ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl30e04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY277973.1| Takifugu rubripes transcription factor Sox5 (Sox5... 40 5.7
2ref|XM_729065.1| Plasmodium chabaudi chabaudi hypothetical prote... 40 5.7
3emb|AL161471.2|ATCHRIV1 Arabidopsis thaliana DNA chromosome 4, c... 40 5.7
4emb|AL773513.3| Mouse DNA sequence from clone RP24-535M24 on chr... 40 5.7
5gb|AC025586.4| Genomic sequence for Mus musculus, clone RP23-320... 40 5.7
6gb|DQ283072.1| Megaelosia goeldii 12S ribosomal RNA gene, partia... 40 5.7
7gb|M60043.1|HSBIE1AA Bovine herpesvirus 4 putative (IE1) and IE1... 40 5.7
8emb|BX323581.9| Zebrafish DNA sequence from clone CH211-255A21 i... 40 5.7
9gb|AC008550.5| Homo sapiens chromosome 5 clone CTC-507E12, compl... 40 5.7
10gb|AC010409.6|AC010409 Homo sapiens chromosome 5 clone CTD-2158P... 40 5.7
11gb|AF318573.1|AF318573 Bovine herpesvirus 4 long unique region, ... 40 5.7
12gb|AC158635.6| Mus musculus 10 BAC RP23-396A23 (Roswell Park Can... 40 5.7
13gb|AC102562.13| Mus musculus chromosome 18, clone RP23-205H1, co... 40 5.7
14gb|AF069299.1|F6N15 Arabidopsis thaliana BAC F6N15 40 5.7
15gb|AC004708.1|AC004708 CIC5B11.1 check: 4870 from: 1 to: 1672... 40 5.7
16dbj|AB215373.1| Equus caballus DNA, microsatellite TKY1430 40 5.7
17gb|AC123793.5| Mus musculus BAC clone RP24-315L18 from chromosom... 40 5.7
18emb|AL663027.9| Mouse DNA sequence from clone RP23-16P3 on chrom... 40 5.7
19emb|AL592422.11| Mouse DNA sequence from clone RP23-218O16 on ch... 40 5.7

>gb|AY277973.1| Takifugu rubripes transcription factor Sox5 (Sox5) gene, complete cds
          Length = 61929

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 35    caaatgaaataataattaaa 54
             ||||||||||||||||||||
Sbjct: 60930 caaatgaaataataattaaa 60911



to top

>ref|XM_729065.1| Plasmodium chabaudi chabaudi hypothetical protein (PC400920.00.0)
          partial mRNA
          Length = 640

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 7  tatgcataactatgatgcac 26
          ||||||||||||||||||||
Sbjct: 59 tatgcataactatgatgcac 78



to top

>emb|AL161471.2|ATCHRIV1 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 1
          Length = 197119

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 272   tgcaaaattccacaataatt 291
             ||||||||||||||||||||
Sbjct: 19210 tgcaaaattccacaataatt 19229



to top

>emb|AL773513.3| Mouse DNA sequence from clone RP24-535M24 on chromosome 4 Contains the
             5' end of the Tle1 gene for transducin-like enhancer of
             split 1 homolog of Drosophila E(spl), two novel genes and
             a CpG island, complete sequence
          Length = 121919

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    gaatataagtgttaaacacg 77
             ||||||||||||||||||||
Sbjct: 85354 gaatataagtgttaaacacg 85373



to top

>gb|AC025586.4| Genomic sequence for Mus musculus, clone RP23-320C8, complete sequence
          Length = 185386

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 101   ttatttacatcttctgtaataaac 124
             |||||||||| |||||||||||||
Sbjct: 24623 ttatttacatattctgtaataaac 24646



to top

>gb|DQ283072.1| Megaelosia goeldii 12S ribosomal RNA gene, partial sequence; tRNA-Val
            gene, complete sequence; and 16S ribosomal RNA gene,
            partial sequence; mitochondrial
          Length = 2414

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 36   aaatgaaataataattaaag 55
            ||||||||||||||||||||
Sbjct: 1136 aaatgaaataataattaaag 1155



to top

>gb|M60043.1|HSBIE1AA Bovine herpesvirus 4 putative (IE1) and IE1 genes, complete cds
          Length = 3241

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 91  ccccatctgattatttacat 110
           ||||||||||||||||||||
Sbjct: 151 ccccatctgattatttacat 170



to top

>emb|BX323581.9| Zebrafish DNA sequence from clone CH211-255A21 in linkage group 5,
             complete sequence
          Length = 99892

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 42    aataataattaaaggtgaatataa 65
             |||||||||||||||| |||||||
Sbjct: 62760 aataataattaaaggtcaatataa 62783



to top

>gb|AC008550.5| Homo sapiens chromosome 5 clone CTC-507E12, complete sequence
          Length = 125406

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 108  catcttctgtaataaaccta 127
            ||||||||||||||||||||
Sbjct: 2872 catcttctgtaataaaccta 2853



to top

>gb|AC010409.6|AC010409 Homo sapiens chromosome 5 clone CTD-2158P22, complete sequence
          Length = 117334

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 108    catcttctgtaataaaccta 127
              ||||||||||||||||||||
Sbjct: 105379 catcttctgtaataaaccta 105360



to top

>gb|AF318573.1|AF318573 Bovine herpesvirus 4 long unique region, complete sequence
          Length = 108873

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 91    ccccatctgattatttacat 110
             ||||||||||||||||||||
Sbjct: 21545 ccccatctgattatttacat 21526



to top

>gb|AC158635.6| Mus musculus 10 BAC RP23-396A23 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 183931

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 22    tgcacgcatgcatcaaatga 41
             ||||||||||||||||||||
Sbjct: 96973 tgcacgcatgcatcaaatga 96992



to top

>gb|AC102562.13| Mus musculus chromosome 18, clone RP23-205H1, complete sequence
          Length = 210975

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 24     cacgcatgcatcaaatgaaa 43
              ||||||||||||||||||||
Sbjct: 118624 cacgcatgcatcaaatgaaa 118643



to top

>gb|AF069299.1|F6N15 Arabidopsis thaliana BAC F6N15
          Length = 95643

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 272   tgcaaaattccacaataatt 291
             ||||||||||||||||||||
Sbjct: 14072 tgcaaaattccacaataatt 14091



to top

>gb|AC004708.1|AC004708 CIC5B11.1  check: 4870  from: 1  to: 167234, complete sequence
          Length = 167234

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 272   tgcaaaattccacaataatt 291
             ||||||||||||||||||||
Sbjct: 44620 tgcaaaattccacaataatt 44639



to top

>dbj|AB215373.1| Equus caballus DNA, microsatellite TKY1430
          Length = 251

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 306 ttcttggcatctgatttggc 325
           ||||||||||||||||||||
Sbjct: 156 ttcttggcatctgatttggc 175



to top

>gb|AC123793.5| Mus musculus BAC clone RP24-315L18 from chromosome 1, complete sequence
          Length = 206081

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 404    ggtggatggagacccaggct 423
              ||||||||||||||||||||
Sbjct: 100215 ggtggatggagacccaggct 100234



to top

>emb|AL663027.9| Mouse DNA sequence from clone RP23-16P3 on chromosome 2, complete
              sequence
          Length = 219778

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 402    ggggtggatggagacccagg 421
              ||||||||||||||||||||
Sbjct: 152256 ggggtggatggagacccagg 152237



to top

>emb|AL592422.11| Mouse DNA sequence from clone RP23-218O16 on chromosome 11, complete
              sequence
          Length = 205668

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 101    ttatttacatcttctgtaataaac 124
              |||||||||| |||||||||||||
Sbjct: 109982 ttatttacatattctgtaataaac 110005


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,871,643
Number of Sequences: 3902068
Number of extensions: 3871643
Number of successful extensions: 99336
Number of sequences better than 10.0: 19
Number of HSP's better than 10.0 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 99301
Number of HSP's gapped (non-prelim): 35
length of query: 427
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 405
effective length of database: 17,147,199,772
effective search space: 6944615907660
effective search space used: 6944615907660
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top