ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl30d05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_450166.1| Oryza sativa (japonica cultivar-group), mRNA 90 8e-15
2dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 90 8e-15
3dbj|AP005583.3| Oryza sativa (japonica cultivar-group) genomic D... 90 8e-15
4dbj|AK074022.1| Oryza sativa (japonica cultivar-group) cDNA clon... 90 8e-15
5gb|AC007364.3| Homo sapiens BAC clone RP11-329H24 from 2, comple... 44 0.40
6emb|AL136100.12| Human DNA sequence from clone RP11-534P19 on ch... 44 0.40
7gb|AC127702.2| Homo sapiens BAC clone RP11-1386H14 from UL, comp... 44 0.40
8gb|AC007441.9| Drosophila melanogaster clone BACR10E03, complete... 42 1.6
9ref|NG_000004.2| Homo sapiens cytochrome P450, family 3, subfami... 42 1.6
10gb|AC146138.2| Pan troglodytes BAC clone RP43-3D14 from 7, compl... 42 1.6
11gb|AC146392.5| Pan troglodytes BAC clone RP43-57L13 from 7, comp... 42 1.6
12gb|AC011904.3| Homo sapiens BAC clone CTD-3244O18 from 7, comple... 42 1.6
13emb|AL590236.8| Human DNA sequence from clone RP11-145I17 on chr... 42 1.6
14emb|AL365254.14| Human DNA sequence from clone RP11-420H21 on ch... 42 1.6
15emb|AL354995.13| Human DNA sequence from clone RP11-512J14 on ch... 42 1.6
16emb|AL034369.1|HSA149D17 Human DNA sequence from clone RP6-149D1... 42 1.6
17gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 42 1.6
18gb|AC040977.10| Homo sapiens chromosome 17, clone RP11-589P10, c... 42 1.6
19gb|AC026182.4| Homo sapiens chromosome 3 clone RP11-279B12 map 3... 42 1.6
20gb|AC027763.9| Homo sapiens chromosome 17, clone RP11-530N7, com... 42 1.6
21gb|AC004977.2|AC004977 Homo sapiens PAC clone RP5-1152C17 from 7... 42 1.6
22gb|AC018833.3|AC018833 Homo sapiens chromosome 3 clone RP11-497I... 42 1.6
23gb|AE003703.3| Drosophila melanogaster chromosome 3R, section 41... 42 1.6
24gb|AC132239.4| Mus musculus BAC clone RP24-534D4 from 13, comple... 42 1.6
25gb|AC129597.5| Mus musculus BAC clone RP23-262I17 from 13, compl... 42 1.6
26gb|AC026214.4| Homo sapiens chromosome 3 clone RP11-717M12 map 3... 42 1.6
27gb|AC169801.2| Rhesus Macaque BAC CH250-205G14 (Children's Hosp... 40 6.2
28gb|AC132619.3| Mus musculus BAC clone RP23-195N4 from chromosome... 40 6.2
29gb|AC111131.8| Mus musculus, clone RP23-340N7, complete sequence 40 6.2
30emb|AL671969.39| Mouse DNA sequence from clone RP23-339O7 on chr... 40 6.2
31emb|CR352230.8| Zebrafish DNA sequence from clone CH211-106G8 in... 40 6.2
32gb|AC011266.8| Homo sapiens chromosome 18, clone RP11-5A1, compl... 40 6.2
33gb|AC067819.10| Homo sapiens chromosome 18, clone RP11-585K6, co... 40 6.2
34gb|AC162947.2| Mus musculus BAC clone RP23-12D16 from chromosome... 40 6.2
35gb|AC162927.3| Mus musculus BAC clone RP23-269E12 from chromosom... 40 6.2
36gb|AC116574.6| Mus musculus BAC clone RP23-234F20 from chromosom... 40 6.2
37gb|AC091491.3| Homo sapiens chromosome 3 clone RP11-15F1 map 3p,... 40 6.2
38emb|BX005255.10| Mouse DNA sequence from clone RP23-228N14 on ch... 40 6.2
39emb|CT485604.3| Pan troglodytes chromosome X clone PTB-004I10 ma... 40 6.2
40gb|AC127086.4| Mus musculus BAC clone RP24-540I5 from 8, complet... 40 6.2
41gb|AC147718.1| Gallus gallus BAC clone CH261-18A20 from chromoso... 40 6.2 
>ref|XM_450166.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 3570

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                        
Query: 382  tgaaataattcacttctggtgactcttattttggttgattgaacctctgcttcgacatca 441
            |||||||||||||||||  |||| |||||||||| ||||||  |||||||||| ||||| 
Sbjct: 3247 tgaaataattcacttctattgacccttattttggctgattgcccctctgcttcaacatcg 3188

                                 
Query: 442  ttaacaactccccggcatttt 462
            ||||||||||| |||||||||
Sbjct: 3187 ttaacaactccacggcatttt 3167
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
               sequence
          Length = 22696651

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 72/81 (88%)
 Strand = Plus / Plus

                                                                           
Query: 382     tgaaataattcacttctggtgactcttattttggttgattgaacctctgcttcgacatca 441
               |||||||||||||||||  |||| |||||||||| ||||||  |||||||||| ||||| 
Sbjct: 2549793 tgaaataattcacttctattgacccttattttggctgattgcccctctgcttcaacatcg 2549852

                                    
Query: 442     ttaacaactccccggcatttt 462
               ||||||||||| |||||||||
Sbjct: 2549853 ttaacaactccacggcatttt 2549873
to top
>dbj|AP005583.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0406E03
          Length = 201069

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 72/81 (88%)
 Strand = Plus / Plus

                                                                          
Query: 382    tgaaataattcacttctggtgactcttattttggttgattgaacctctgcttcgacatca 441
              |||||||||||||||||  |||| |||||||||| ||||||  |||||||||| ||||| 
Sbjct: 136383 tgaaataattcacttctattgacccttattttggctgattgcccctctgcttcaacatcg 136442

                                   
Query: 442    ttaacaactccccggcatttt 462
              ||||||||||| |||||||||
Sbjct: 136443 ttaacaactccacggcatttt 136463
to top
>dbj|AK074022.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033074A15, full
            insert sequence
          Length = 3570

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                        
Query: 382  tgaaataattcacttctggtgactcttattttggttgattgaacctctgcttcgacatca 441
            |||||||||||||||||  |||| |||||||||| ||||||  |||||||||| ||||| 
Sbjct: 3247 tgaaataattcacttctattgacccttattttggctgattgcccctctgcttcaacatcg 3188

                                 
Query: 442  ttaacaactccccggcatttt 462
            ||||||||||| |||||||||
Sbjct: 3187 ttaacaactccacggcatttt 3167
to top
>gb|AC007364.3| Homo sapiens BAC clone RP11-329H24 from 2, complete sequence
          Length = 200908

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 41    cacttaacataatgacttctaa 62
             ||||||||||||||||||||||
Sbjct: 43624 cacttaacataatgacttctaa 43603
to top
>emb|AL136100.12| Human DNA sequence from clone RP11-534P19 on chromosome 6 Contains a
              pseudogene similar to zinc finger proteins, complete
              sequence
          Length = 172212

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 87     caaggaacactggaaatagtga 108
              ||||||||||||||||||||||
Sbjct: 158037 caaggaacactggaaatagtga 158016
to top
>gb|AC127702.2| Homo sapiens BAC clone RP11-1386H14 from UL, complete sequence
          Length = 176969

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 87    caaggaacactggaaatagtga 108
             ||||||||||||||||||||||
Sbjct: 54709 caaggaacactggaaatagtga 54688
to top
>gb|AC007441.9| Drosophila melanogaster clone BACR10E03, complete sequence
          Length = 195212

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 262   ctagaatcataaagtcggtca 282
             |||||||||||||||||||||
Sbjct: 87523 ctagaatcataaagtcggtca 87543
to top
>ref|NG_000004.2| Homo sapiens cytochrome P450, family 3, subfamily A (CYP3A) on
             chromosome 7
          Length = 428605

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 373   tctttttgctgaaataattca 393
             |||||||||||||||||||||
Sbjct: 25143 tctttttgctgaaataattca 25163
to top
>gb|AC146138.2| Pan troglodytes BAC clone RP43-3D14 from 7, complete sequence
          Length = 176823

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 373   tctttttgctgaaataattca 393
             |||||||||||||||||||||
Sbjct: 49083 tctttttgctgaaataattca 49063
to top
>gb|AC146392.5| Pan troglodytes BAC clone RP43-57L13 from 7, complete sequence
          Length = 170470

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 373   tctttttgctgaaataattca 393
             |||||||||||||||||||||
Sbjct: 20049 tctttttgctgaaataattca 20069
to top
>gb|AC011904.3| Homo sapiens BAC clone CTD-3244O18 from 7, complete sequence
          Length = 113879

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 373   tctttttgctgaaataattca 393
             |||||||||||||||||||||
Sbjct: 25143 tctttttgctgaaataattca 25163
to top
>emb|AL590236.8| Human DNA sequence from clone RP11-145I17 on chromosome Xq21.1-21.33,
             complete sequence
          Length = 79387

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 41    cacttaacataatgacttcta 61
             |||||||||||||||||||||
Sbjct: 46507 cacttaacataatgacttcta 46487
to top
>emb|AL365254.14| Human DNA sequence from clone RP11-420H21 on chromosome 1, complete
             sequence
          Length = 157721

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 41    cacttaacataatgacttcta 61
             |||||||||||||||||||||
Sbjct: 37343 cacttaacataatgacttcta 37323
to top
>emb|AL354995.13| Human DNA sequence from clone RP11-512J14 on chromosome 13 Contains the
              3' end of the DACH gene for dachshund homolog (Drosophila)
              (DACH1, FLJ10138), complete sequence
          Length = 149582

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 162    aatttcagttatggttggatt 182
              |||||||||||||||||||||
Sbjct: 147093 aatttcagttatggttggatt 147113
to top
>emb|AL034369.1|HSA149D17 Human DNA sequence from clone RP6-149D17 on chromosome Xq22.2-23
             Contains the gene for a novel protein similar to
             pancreatic lipase-related protein 2 (PNLIPRP2), the 5' end
             of the COL4A6 gene for type IV alpha 6 collagen and the 5'
             end of the COL4A5 gene for type IV alpha 5 collagen
             (Alport syndrome), complete sequence
          Length = 122157

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 41    cacttaacataatgacttcta 61
             |||||||||||||||||||||
Sbjct: 95717 cacttaacataatgacttcta 95737
to top
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 342     ccttgggcatttccaggtact 362
               |||||||||||||||||||||
Sbjct: 2595428 ccttgggcatttccaggtact 2595448
to top
>gb|AC040977.10| Homo sapiens chromosome 17, clone RP11-589P10, complete sequence
          Length = 174741

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 41    cacttaacataatgacttcta 61
             |||||||||||||||||||||
Sbjct: 55366 cacttaacataatgacttcta 55346
to top
>gb|AC026182.4| Homo sapiens chromosome 3 clone RP11-279B12 map 3p, complete sequence
          Length = 167179

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 219   gacattccaccaaaaacaatgtgag 243
             |||||| ||||||||||||||||||
Sbjct: 38385 gacatttcaccaaaaacaatgtgag 38361
to top
>gb|AC027763.9| Homo sapiens chromosome 17, clone RP11-530N7, complete sequence
          Length = 169770

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 41    cacttaacataatgacttcta 61
             |||||||||||||||||||||
Sbjct: 48599 cacttaacataatgacttcta 48619
to top
>gb|AC004977.2|AC004977 Homo sapiens PAC clone RP5-1152C17 from 7, complete sequence
          Length = 106473

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 373   tctttttgctgaaataattca 393
             |||||||||||||||||||||
Sbjct: 70422 tctttttgctgaaataattca 70442
to top
>gb|AC018833.3|AC018833 Homo sapiens chromosome 3 clone RP11-497I24, complete sequence
          Length = 145976

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 219   gacattccaccaaaaacaatgtgag 243
             |||||| ||||||||||||||||||
Sbjct: 16249 gacatttcaccaaaaacaatgtgag 16273
to top
>gb|AE003703.3| Drosophila melanogaster chromosome 3R, section 41 of 118 of the
             complete sequence
          Length = 223948

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 262   ctagaatcataaagtcggtca 282
             |||||||||||||||||||||
Sbjct: 22427 ctagaatcataaagtcggtca 22447
to top
>gb|AC132239.4| Mus musculus BAC clone RP24-534D4 from 13, complete sequence
          Length = 163009

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 74     gctgtgcctgtagcaaggaacactg 98
              |||||||||||||||||| ||||||
Sbjct: 143997 gctgtgcctgtagcaaggcacactg 143973
to top
>gb|AC129597.5| Mus musculus BAC clone RP23-262I17 from 13, complete sequence
          Length = 195537

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 74   gctgtgcctgtagcaaggaacactg 98
            |||||||||||||||||| ||||||
Sbjct: 1995 gctgtgcctgtagcaaggcacactg 1971
to top
>gb|AC026214.4| Homo sapiens chromosome 3 clone RP11-717M12 map 3p, complete sequence
          Length = 174645

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 219    gacattccaccaaaaacaatgtgag 243
              |||||| ||||||||||||||||||
Sbjct: 135931 gacatttcaccaaaaacaatgtgag 135907
to top
>gb|AC169801.2| Rhesus Macaque  BAC CH250-205G14 (Children's Hospital Oakland Research
             Institute Rhesus macaque Adult Male BAC Library) complete
             sequence
          Length = 168949

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 42    acttaacataatgacttcta 61
             ||||||||||||||||||||
Sbjct: 94583 acttaacataatgacttcta 94564
to top
>gb|AC132619.3| Mus musculus BAC clone RP23-195N4 from chromosome 7, complete sequence
          Length = 193890

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 369    ttagtctttttgctgaaata 388
              ||||||||||||||||||||
Sbjct: 109200 ttagtctttttgctgaaata 109219
to top
>gb|AC111131.8| Mus musculus, clone RP23-340N7, complete sequence
          Length = 202386

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 333   aaatccaagccttgggcatt 352
             ||||||||||||||||||||
Sbjct: 94729 aaatccaagccttgggcatt 94710
to top
>emb|AL671969.39| Mouse DNA sequence from clone RP23-339O7 on chromosome 11 Contains part
             of a novel gene and the Nmu2r gene for neuromedin U
             receptor 2, complete sequence
          Length = 118473

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 328   tcaataaatccaagccttgg 347
             ||||||||||||||||||||
Sbjct: 61671 tcaataaatccaagccttgg 61652
to top
>emb|CR352230.8| Zebrafish DNA sequence from clone CH211-106G8 in linkage group 2,
              complete sequence
          Length = 168916

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 124    gtaatctctgattatgtttg 143
              ||||||||||||||||||||
Sbjct: 124010 gtaatctctgattatgtttg 123991
to top
>gb|AC011266.8| Homo sapiens chromosome 18, clone RP11-5A1, complete sequence
          Length = 167191

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 280   tcaatttgactatcacagca 299
             ||||||||||||||||||||
Sbjct: 97797 tcaatttgactatcacagca 97816
to top
>gb|AC067819.10| Homo sapiens chromosome 18, clone RP11-585K6, complete sequence
          Length = 216972

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 40    ccacttaacataatgacttc 59
             ||||||||||||||||||||
Sbjct: 61746 ccacttaacataatgacttc 61765
to top
>gb|AC162947.2| Mus musculus BAC clone RP23-12D16 from chromosome 8, complete sequence
          Length = 230889

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 375    tttttgctgaaataattcac 394
              ||||||||||||||||||||
Sbjct: 129841 tttttgctgaaataattcac 129860
to top
>gb|AC162927.3| Mus musculus BAC clone RP23-269E12 from chromosome 9, complete sequence
          Length = 213948

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 374   ctttttgctgaaataattcacttc 397
             ||||||||| ||||||||||||||
Sbjct: 71247 ctttttgctcaaataattcacttc 71224
to top
>gb|AC116574.6| Mus musculus BAC clone RP23-234F20 from chromosome 12, complete sequence
          Length = 191808

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 219    gacattccaccaaaaacaat 238
              ||||||||||||||||||||
Sbjct: 156079 gacattccaccaaaaacaat 156060
to top
>gb|AC091491.3| Homo sapiens chromosome 3 clone RP11-15F1 map 3p, complete sequence
          Length = 152888

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 40    ccacttaacataatgacttc 59
             ||||||||||||||||||||
Sbjct: 48164 ccacttaacataatgacttc 48183
to top
>emb|BX005255.10| Mouse DNA sequence from clone RP23-228N14 on chromosome X, complete
             sequence
          Length = 230114

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 333   aaatccaagccttgggcatt 352
             ||||||||||||||||||||
Sbjct: 78572 aaatccaagccttgggcatt 78553
to top
>emb|CT485604.3| Pan troglodytes chromosome X clone PTB-004I10 map Xq28, complete
             sequence
          Length = 109609

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 41    cacttaacataatgacttct 60
             ||||||||||||||||||||
Sbjct: 72063 cacttaacataatgacttct 72082
to top
>gb|AC127086.4| Mus musculus BAC clone RP24-540I5 from 8, complete sequence
          Length = 161316

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 375    tttttgctgaaataattcac 394
              ||||||||||||||||||||
Sbjct: 132946 tttttgctgaaataattcac 132965
to top
>gb|AC147718.1| Gallus gallus BAC clone CH261-18A20 from chromosome unknown, complete
             sequence
          Length = 185989

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 256   gcattcctagaatcataaag 275
             ||||||||||||||||||||
Sbjct: 95783 gcattcctagaatcataaag 95802


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,343,496
Number of Sequences: 3902068
Number of extensions: 4343496
Number of successful extensions: 89785
Number of sequences better than 10.0: 41
Number of HSP's better than 10.0 without gapping: 41
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 89668
Number of HSP's gapped (non-prelim): 117
length of query: 462
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 440
effective length of database: 17,147,199,772
effective search space: 7544767899680
effective search space used: 7544767899680
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top