ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl30a06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY107171.1| Zea mays PCO069619 mRNA sequence 90 7e-15
2gb|AY104577.1| Zea mays PCO137756 mRNA sequence 82 2e-12
3dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 74 4e-10
4emb|AL928743.1|CNS08CBG Oryza sativa chromosome 12, . BAC OSJNBb... 74 4e-10
5gb|AF029256.2|AF029256 Kosteletzkya virginica KVATP1 plasma memb... 74 4e-10
6dbj|AK071252.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 4e-10
7dbj|AK067535.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 4e-10
8gb|AY103963.1| Zea mays PCO106203 mRNA sequence 74 4e-10
9gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 74 4e-10
10emb|AL732378.3|CNS08C91 Oryza sativa chromosome 12, . BAC OSJNBa... 74 4e-10
11emb|AL731762.2|CNS07YPW Oryza sativa chromosome 12, . BAC OJ1119... 74 4e-10
12emb|AJ440001.1|OSA440001 Oryza sativa (japonica cultivar-group) ... 72 2e-09
13gb|AC134344.2| Oryza sativa (japonica cultivar-group) chromosome... 70 7e-09
14gb|AC136224.2| Oryza sativa (japonica cultivar-group) chromosome... 70 7e-09
15emb|AJ440002.1|OSA440002 Oryza sativa (japonica cultivar-group) ... 70 7e-09
16gb|AF480431.1| Zea mays plasma membrane H+ ATPase-like gene, par... 70 7e-09
17gb|AF498616.1| Zea mays cultivar C_9 plasma membrane H+-transpor... 70 7e-09
18gb|AF498615.1| Zea mays cultivar D_9 plasma membrane H+-transpor... 70 7e-09
19gb|AF498614.1| Zea mays cultivar D_6 plasma membrane H+-transpor... 70 7e-09
20gb|AF498613.1| Zea mays cultivar F_1 plasma membrane H+-transpor... 70 7e-09
21gb|AF498612.1| Zea mays cultivar Mo17 plasma membrane H+-transpo... 70 7e-09
22gb|AF498611.1| Zea mays cultivar D_7 plasma membrane H+-transpor... 70 7e-09
23gb|AF498610.1| Zea mays cultivar TX601 plasma membrane H+-transp... 70 7e-09
24gb|AF498609.1| Zea mays cultivar B84 plasma membrane H+-transpor... 70 7e-09
25gb|AF498608.1| Zea mays cultivar DE811 plasma membrane H+-transp... 70 7e-09
26gb|AF498607.1| Zea mays cultivar 684 plasma membrane H+-transpor... 70 7e-09
27gb|AF498606.1| Zea mays cultivar D71-4HT plasma membrane H+-tran... 70 7e-09
28gb|AF498605.1| Zea mays cultivar H99 plasma membrane H+-transpor... 70 7e-09
29gb|AF498604.1| Zea mays cultivar IVANA plasma membrane H+-transp... 70 7e-09
30gb|AF498603.1| Zea mays cultivar CO109 plasma membrane H+-transp... 70 7e-09
31gb|AF498602.1| Zea mays cultivar I_1 plasma membrane H+-transpor... 70 7e-09
32gb|AF498601.1| Zea mays cultivar B73 plasma membrane H+-transpor... 70 7e-09
33gb|AF498600.1| Zea mays cultivar F_2 plasma membrane H+-transpor... 70 7e-09
34gb|AF498599.1| Zea mays cultivar G_1 plasma membrane H+-transpor... 70 7e-09
35gb|AF498598.1| Zea mays cultivar B_6 plasma membrane H+-transpor... 70 7e-09
36gb|AF498597.1| Zea mays cultivar H_4 plasma membrane H+-transpor... 70 7e-09
37gb|AF498596.1| Zea mays cultivar F_4 plasma membrane H+-transpor... 70 7e-09
38gb|AF498595.1| Zea mays cultivar F_3 plasma membrane H+-transpor... 70 7e-09
39gb|AF498594.1| Zea mays cultivar F_5 plasma membrane H+-transpor... 70 7e-09
40gb|AF498593.1| Zea mays cultivar H_5 plasma membrane H+-transpor... 70 7e-09
41gb|AF498592.1| Zea mays cultivar H_3 plasma membrane H+-transpor... 70 7e-09
42gb|AF498591.1| Zea mays cultivar J40 plasma membrane H+-transpor... 70 7e-09
43gb|AF498590.1| Zea mays cultivar 647 plasma membrane H+-transpor... 70 7e-09
44gb|AF498589.1| Zea mays cultivar B_1 plasma membrane H+-transpor... 70 7e-09
45gb|AF498588.1| Zea mays cultivar F_6 plasma membrane H+-transpor... 70 7e-09
46gb|AF498587.1| Zea mays cultivar C_5 plasma membrane H+-transpor... 70 7e-09
47gb|AF498586.1| Zea mays cultivar H_1 plasma membrane H+-transpor... 70 7e-09
48dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 70 7e-09
49emb|AJ441084.1|ZMA441084 Zea mays partial mRNA for proton-export... 70 7e-09
50dbj|AK100483.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 7e-09
51dbj|AK099106.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 7e-09
52dbj|AK069666.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 7e-09
53emb|AJ539534.1|ZMA539534 Zea mays partial mRNA for proton-export... 70 7e-09
54ref|XM_468274.1| Oryza sativa (japonica cultivar-group), mRNA 66 1e-07
55emb|AJ440217.1|OSA440217 Oryza sativa a6 gene for plasma membran... 66 1e-07
56dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 66 1e-07
57dbj|AP003975.3| Oryza sativa (japonica cultivar-group) genomic D... 66 1e-07
58gb|AY109425.1| Zea mays CL1965_1 mRNA sequence 62 2e-06
59dbj|AK121272.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 7e-06
60gb|AC097277.6| Oryza sativa chromosome 3 BAC OSJNBa0022C08 genom... 58 3e-05
61gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 58 3e-05
62gb|AY136627.1| Hordeum vulgare subsp. vulgare plasma membrane P-... 58 3e-05
63emb|AJ439999.1|OSA439999 Oryza sativa (japonica cultivar-group) ... 58 3e-05
64emb|AJ344078.1|HVU344078 Hordeum vulgare partial mRNA for plasma... 58 3e-05
65dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 58 3e-05
66dbj|D10207.1|RICOSA1 Oryza sativa OSA1 mRNA for H-ATPase, comple... 58 3e-05
67dbj|AK068765.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
68emb|X85805.1|ZMPMHATP Z.mays mRNA for plasma membrane H+ ATPase 54 4e-04
69gb|M60166.1|TOMLHA1 Tomato (L.esculentum) H+-ATPase (LHA1) mRNA,... 50 0.006
70ref|NM_126721.2| Arabidopsis thaliana ATPase AT2G07560 mRNA, com... 46 0.10
71emb|AL133340.27| Human DNA sequence from clone RP11-204H22 on ch... 46 0.10
72gb|AC007662.3| Arabidopsis thaliana chromosome 2 BAC F9A16 genom... 46 0.10
73dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.10
74gb|BT002855.1| Arabidopsis thaliana clone RAFL15-05-H02 (R20351)... 46 0.10
75dbj|AP005173.4| Oryza sativa (japonica cultivar-group) genomic D... 46 0.10
76dbj|AK121402.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.10
77dbj|AK072909.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.10
78dbj|D31843.1|RICOSA2 Oryza sativa (japonica cultivar-group) mRNA... 46 0.10
79ref|XM_476966.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.40
80gb|AY543630.1| Triticum aestivum plasma membrane H+-ATPase (ha1)... 44 0.40
81emb|AJ440000.1|OSA440000 Oryza sativa (japonica cultivar-group) ... 44 0.40
82gb|AF384148.1|AF384148 Triticum aestivum H+-ATPase mRNA, partial... 44 0.40
83dbj|D45189.1|ZMUZHA1 Zostera marina mRNA for putative plasma mem... 44 0.40
84gb|AY829002.2| Triticum aestivum plasma membrane H+-ATPase gene,... 42 1.6
85gb|AC117247.4| Mus musculus BAC clone RP24-323L24 from chromosom... 42 1.6
86gb|AC132270.3| Mus musculus BAC clone RP24-338C23 from chromosom... 42 1.6
87dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
88dbj|AP005249.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
89dbj|AP004657.2| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
90dbj|AK108449.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.6
91gb|AC171012.3| Gallus gallus BAC clone CH261-128I7 from chromoso... 42 1.6
92gb|AC153727.6| Mus musculus BAC clone RP23-354L15 from chromosom... 40 6.2
93gb|AC163041.3| Mus musculus BAC clone RP23-32K16 from chromosome... 40 6.2
94gb|AC156036.4| Mus musculus BAC clone RP23-341B16 from chromosom... 40 6.2
95gb|AC153140.5| Mus musculus BAC clone RP23-340P19 from chromosom... 40 6.2
96gb|AC156037.6| Mus musculus BAC clone RP23-138L1 from chromosome... 40 6.2
97gb|AC130830.3| Mus musculus BAC clone RP23-474G1 from chromosome... 40 6.2
98gb|AE009036.1| Agrobacterium tumefaciens str. C58 circular chrom... 40 6.2
99gb|AC153794.6| Mus musculus BAC clone RP23-128I24 from chromosom... 40 6.2
100gb|AC124739.2| Mus musculus BAC clone RP23-344H4 from chromosome... 40 6.2
101emb|CR450690.7| Zebrafish DNA sequence from clone CH211-78C14 in... 40 6.2
102gb|AC124601.5| Mus musculus BAC clone RP23-27M3 from chromosome ... 40 6.2
103gb|AC124530.4| Mus musculus BAC clone RP23-286D7 from chromosome... 40 6.2
104gb|AC124511.4| Mus musculus BAC clone RP23-440I16 from chromosom... 40 6.2
105gb|AC165350.3| Mus musculus BAC clone RP23-249A17 from chromosom... 40 6.2
106gb|AC153662.6| Mus musculus BAC clone RP23-24I10 from chromosome... 40 6.2
107emb|AJ222786.1|HVJ222786 Hordeum vulgare mRNA for H(+)-transport... 40 6.2
108gb|AC140930.3| Mus musculus BAC clone RP23-116P20 from chromosom... 40 6.2
109gb|AC112657.2| Homo sapiens X BAC RP11-647I17 (Roswell Park Canc... 40 6.2
110gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome 40 6.2
111gb|AC122327.5| Mus musculus BAC clone RP23-339D20 from chromosom... 40 6.2
112gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome 40 6.2
113gb|AC132472.3| Mus musculus BAC clone RP23-113B13 from chromosom... 40 6.2
114dbj|AB042103.1| Asparagus officinalis AoPOX1 mRNA for peroxidase... 40 6.2
115emb|BX571709.23| Zebrafish DNA sequence from clone DKEY-251M8 in... 40 6.2
116gb|AC134462.5| Mus musculus BAC clone RP23-391L12 from chromosom... 40 6.2
117gb|AC134917.5| Mus musculus BAC clone RP23-64B3 from chromosome ... 40 6.2
118gb|AC158366.5| Mus musculus BAC clone RP23-33N12 from chromosome... 40 6.2
119emb|CT030157.8| Mouse DNA sequence from clone RP24-316P8 on chro... 40 6.2
120gb|AC134254.3| Mus musculus BAC clone RP23-474M18 from 12, compl... 40 6.2
121gb|AC127242.3| Mus musculus BAC clone RP24-404P19 from 12, compl... 40 6.2
122emb|CT030250.3| Mouse DNA sequence from clone RP23-285E4 on chro... 40 6.2
123gb|AC124772.4| Mus musculus BAC clone RP23-47P3 from 12, complet... 40 6.2
124gb|AC126045.3| Mus musculus BAC clone RP23-71I22 from 12, comple... 40 6.2
125gb|AC134601.4| Mus musculus BAC clone RP23-242M10 from 12, compl... 40 6.2
126gb|AC130824.4| Mus musculus BAC clone RP23-349B5 from 12, comple... 40 6.2
127gb|AC122351.5| Mus musculus BAC clone RP23-388H1 from 12, comple... 40 6.2
128gb|AC130829.4| Mus musculus BAC clone RP23-451I11 from 12, compl... 40 6.2
129gb|AC164424.5| Mus musculus BAC clone RP23-151N21 from chromosom... 40 6.2
130gb|AC163633.4| Mus musculus BAC clone RP24-177N8 from chromosome... 40 6.2
131gb|AC163634.4| Mus musculus BAC clone RP23-152O2 from chromosome... 40 6.2

>gb|AY107171.1| Zea mays PCO069619 mRNA sequence
          Length = 1102

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 381 gtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacg 440
           |||||||||||||||||||||||||||||||| ||||| ||||| || || |||||||| 
Sbjct: 854 gtgtaggactgctggatggtctcgatgtcgagtcccttcagcttcacaacagactccaca 795

                                
Query: 441 tgccctttgagcgtatgaagc 461
           ||||| ||||| || ||||||
Sbjct: 794 tgccccttgagtgtgtgaagc 774



to top

>gb|AY104577.1| Zea mays PCO137756 mRNA sequence
          Length = 1308

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                        
Query: 378  acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 437
            |||||||||  |||||| ||||| || |||||||| ||||||||||||||||||||||| 
Sbjct: 1231 acggtgtagctctgctgaatggtgtcaatgtcgaggcccttgagcttgacgacggactcg 1172

                             
Query: 438  acgtgccctttgagcgt 454
            ||||| || ||||||||
Sbjct: 1171 acgtgtcccttgagcgt 1155



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 73/85 (85%)
 Strand = Plus / Minus

                                                                            
Query: 373      atcagacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgg 432
                |||| |||||||| ||||||||||||||||| |||||||| || |||||||| || || |
Sbjct: 27429483 atcacacggtgtaagactgctggatggtctcaatgtcgaggcctttgagcttcacaaccg 27429424

                                         
Query: 433      actccacgtgccctttgagcgtatg 457
                | || || ||||| |||||||||||
Sbjct: 27429423 attctacatgccccttgagcgtatg 27429399



to top

>emb|AL928743.1|CNS08CBG Oryza sativa chromosome 12, . BAC OSJNBb0011N16 of library OSJNBb from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 55237

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 73/85 (85%)
 Strand = Plus / Plus

                                                                         
Query: 373   atcagacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgg 432
             |||| |||||||| ||||||||||||||||| |||||||| || |||||||| || || |
Sbjct: 52335 atcacacggtgtaagactgctggatggtctcaatgtcgaggcctttgagcttcacaaccg 52394

                                      
Query: 433   actccacgtgccctttgagcgtatg 457
             | || || ||||| |||||||||||
Sbjct: 52395 attctacatgccccttgagcgtatg 52419



to top

>gb|AF029256.2|AF029256 Kosteletzkya virginica KVATP1 plasma membrane proton ATPase (ATP1)
            mRNA, complete cds
          Length = 3175

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 389  ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
            ||||||||| || |||||||| || ||||| ||||| ||||| ||||| ||||| |||||
Sbjct: 2872 ctgctggatcgtatcgatgtccagccccttcagctttacgacagactcgacgtgaccttt 2813

                         
Query: 449  gagcgtatgaagc 461
            |||||||||||||
Sbjct: 2812 gagcgtatgaagc 2800



to top

>dbj|AK071252.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023088D22, full
            insert sequence
          Length = 1702

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 73/85 (85%)
 Strand = Plus / Minus

                                                                        
Query: 373  atcagacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgg 432
            |||| |||||||| ||||||||||||||||| |||||||| || |||||||| || || |
Sbjct: 1287 atcacacggtgtaagactgctggatggtctcaatgtcgaggcctttgagcttcacaaccg 1228

                                     
Query: 433  actccacgtgccctttgagcgtatg 457
            | || || ||||| |||||||||||
Sbjct: 1227 attctacatgccccttgagcgtatg 1203



to top

>dbj|AK067535.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013109J17, full
            insert sequence
          Length = 3286

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 73/85 (85%)
 Strand = Plus / Minus

                                                                        
Query: 373  atcagacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgg 432
            |||| |||||||| ||||||||||||||||| |||||||| || |||||||| || || |
Sbjct: 2929 atcacacggtgtaagactgctggatggtctcaatgtcgaggcctttgagcttcacaaccg 2870

                                     
Query: 433  actccacgtgccctttgagcgtatg 457
            | || || ||||| |||||||||||
Sbjct: 2869 attctacatgccccttgagcgtatg 2845



to top

>gb|AY103963.1| Zea mays PCO106203 mRNA sequence
          Length = 1358

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 40/41 (97%)
 Strand = Plus / Minus

                                                    
Query: 378 acggtgtaggactgctggatggtctcgatgtcgagaccctt 418
           |||||||||||||||||||||||||||||||| ||||||||
Sbjct: 971 acggtgtaggactgctggatggtctcgatgtccagaccctt 931



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 73/85 (85%)
 Strand = Plus / Minus

                                                                            
Query: 373      atcagacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgg 432
                |||| |||||||| ||||||||||||||||| |||||||| || |||||||| || || |
Sbjct: 27355083 atcacacggtgtaagactgctggatggtctcaatgtcgaggcctttgagcttcacaaccg 27355024

                                         
Query: 433      actccacgtgccctttgagcgtatg 457
                | || || ||||| |||||||||||
Sbjct: 27355023 attctacatgccccttgagcgtatg 27354999



to top

>emb|AL732378.3|CNS08C91 Oryza sativa chromosome 12, . BAC OSJNBa0063N15 of library OSJNBa
            from chromosome 12 of cultivar Nipponbare of ssp.
            japonica of Oryza sativa (rice), complete sequence
          Length = 109222

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 73/85 (85%)
 Strand = Plus / Minus

                                                                        
Query: 373  atcagacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgg 432
            |||| |||||||| ||||||||||||||||| |||||||| || |||||||| || || |
Sbjct: 5397 atcacacggtgtaagactgctggatggtctcaatgtcgaggcctttgagcttcacaaccg 5338

                                     
Query: 433  actccacgtgccctttgagcgtatg 457
            | || || ||||| |||||||||||
Sbjct: 5337 attctacatgccccttgagcgtatg 5313



to top

>emb|AL731762.2|CNS07YPW Oryza sativa chromosome 12, . BAC OJ1119_E02 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 124605

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 73/85 (85%)
 Strand = Plus / Minus

                                                                         
Query: 373   atcagacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgg 432
             |||| |||||||| ||||||||||||||||| |||||||| || |||||||| || || |
Sbjct: 97803 atcacacggtgtaagactgctggatggtctcaatgtcgaggcctttgagcttcacaaccg 97744

                                      
Query: 433   actccacgtgccctttgagcgtatg 457
             | || || ||||| |||||||||||
Sbjct: 97743 attctacatgccccttgagcgtatg 97719



to top

>emb|AJ440001.1|OSA440001 Oryza sativa (japonica cultivar-group) a3 gene for plasma membrane H+
            ATPase, exons 1-21
          Length = 6072

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                        
Query: 378  acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 437
            |||||||| ||||||||||||||||| |||||||| || |||||||| || || || || 
Sbjct: 6068 acggtgtaagactgctggatggtctcaatgtcgaggcctttgagcttcacaaccgattct 6009

                                
Query: 438  acgtgccctttgagcgtatg 457
            || ||||| |||||||||||
Sbjct: 6008 acatgccccttgagcgtatg 5989



to top

>gb|AC134344.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0059K16,
              complete sequence
          Length = 139615

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 68/79 (86%)
 Strand = Plus / Plus

                                                                          
Query: 376    agacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggact 435
              |||||||||||   | ||||||||| ||||||||||| |||||||||||||| || ||||
Sbjct: 131563 agacggtgtagtggttctggatggtgtcgatgtcgaggcccttgagcttgaccaccgact 131622

                                 
Query: 436    ccacgtgccctttgagcgt 454
              | ||||| || ||||||||
Sbjct: 131623 cgacgtggcccttgagcgt 131641



to top

>gb|AC136224.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0006B22, complete sequence
          Length = 166052

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 68/79 (86%)
 Strand = Plus / Plus

                                                                         
Query: 376   agacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggact 435
             |||||||||||   | ||||||||| ||||||||||| |||||||||||||| || ||||
Sbjct: 50683 agacggtgtagtggttctggatggtgtcgatgtcgaggcccttgagcttgaccaccgact 50742

                                
Query: 436   ccacgtgccctttgagcgt 454
             | ||||| || ||||||||
Sbjct: 50743 cgacgtggcccttgagcgt 50761



to top

>emb|AJ440002.1|OSA440002 Oryza sativa (japonica cultivar-group) a4 gene for plasma membrane H+
            ATPase, exons 1-12
          Length = 3894

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 68/79 (86%)
 Strand = Plus / Minus

                                                                        
Query: 376  agacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggact 435
            |||||||||||   | ||||||||| ||||||||||| |||||||||||||| || ||||
Sbjct: 3892 agacggtgtagtggttctggatggtgtcgatgtcgaggcccttgagcttgaccaccgact 3833

                               
Query: 436  ccacgtgccctttgagcgt 454
            | ||||| || ||||||||
Sbjct: 3832 cgacgtggcccttgagcgt 3814



to top

>gb|AF480431.1| Zea mays plasma membrane H+ ATPase-like gene, partial sequence
          Length = 6539

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                        
Query: 389  ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
            |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 2510 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 2569

               
Query: 449  gag 451
            |||
Sbjct: 2570 gag 2572



to top

>gb|AF498616.1| Zea mays cultivar C_9 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 408

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 138 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 79

              
Query: 449 gag 451
           |||
Sbjct: 78  gag 76



to top

>gb|AF498615.1| Zea mays cultivar D_9 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 413

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84

              
Query: 449 gag 451
           |||
Sbjct: 83  gag 81



to top

>gb|AF498614.1| Zea mays cultivar D_6 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 413

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84

              
Query: 449 gag 451
           |||
Sbjct: 83  gag 81



to top

>gb|AF498613.1| Zea mays cultivar F_1 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 413

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84

              
Query: 449 gag 451
           |||
Sbjct: 83  gag 81



to top

>gb|AF498612.1| Zea mays cultivar Mo17 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 413

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtgaccctt 84

              
Query: 449 gag 451
           |||
Sbjct: 83  gag 81



to top

>gb|AF498611.1| Zea mays cultivar D_7 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 410

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 140 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 81

              
Query: 449 gag 451
           |||
Sbjct: 80  gag 78



to top

>gb|AF498610.1| Zea mays cultivar TX601 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 395

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 138 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtgaccctt 79

              
Query: 449 gag 451
           |||
Sbjct: 78  gag 76



to top

>gb|AF498609.1| Zea mays cultivar B84 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 413

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84

              
Query: 449 gag 451
           |||
Sbjct: 83  gag 81



to top

>gb|AF498608.1| Zea mays cultivar DE811 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 413

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84

              
Query: 449 gag 451
           |||
Sbjct: 83  gag 81



to top

>gb|AF498607.1| Zea mays cultivar 684 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 413

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84

              
Query: 449 gag 451
           |||
Sbjct: 83  gag 81



to top

>gb|AF498606.1| Zea mays cultivar D71-4HT plasma membrane H+-transporting
           ATPase-like protein gene, 3'UTR and partial cds
          Length = 413

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84

              
Query: 449 gag 451
           |||
Sbjct: 83  gag 81



to top

>gb|AF498605.1| Zea mays cultivar H99 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 264

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 140 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 81

              
Query: 449 gag 451
           |||
Sbjct: 80  gag 78



to top

>gb|AF498604.1| Zea mays cultivar IVANA plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 414

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 144 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 85

              
Query: 449 gag 451
           |||
Sbjct: 84  gag 82



to top

>gb|AF498603.1| Zea mays cultivar CO109 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 412

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 142 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 83

              
Query: 449 gag 451
           |||
Sbjct: 82  gag 80



to top

>gb|AF498602.1| Zea mays cultivar I_1 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 413

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84

              
Query: 449 gag 451
           |||
Sbjct: 83  gag 81



to top

>gb|AF498601.1| Zea mays cultivar B73 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 335

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 141 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 82

              
Query: 449 gag 451
           |||
Sbjct: 81  gag 79



to top

>gb|AF498600.1| Zea mays cultivar F_2 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 411

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 141 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 82

              
Query: 449 gag 451
           |||
Sbjct: 81  gag 79



to top

>gb|AF498599.1| Zea mays cultivar G_1 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 406

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtgaccctt 84

              
Query: 449 gag 451
           |||
Sbjct: 83  gag 81



to top

>gb|AF498598.1| Zea mays cultivar B_6 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 413

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84

              
Query: 449 gag 451
           |||
Sbjct: 83  gag 81



to top

>gb|AF498597.1| Zea mays cultivar H_4 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 412

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 140 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 81

              
Query: 449 gag 451
           |||
Sbjct: 80  gag 78



to top

>gb|AF498596.1| Zea mays cultivar F_4 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 413

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84

              
Query: 449 gag 451
           |||
Sbjct: 83  gag 81



to top

>gb|AF498595.1| Zea mays cultivar F_3 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 410

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 140 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 81

              
Query: 449 gag 451
           |||
Sbjct: 80  gag 78



to top

>gb|AF498594.1| Zea mays cultivar F_5 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 413

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84

              
Query: 449 gag 451
           |||
Sbjct: 83  gag 81



to top

>gb|AF498593.1| Zea mays cultivar H_5 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 413

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84

              
Query: 449 gag 451
           |||
Sbjct: 83  gag 81



to top

>gb|AF498592.1| Zea mays cultivar H_3 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 413

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84

              
Query: 449 gag 451
           |||
Sbjct: 83  gag 81



to top

>gb|AF498591.1| Zea mays cultivar J40 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 397

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtgaccctt 84

              
Query: 449 gag 451
           |||
Sbjct: 83  gag 81



to top

>gb|AF498590.1| Zea mays cultivar 647 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 413

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84

              
Query: 449 gag 451
           |||
Sbjct: 83  gag 81



to top

>gb|AF498589.1| Zea mays cultivar B_1 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 413

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84

              
Query: 449 gag 451
           |||
Sbjct: 83  gag 81



to top

>gb|AF498588.1| Zea mays cultivar F_6 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 413

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84

              
Query: 449 gag 451
           |||
Sbjct: 83  gag 81



to top

>gb|AF498587.1| Zea mays cultivar C_5 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 413

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 143 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 84

              
Query: 449 gag 451
           |||
Sbjct: 83  gag 81



to top

>gb|AF498586.1| Zea mays cultivar H_1 plasma membrane H+-transporting ATPase-like
           protein gene, 3'UTR and partial cds
          Length = 404

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 141 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtgaccctt 82

              
Query: 449 gag 451
           |||
Sbjct: 81  gag 79



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 68/79 (86%)
 Strand = Plus / Plus

                                                                            
Query: 376      agacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggact 435
                |||||||||||   | ||||||||| ||||||||||| |||||||||||||| || ||||
Sbjct: 14715269 agacggtgtagtggttctggatggtgtcgatgtcgaggcccttgagcttgaccaccgact 14715328

                                   
Query: 436      ccacgtgccctttgagcgt 454
                | ||||| || ||||||||
Sbjct: 14715329 cgacgtggcccttgagcgt 14715347



to top

>emb|AJ441084.1|ZMA441084 Zea mays partial mRNA for proton-exporting ATPase (mha3 gene)
          Length = 1259

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 924 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 865

              
Query: 449 gag 451
           |||
Sbjct: 864 gag 862



to top

>dbj|AK100483.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023097B04, full
            insert sequence
          Length = 3538

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                        
Query: 392  ctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgag 451
            ||||||||| ||||||||||| |||||||||||||| || ||||| ||||| || |||||
Sbjct: 3135 ctggatggtgtcgatgtcgaggcccttgagcttgaccaccgactcgacgtggcccttgag 3076

               
Query: 452  cgt 454
            |||
Sbjct: 3075 cgt 3073



to top

>dbj|AK099106.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023028O04, full
            insert sequence
          Length = 1472

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                        
Query: 392  ctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgag 451
            ||||||||| ||||||||||| |||||||||||||| || ||||| ||||| || |||||
Sbjct: 1187 ctggatggtgtcgatgtcgaggcccttgagcttgaccaccgactcgacgtggcccttgag 1128

               
Query: 452  cgt 454
            |||
Sbjct: 1127 cgt 1125



to top

>dbj|AK069666.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023028O05, full
            insert sequence
          Length = 1472

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                        
Query: 392  ctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgag 451
            ||||||||| ||||||||||| |||||||||||||| || ||||| ||||| || |||||
Sbjct: 1187 ctggatggtgtcgatgtcgaggcccttgagcttgaccaccgactcgacgtggcccttgag 1128

               
Query: 452  cgt 454
            |||
Sbjct: 1127 cgt 1125



to top

>emb|AJ539534.1|ZMA539534 Zea mays partial mRNA for proton-exporting ATPase (mha4 gene)
          Length = 1359

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
           |||||||||||| |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 924 ctgctggatggtgtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 865

              
Query: 449 gag 451
           |||
Sbjct: 864 gag 862



to top

>ref|XM_468274.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2853

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                        
Query: 378  acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 437
            |||||||||  ||| ||||| || ||||||||||| ||||||||||| || || ||||| 
Sbjct: 2849 acggtgtagctctgttggattgtgtcgatgtcgagccccttgagcttcaccaccgactct 2790

                             
Query: 438  acgtgccctttgagcgt 454
            |||||||| ||||||||
Sbjct: 2789 acgtgccccttgagcgt 2773



to top

>emb|AJ440217.1|OSA440217 Oryza sativa a6 gene for plasma membrane H+-ATPase
          Length = 4058

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                        
Query: 378  acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 437
            |||||||||  ||| ||||| || ||||||||||| ||||||||||| || || ||||| 
Sbjct: 4054 acggtgtagctctgttggattgtgtcgatgtcgagccccttgagcttcaccaccgactct 3995

                             
Query: 438  acgtgccctttgagcgt 454
            |||||||| ||||||||
Sbjct: 3994 acgtgccccttgagcgt 3978



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                            
Query: 378      acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 437
                |||||||||  ||| ||||| || ||||||||||| ||||||||||| || || ||||| 
Sbjct: 33954341 acggtgtagctctgttggattgtgtcgatgtcgagccccttgagcttcaccaccgactct 33954282

                                 
Query: 438      acgtgccctttgagcgt 454
                |||||||| ||||||||
Sbjct: 33954281 acgtgccccttgagcgt 33954265



to top

>dbj|AP003975.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1004_E04
          Length = 133621

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                          
Query: 378    acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 437
              |||||||||  ||| ||||| || ||||||||||| ||||||||||| || || ||||| 
Sbjct: 113304 acggtgtagctctgttggattgtgtcgatgtcgagccccttgagcttcaccaccgactct 113245

                               
Query: 438    acgtgccctttgagcgt 454
              |||||||| ||||||||
Sbjct: 113244 acgtgccccttgagcgt 113228



to top

>gb|AY109425.1| Zea mays CL1965_1 mRNA sequence
          Length = 3431

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                        
Query: 389  ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
            |||||||||||  |||||||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 3046 ctgctggatggggtcgatgtccaggcccttgagcttgaccaccgactccacgtggccctt 2987

               
Query: 449  gag 451
            |||
Sbjct: 2986 gag 2984



to top

>dbj|AK121272.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023107A16, full
            insert sequence
          Length = 3134

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                        
Query: 393  tggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgagc 452
            ||||| || ||||||||||| ||||||||||| || || ||||| |||||||| ||||||
Sbjct: 2811 tggattgtgtcgatgtcgagccccttgagcttcaccaccgactctacgtgccccttgagc 2752

              
Query: 453  gt 454
            ||
Sbjct: 2751 gt 2750



to top

>gb|AC097277.6| Oryza sativa chromosome 3 BAC OSJNBa0022C08 genomic sequence, complete
             sequence
          Length = 150155

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Plus

                                                                         
Query: 381   gtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacg 440
             ||||||||||| || ||||| || ||||| || ||||| ||||| || || |||||||| 
Sbjct: 78620 gtgtaggactggtgaatggtatcaatgtccaggcccttcagcttcacaactgactccaca 78679

                                  
Query: 441   tgccctttgagcgtatgaagc 461
             ||||| || ||||||||||||
Sbjct: 78680 tgccccttcagcgtatgaagc 78700



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                            
Query: 381      gtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacg 440
                ||||||||||| || ||||| || ||||| || ||||| ||||| || || |||||||| 
Sbjct: 27225775 gtgtaggactggtgaatggtatcaatgtccaggcccttcagcttcacaactgactccaca 27225716

                                     
Query: 441      tgccctttgagcgtatgaagc 461
                ||||| || ||||||||||||
Sbjct: 27225715 tgccccttcagcgtatgaagc 27225695



to top

>gb|AY136627.1| Hordeum vulgare subsp. vulgare plasma membrane P-type proton pump
            ATPase (Ha1) mRNA, complete cds
          Length = 3446

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 395  gatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgag 451
            |||||| |||||||| || ||||||||||| || |||||||| |||||||| |||||
Sbjct: 3031 gatggtgtcgatgtcaaggcccttgagcttcaccacggactcaacgtgccccttgag 2975



to top

>emb|AJ439999.1|OSA439999 Oryza sativa (japonica cultivar-group) a1 gene for plasma membrane H+
            ATPase, exons 1-21
          Length = 6701

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                        
Query: 381  gtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacg 440
            ||||||||||| || ||||| || ||||| || ||||| ||||| || || |||||||| 
Sbjct: 6694 gtgtaggactggtgaatggtatcaatgtccaggcccttcagcttcacaactgactccaca 6635

                                 
Query: 441  tgccctttgagcgtatgaagc 461
            ||||| || ||||||||||||
Sbjct: 6634 tgccccttcagcgtatgaagc 6614



to top

>emb|AJ344078.1|HVU344078 Hordeum vulgare partial mRNA for plasma membrane H+-ATPase (ha1 gene)
          Length = 2280

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 395  gatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgccctttgag 451
            |||||| |||||||| || ||||||||||| || |||||||| |||||||| |||||
Sbjct: 1888 gatggtgtcgatgtcaaggcccttgagcttcaccacggactcaacgtgccccttgag 1832



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                            
Query: 381      gtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacg 440
                ||||||||||| || ||||| || ||||| || ||||| ||||| || || |||||||| 
Sbjct: 27317098 gtgtaggactggtgaatggtatcaatgtccaggcccttcagcttcacaactgactccaca 27317039

                                     
Query: 441      tgccctttgagcgtatgaagc 461
                ||||| || ||||||||||||
Sbjct: 27317038 tgccccttcagcgtatgaagc 27317018



to top

>dbj|D10207.1|RICOSA1 Oryza sativa OSA1 mRNA for H-ATPase, complete cds
          Length = 3053

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                        
Query: 381  gtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacg 440
            ||||||||||| || ||||| || ||||| || ||||| ||||| || || |||||||| 
Sbjct: 2894 gtgtaggactggtgaatggtatcaatgtccaggcccttcagcttcacaactgactccaca 2835

                                 
Query: 441  tgccctttgagcgtatgaagc 461
            ||||| || ||||||||||||
Sbjct: 2834 tgccccttcagcgtatgaagc 2814



to top

>dbj|AK068765.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013162E15, full
            insert sequence
          Length = 3307

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                        
Query: 381  gtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacg 440
            ||||||||||| || ||||| || ||||| || ||||| ||||| || || |||||||| 
Sbjct: 3143 gtgtaggactggtgaatggtatcaatgtccaggcccttcagcttcacaactgactccaca 3084

                                 
Query: 441  tgccctttgagcgtatgaagc 461
            ||||| || ||||||||||||
Sbjct: 3083 tgccccttcagcgtatgaagc 3063



to top

>emb|X85805.1|ZMPMHATP Z.mays mRNA for plasma membrane H+ ATPase
          Length = 3369

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                        
Query: 389  ctgctggatggtctcgatgtcgagacccttgagcttgacgacggactccacgtgcccttt 448
            |||||||||||| |||||||| || |||||||||||  | || ||||||||||| || ||
Sbjct: 3037 ctgctggatggtgtcgatgtccaggcccttgagcttagccaccgactccacgtggccctt 2978

               
Query: 449  gag 451
            |||
Sbjct: 2977 gag 2975



to top

>gb|M60166.1|TOMLHA1 Tomato (L.esculentum) H+-ATPase (LHA1) mRNA, complete cds
          Length = 3229

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 378  acggtgtaggactgctggatggtctcgatgtcgagaccctt 418
            |||||||| |||||||| || ||||| ||||||||||||||
Sbjct: 2987 acggtgtatgactgctgaattgtctcaatgtcgagaccctt 2947



to top

>ref|NM_126721.2| Arabidopsis thaliana ATPase AT2G07560 mRNA, complete cds
          Length = 3332

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 405  atgtcgagacccttgagcttgacgacggactccacgtgccctttgag 451
            ||||| |||||||||||||| || || ||||| ||||| ||||||||
Sbjct: 2879 atgtcaagacccttgagcttcactaccgactcaacgtggcctttgag 2833



to top

>emb|AL133340.27| Human DNA sequence from clone RP11-204H22 on chromosome 20 Contains part
              of a novel gene, ESTs, STSs and GSSs, complete sequence
          Length = 138442

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 108    aagctaaaaatgaaggggggaaa 130
              |||||||||||||||||||||||
Sbjct: 107233 aagctaaaaatgaaggggggaaa 107211



to top

>gb|AC007662.3| Arabidopsis thaliana chromosome 2 BAC F9A16 genomic sequence, complete
             sequence
          Length = 102249

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                            
Query: 405   atgtcgagacccttgagcttgacgacggactccacgtgccctttgag 451
             ||||| |||||||||||||| || || ||||| ||||| ||||||||
Sbjct: 43890 atgtcaagacccttgagcttcactaccgactcaacgtggcctttgag 43844



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
               sequence
          Length = 29644043

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                              
Query: 373     atcagacggtgtaggactgctggatggtctc 403
               |||| |||||||| |||||||||||||||||
Sbjct: 4952558 atcacacggtgtatgactgctggatggtctc 4952528



to top

>gb|BT002855.1| Arabidopsis thaliana clone RAFL15-05-H02 (R20351) putative plasma
           membrane proton ATPase (At2g07560) mRNA, partial cds
          Length = 1444

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 405 atgtcgagacccttgagcttgacgacggactccacgtgccctttgag 451
           ||||| |||||||||||||| || || ||||| ||||| ||||||||
Sbjct: 975 atgtcaagacccttgagcttcactaccgactcaacgtggcctttgag 929



to top

>dbj|AP005173.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OSJNBb0003E08
          Length = 161095

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                             
Query: 373    atcagacggtgtaggactgctggatggtctc 403
              |||| |||||||| |||||||||||||||||
Sbjct: 138042 atcacacggtgtatgactgctggatggtctc 138012



to top

>dbj|AK121402.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023131O20, full
            insert sequence
          Length = 3388

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 373  atcagacggtgtaggactgctggatggtctc 403
            |||| |||||||| |||||||||||||||||
Sbjct: 3006 atcacacggtgtatgactgctggatggtctc 2976



to top

>dbj|AK072909.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023148A19, full
            insert sequence
          Length = 2685

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 373  atcagacggtgtaggactgctggatggtctc 403
            |||| |||||||| |||||||||||||||||
Sbjct: 2439 atcacacggtgtatgactgctggatggtctc 2409



to top

>dbj|D31843.1|RICOSA2 Oryza sativa (japonica cultivar-group) mRNA for plasma membrane
            H+-ATPase, complete cds
          Length = 3264

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 373  atcagacggtgtaggactgctggatggtctc 403
            |||| |||||||| |||||||||||||||||
Sbjct: 3005 atcacacggtgtatgactgctggatggtctc 2975



to top

>ref|XM_476966.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2874

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 378  acggtgtaggactgctggatggtctc 403
            |||||||| |||||||||||||||||
Sbjct: 2870 acggtgtatgactgctggatggtctc 2845



to top

>gb|AY543630.1| Triticum aestivum plasma membrane H+-ATPase (ha1) mRNA, complete cds
          Length = 2856

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                        
Query: 378  acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 437
            |||||||||  ||| | |||||| |||||||| || ||||||||||| || ||||| || 
Sbjct: 2852 acggtgtagttctggttgatggtgtcgatgtcaaggcccttgagcttcaccacggattca 2793

                          
Query: 438  acgtgccctttgag 451
            ||||| || |||||
Sbjct: 2792 acgtggcccttgag 2779



to top

>emb|AJ440000.1|OSA440000 Oryza sativa (japonica cultivar-group) a2 gene for plasma membrane H+
            ATPase, exons 1-21
          Length = 5622

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 378  acggtgtaggactgctggatggtctc 403
            |||||||| |||||||||||||||||
Sbjct: 5618 acggtgtatgactgctggatggtctc 5593



to top

>gb|AF384148.1|AF384148 Triticum aestivum H+-ATPase mRNA, partial cds
          Length = 437

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                       
Query: 378 acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 437
           |||||||||  ||| | |||||| |||||||| || ||||||||||| || ||||| || 
Sbjct: 407 acggtgtagttctggttgatggtgtcgatgtcaaggcccttgagcttcaccacggattca 348

                         
Query: 438 acgtgccctttgag 451
           ||||| || |||||
Sbjct: 347 acgtggcccttgag 334



to top

>dbj|D45189.1|ZMUZHA1 Zostera marina mRNA for putative plasma membrane H+-ATPase, complete
            cds
          Length = 3250

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                        
Query: 378  acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 437
            |||||||||  |||||||||||| || ||||| ||||| || ||||| || || ||||||
Sbjct: 3002 acggtgtagttctgctggatggtttcaatgtcaagacctttaagcttcaccaccgactcc 2943

              
Query: 438  ac 439
            ||
Sbjct: 2942 ac 2941



to top

>gb|AY829002.2| Triticum aestivum plasma membrane H+-ATPase gene, promoter region and
            complete cds
          Length = 6132

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                        
Query: 378  acggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacggactcc 437
            |||||||||  ||| | |||||| |||||||| || ||||||||||| || ||||| || 
Sbjct: 6120 acggtgtagttctggttgatggtgtcgatgtcaaggcccttgagcttcaccacggattca 6061

                 
Query: 438  acgtg 442
            |||||
Sbjct: 6060 acgtg 6056



to top

>gb|AC117247.4| Mus musculus BAC clone RP24-323L24 from chromosome 5, complete
            sequence
          Length = 162677

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 126  ggaaacataatgtacatactg 146
            |||||||||||||||||||||
Sbjct: 5493 ggaaacataatgtacatactg 5513



to top

>gb|AC132270.3| Mus musculus BAC clone RP24-338C23 from chromosome 5, complete
            sequence
          Length = 145471

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 126  ggaaacataatgtacatactg 146
            |||||||||||||||||||||
Sbjct: 8193 ggaaacataatgtacatactg 8173



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                           
Query: 374     tcagacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgga 433
               |||||||||||||   ||||||| | | || |||||||| ||||||||| |||||  |||
Sbjct: 8607790 tcagacggtgtagtggtgctggacgttgtccatgtcgaggcccttgagcctgacggtgga 8607849

                    
Query: 434     ctcca 438
               |||||
Sbjct: 8607850 ctcca 8607854



to top

>dbj|AP005249.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OSJNBa0087F21
          Length = 187401

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                          
Query: 374    tcagacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgga 433
              |||||||||||||   ||||||| | | || |||||||| ||||||||| |||||  |||
Sbjct: 119701 tcagacggtgtagtggtgctggacgttgtccatgtcgaggcccttgagcctgacggtgga 119760

                   
Query: 434    ctcca 438
              |||||
Sbjct: 119761 ctcca 119765



to top

>dbj|AP004657.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0031C02
          Length = 138843

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                          
Query: 374    tcagacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgga 433
              |||||||||||||   ||||||| | | || |||||||| ||||||||| |||||  |||
Sbjct: 137333 tcagacggtgtagtggtgctggacgttgtccatgtcgaggcccttgagcctgacggtgga 137392

                   
Query: 434    ctcca 438
              |||||
Sbjct: 137393 ctcca 137397



to top

>dbj|AK108449.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-143-C07, full
            insert sequence
          Length = 1439

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                        
Query: 374  tcagacggtgtaggactgctggatggtctcgatgtcgagacccttgagcttgacgacgga 433
            |||||||||||||   ||||||| | | || |||||||| ||||||||| |||||  |||
Sbjct: 1051 tcagacggtgtagtggtgctggacgttgtccatgtcgaggcccttgagcctgacggtgga 992

                 
Query: 434  ctcca 438
            |||||
Sbjct: 991  ctcca 987



to top

>gb|AC171012.3| Gallus gallus BAC clone CH261-128I7 from chromosome ul, complete sequence
          Length = 231142

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 44     aagcagacaggccccaggaag 64
              |||||||||||||||||||||
Sbjct: 192065 aagcagacaggccccaggaag 192045



to top

>gb|AC153727.6| Mus musculus BAC clone RP23-354L15 from chromosome 12, complete sequence
          Length = 202733

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 41     tgaaagcagacaggccccag 60
              ||||||||||||||||||||
Sbjct: 182331 tgaaagcagacaggccccag 182312



to top

>gb|AC163041.3| Mus musculus BAC clone RP23-32K16 from chromosome 12, complete sequence
          Length = 254666

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 41     tgaaagcagacaggccccag 60
              ||||||||||||||||||||
Sbjct: 148505 tgaaagcagacaggccccag 148486



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 41    tgaaagcagacaggccccag 60
             ||||||||||||||||||||
Sbjct: 68011 tgaaagcagacaggccccag 67992



to top

>gb|AC156036.4| Mus musculus BAC clone RP23-341B16 from chromosome 12, complete sequence
          Length = 211424

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 41     tgaaagcagacaggccccag 60
              ||||||||||||||||||||
Sbjct: 119341 tgaaagcagacaggccccag 119360



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 41   tgaaagcagacaggccccag 60
            ||||||||||||||||||||
Sbjct: 5499 tgaaagcagacaggccccag 5518



to top

>gb|AC153140.5| Mus musculus BAC clone RP23-340P19 from chromosome 12, complete sequence
          Length = 241834

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 41     tgaaagcagacaggccccag 60
              ||||||||||||||||||||
Sbjct: 131294 tgaaagcagacaggccccag 131275



to top

>gb|AC156037.6| Mus musculus BAC clone RP23-138L1 from chromosome 12, complete sequence
          Length = 217016

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 41     tgaaagcagacaggccccag 60
              ||||||||||||||||||||
Sbjct: 197525 tgaaagcagacaggccccag 197506



to top

>gb|AC130830.3| Mus musculus BAC clone RP23-474G1 from chromosome 12, complete sequence
          Length = 199958

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 41     tgaaagcagacaggccccag 60
              ||||||||||||||||||||
Sbjct: 135298 tgaaagcagacaggccccag 135279



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 41    tgaaagcagacaggccccag 60
             ||||||||||||||||||||
Sbjct: 14879 tgaaagcagacaggccccag 14860



to top

>gb|AE009036.1| Agrobacterium tumefaciens str. C58 circular chromosome, section 62 of
            256 of the complete sequence
          Length = 10029

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 389  ctgctggatggtctcgatgtcgag 412
            |||||||| |||||||||||||||
Sbjct: 8243 ctgctggaaggtctcgatgtcgag 8266



to top

>gb|AC153794.6| Mus musculus BAC clone RP23-128I24 from chromosome 12, complete sequence
          Length = 208105

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 41     tgaaagcagacaggccccag 60
              ||||||||||||||||||||
Sbjct: 162430 tgaaagcagacaggccccag 162449



to top

>gb|AC124739.2| Mus musculus BAC clone RP23-344H4 from chromosome 12, complete sequence
          Length = 224632

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 41    tgaaagcagacaggccccag 60
             ||||||||||||||||||||
Sbjct: 31310 tgaaagcagacaggccccag 31329



to top

>emb|CR450690.7| Zebrafish DNA sequence from clone CH211-78C14 in linkage group 11,
              complete sequence
          Length = 163328

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 113    aaaaatgaaggggggaaaca 132
              ||||||||||||||||||||
Sbjct: 113061 aaaaatgaaggggggaaaca 113080



to top

>gb|AC124601.5| Mus musculus BAC clone RP23-27M3 from chromosome 12, complete sequence
          Length = 237876

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 41     tgaaagcagacaggccccag 60
              ||||||||||||||||||||
Sbjct: 152000 tgaaagcagacaggccccag 152019



to top

>gb|AC124530.4| Mus musculus BAC clone RP23-286D7 from chromosome 12, complete sequence
          Length = 174849

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 41     tgaaagcagacaggccccag 60
              ||||||||||||||||||||
Sbjct: 120896 tgaaagcagacaggccccag 120915



to top

>gb|AC124511.4| Mus musculus BAC clone RP23-440I16 from chromosome 12, complete
             sequence
          Length = 179914

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 41    tgaaagcagacaggccccag 60
             ||||||||||||||||||||
Sbjct: 25328 tgaaagcagacaggccccag 25347



to top

>gb|AC165350.3| Mus musculus BAC clone RP23-249A17 from chromosome 12, complete sequence
          Length = 227048

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 41     tgaaagcagacaggccccag 60
              ||||||||||||||||||||
Sbjct: 198884 tgaaagcagacaggccccag 198903



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 41    tgaaagcagacaggccccag 60
             ||||||||||||||||||||
Sbjct: 36760 tgaaagcagacaggccccag 36779



to top

>gb|AC153662.6| Mus musculus BAC clone RP23-24I10 from chromosome 12, complete sequence
          Length = 216041

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 41     tgaaagcagacaggccccag 60
              ||||||||||||||||||||
Sbjct: 144244 tgaaagcagacaggccccag 144225



to top

>emb|AJ222786.1|HVJ222786 Hordeum vulgare mRNA for H(+)-transporting ATPase-like protein,
           clone RG135
          Length = 350

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 414 cccttgagcttgacgacggactccacgtgccc 445
           ||||||||||| || |||||||| ||||||||
Sbjct: 349 cccttgagcttcaccacggactcaacgtgccc 318



to top

>gb|AC140930.3| Mus musculus BAC clone RP23-116P20 from chromosome 12, complete sequence
          Length = 201455

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 41     tgaaagcagacaggccccag 60
              ||||||||||||||||||||
Sbjct: 159980 tgaaagcagacaggccccag 159961



to top

>gb|AC112657.2| Homo sapiens X BAC RP11-647I17 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 116810

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   cacagatccactcttcactc 306
             ||||||||||||||||||||
Sbjct: 79368 cacagatccactcttcactc 79349



to top

>gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome
          Length = 2841581

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 389    ctgctggatggtctcgatgtcgag 412
              |||||||| |||||||||||||||
Sbjct: 678827 ctgctggaaggtctcgatgtcgag 678850



to top

>gb|AC122327.5| Mus musculus BAC clone RP23-339D20 from chromosome 12, complete sequence
          Length = 217167

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 41     tgaaagcagacaggccccag 60
              ||||||||||||||||||||
Sbjct: 117888 tgaaagcagacaggccccag 117907



to top

>gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome
          Length = 3304561

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 205     caaactgcatcaccagcggg 224
               ||||||||||||||||||||
Sbjct: 1807036 caaactgcatcaccagcggg 1807055



to top

>gb|AC132472.3| Mus musculus BAC clone RP23-113B13 from chromosome 12, complete sequence
          Length = 214333

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 41     tgaaagcagacaggccccag 60
              ||||||||||||||||||||
Sbjct: 126294 tgaaagcagacaggccccag 126313



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 41    tgaaagcagacaggccccag 60
             ||||||||||||||||||||
Sbjct: 39253 tgaaagcagacaggccccag 39272



to top

>dbj|AB042103.1| Asparagus officinalis AoPOX1 mRNA for peroxidase, complete cds
          Length = 1159

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 403 cgatgtcgagacccttgagcttga 426
           |||||||||| |||||||||||||
Sbjct: 556 cgatgtcgaggcccttgagcttga 533



to top

>emb|BX571709.23| Zebrafish DNA sequence from clone DKEY-251M8 in linkage group 11,
              complete sequence
          Length = 154382

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 113    aaaaatgaaggggggaaaca 132
              ||||||||||||||||||||
Sbjct: 111457 aaaaatgaaggggggaaaca 111438



to top

>gb|AC134462.5| Mus musculus BAC clone RP23-391L12 from chromosome 12, complete sequence
          Length = 197870

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 41     tgaaagcagacaggccccag 60
              ||||||||||||||||||||
Sbjct: 157654 tgaaagcagacaggccccag 157673



to top

>gb|AC134917.5| Mus musculus BAC clone RP23-64B3 from chromosome 12, complete sequence
          Length = 225046

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 41     tgaaagcagacaggccccag 60
              ||||||||||||||||||||
Sbjct: 127745 tgaaagcagacaggccccag 127764



to top

>gb|AC158366.5| Mus musculus BAC clone RP23-33N12 from chromosome 12, complete sequence
          Length = 212215

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 41    tgaaagcagacaggccccag 60
             ||||||||||||||||||||
Sbjct: 39677 tgaaagcagacaggccccag 39658



to top

>emb|CT030157.8| Mouse DNA sequence from clone RP24-316P8 on chromosome 12, complete
              sequence
          Length = 199971

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 41     tgaaagcagacaggccccag 60
              ||||||||||||||||||||
Sbjct: 141497 tgaaagcagacaggccccag 141516



to top

>gb|AC134254.3| Mus musculus BAC clone RP23-474M18 from 12, complete sequence
          Length = 191070

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 41     tgaaagcagacaggccccag 60
              ||||||||||||||||||||
Sbjct: 153929 tgaaagcagacaggccccag 153910



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 41    tgaaagcagacaggccccag 60
             ||||||||||||||||||||
Sbjct: 12043 tgaaagcagacaggccccag 12024



to top

>gb|AC127242.3| Mus musculus BAC clone RP24-404P19 from 12, complete sequence
          Length = 171990

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 41     tgaaagcagacaggccccag 60
              ||||||||||||||||||||
Sbjct: 156924 tgaaagcagacaggccccag 156905



to top

>emb|CT030250.3| Mouse DNA sequence from clone RP23-285E4 on chromosome 12, complete
              sequence
          Length = 177784

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 41     tgaaagcagacaggccccag 60
              ||||||||||||||||||||
Sbjct: 122985 tgaaagcagacaggccccag 123004



to top

>gb|AC124772.4| Mus musculus BAC clone RP23-47P3 from 12, complete sequence
          Length = 218340

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 41     tgaaagcagacaggccccag 60
              ||||||||||||||||||||
Sbjct: 146837 tgaaagcagacaggccccag 146818



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 41    tgaaagcagacaggccccag 60
             ||||||||||||||||||||
Sbjct: 66779 tgaaagcagacaggccccag 66760



to top

>gb|AC126045.3| Mus musculus BAC clone RP23-71I22 from 12, complete sequence
          Length = 224725

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 41     tgaaagcagacaggccccag 60
              ||||||||||||||||||||
Sbjct: 221765 tgaaagcagacaggccccag 221784



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 41    tgaaagcagacaggccccag 60
             ||||||||||||||||||||
Sbjct: 85807 tgaaagcagacaggccccag 85826



to top

>gb|AC134601.4| Mus musculus BAC clone RP23-242M10 from 12, complete sequence
          Length = 171767

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 41    tgaaagcagacaggccccag 60
             ||||||||||||||||||||
Sbjct: 81445 tgaaagcagacaggccccag 81464



to top

>gb|AC130824.4| Mus musculus BAC clone RP23-349B5 from 12, complete sequence
          Length = 178133

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 41     tgaaagcagacaggccccag 60
              ||||||||||||||||||||
Sbjct: 115732 tgaaagcagacaggccccag 115751



to top

>gb|AC122351.5| Mus musculus BAC clone RP23-388H1 from 12, complete sequence
          Length = 201060

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 41    tgaaagcagacaggccccag 60
             ||||||||||||||||||||
Sbjct: 71390 tgaaagcagacaggccccag 71371



to top

>gb|AC130829.4| Mus musculus BAC clone RP23-451I11 from 12, complete sequence
          Length = 189692

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 41     tgaaagcagacaggccccag 60
              ||||||||||||||||||||
Sbjct: 140785 tgaaagcagacaggccccag 140766



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 41    tgaaagcagacaggccccag 60
             ||||||||||||||||||||
Sbjct: 36710 tgaaagcagacaggccccag 36691



to top

>gb|AC164424.5| Mus musculus BAC clone RP23-151N21 from chromosome 12, complete
             sequence
          Length = 183953

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 41    tgaaagcagacaggccccag 60
             ||||||||||||||||||||
Sbjct: 99694 tgaaagcagacaggccccag 99713



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 41   tgaaagcagacaggccccag 60
            ||||||||||||||||||||
Sbjct: 4755 tgaaagcagacaggccccag 4774



to top

>gb|AC163633.4| Mus musculus BAC clone RP24-177N8 from chromosome 12, complete sequence
          Length = 178326

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 41     tgaaagcagacaggccccag 60
              ||||||||||||||||||||
Sbjct: 165317 tgaaagcagacaggccccag 165336



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 41    tgaaagcagacaggccccag 60
             ||||||||||||||||||||
Sbjct: 67277 tgaaagcagacaggccccag 67296



to top

>gb|AC163634.4| Mus musculus BAC clone RP23-152O2 from chromosome 12, complete sequence
          Length = 199499

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 41    tgaaagcagacaggccccag 60
             ||||||||||||||||||||
Sbjct: 90846 tgaaagcagacaggccccag 90865


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,112,617
Number of Sequences: 3902068
Number of extensions: 3112617
Number of successful extensions: 52645
Number of sequences better than 10.0: 131
Number of HSP's better than 10.0 without gapping: 131
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 52347
Number of HSP's gapped (non-prelim): 297
length of query: 461
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 439
effective length of database: 17,147,199,772
effective search space: 7527620699908
effective search space used: 7527620699908
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top