578690 Elaeis guineensis microsatellite DNA, clone mEgCIR3593
          Length = 440

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 211 tatgcatgcatgcatgcatg 230
           ||||||||||||||||||||
Sbjct: 338 tatgcatgcatgcatgcatg 319

to top

>emb|AJ438040.1|TCH438040 Tetraselmis chui DNA containing repeats, strain CCAP 8/6
          Length = 903

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 212 atgcatgcatgcatgcatgg 231
           ||||||||||||||||||||
Sbjct: 308 atgcatgcatgcatgcatgg 327

to top

>emb|CT009546.4| Mouse DNA sequence from clone RP23-111H19 on chromosome 13, complete
              sequence
          Length = 207769

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 192240 tatgcatgcatgcatgcatg 192259

to top

>emb|BX324230.15| Zebrafish DNA sequence from clone CH211-42C5 in linkage group 7,
             complete sequence
          Length = 179902

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 63519 tatgcatgcatgcatgcatg 63538

to top

>gb|AC115361.5| Mus musculus BAC clone RP24-76P12 from chromosome 8, complete sequence
          Length = 235095

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 66182 tatgcatgcatgcatgcatg 66201

to top

>gb|AC132272.3| Mus musculus BAC clone RP24-339P23 from chromosome 16, complete sequence
          Length = 147166

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 119629 tatgcatgcatgcatgcatg 119648

to top

>gb|AC122000.3| Mus musculus BAC clone RP24-328N20 from chromosome 16, complete
             sequence
          Length = 188993

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 85054 tatgcatgcatgcatgcatg 85073

to top

>gb|AC129198.3| Mus musculus BAC clone RP24-183I4 from chromosome 15, complete sequence
          Length = 165791

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 14050 tatgcatgcatgcatgcatg 14069

to top

>gb|AC125096.3| Mus musculus BAC clone RP24-181K19 from chromosome 18, complete
             sequence
          Length = 154941

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 31407 tatgcatgcatgcatgcatg 31388

to top

>gb|AC126671.3| Mus musculus BAC clone RP24-472G2 from chromosome 16, complete sequence
          Length = 172980

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 88884 tatgcatgcatgcatgcatg 88865

to top

>gb|AC127557.5| Mus musculus BAC clone RP24-416I20 from chromosome 17, complete
             sequence
          Length = 148854

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 27145 tatgcatgcatgcatgcatg 27164

to top

>gb|AC129590.4| Mus musculus BAC clone RP24-428B12 from chromosome 14, complete sequence
          Length = 180177

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 152324 tatgcatgcatgcatgcatg 152305

to top

>gb|AC134441.4| Mus musculus BAC clone RP24-544J6 from chromosome 5, complete sequence
          Length = 177565

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 166940 tatgcatgcatgcatgcatg 166959

to top

>gb|AC122299.5| Mus musculus BAC clone RP23-270L23 from chromosome 5, complete sequence
          Length = 209091

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 113548 tatgcatgcatgcatgcatg 113529

to top

>gb|AC116319.4| Mus musculus BAC clone RP23-265J2 from chromosome 14, complete sequence
          Length = 170494

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 212    atgcatgcatgcatgcatggacac 235
              ||||||||||||||| ||||||||
Sbjct: 115609 atgcatgcatgcatgtatggacac 115632

to top

>gb|AC126447.3| Mus musculus BAC clone RP23-352G19 from chromosome 5, complete sequence
          Length = 196904

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 212   atgcatgcatgcatgcatgg 231
             ||||||||||||||||||||
Sbjct: 59387 atgcatgcatgcatgcatgg 59406



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 25780 tatgcatgcatgcatgcatg 25761



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 212   atgcatgcatgcatgcatgg 231
             ||||||||||||||||||||
Sbjct: 25775 atgcatgcatgcatgcatgg 25756

to top

>gb|AC122365.4| Mus musculus BAC clone RP23-447A7 from chromosome 5, complete sequence
          Length = 195492

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tatgcatgcatgcatgcatg 230
             ||||||||||||||||||||
Sbjct: 84322 tatgcatgcatgcatgcatg 84303

to top

>gb|AC123842.4| Mus musculus BAC clone RP23-400N18 from chromosome 10, complete sequence
          Length = 200997

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tatgcatgcatgcatgcatg 230
              ||||||||||||||||||||
Sbjct: 117198 tatgcatgcatgcatgcatg 117179

to top

>gb|AC126442.4| Mus musculus BAC clone RP23-453M12 from chromosome 7, complete sequence
          Length = 204287

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 212   atgcatgcatgcatgcatgg 231
             ||||||||||||||||||||
Sbjct: 39608 atgcatgcatgcatgcatgg 39589


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,336,871
Number of Sequences: 3902068
Number of extensions: 3336871
Number of successful extensions: 103993
Number of sequences better than 10.0: 669
Number of HSP's better than 10.0 without gapping: 694
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 94942
Number of HSP's gapped (non-prelim): 7229
length of query: 443
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 421
effective length of database: 17,147,199,772
effective search space: 7218971104012
effective search space used: 7218971104012
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result