ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl29h06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|DP000016.1| Pan troglodytes target 1 genomic scaffold 46 0.10
2gb|AC087512.2| Pan troglodytes clone RP43-144M20, complete sequence 46 0.10
3gb|AC147106.2| Pan troglodytes BAC clone RP43-15F7 from 7, compl... 46 0.10
4gb|AC146205.2| Pan troglodytes BAC clone RP43-34B6 from 7, compl... 46 0.10
5emb|BX927225.7| Zebrafish DNA sequence from clone CH211-106F9 in... 42 1.6
6emb|AL035475.7|PFMAL4P2 Plasmodium falciparum MAL4P2 42 1.6
7emb|BX005355.10| Zebrafish DNA sequence from clone CH211-222M2, ... 42 1.6
8emb|AL451082.6| Human DNA sequence from clone RP11-307B16 on chr... 40 6.3
9gb|AC105515.5| Rattus norvegicus 14 BAC CH230-13H11 (Children's ... 40 6.3
10emb|AL158813.16| Human DNA sequence from clone RP11-29C12 on chr... 40 6.3
11emb|AL109614.28|HSBA425M5 Human DNA sequence from clone RP11-425... 40 6.3
12ref|XM_782192.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 6.3
13emb|AL935257.1| Lactobacillus plantarum strain WCFS1 complete ge... 40 6.3
14gb|AC007187.5| Arabidopsis thaliana chromosome 2 clone F7E22 map... 40 6.3
15gb|AC105940.2| Homo sapiens chromosome 1 clone RP11-335O13, comp... 40 6.3
16gb|AY900631.1| Drosophila buzzatii clone BAC 5H14, complete sequ... 40 6.3
17gb|AC154323.3| Mus musculus BAC clone RP23-307K19 from chromosom... 40 6.3
18gb|AC073616.17| Homo sapiens 12 BAC RP3-361K10 (Roswell Park Can... 40 6.3
19gb|AC009306.5| Homo sapiens BAC clone RP11-290K24 from 2, comple... 40 6.3
20gb|AC154407.2| Mus musculus BAC clone RP24-257B4 from 14, comple... 40 6.3
21gb|AC146598.4| Mus musculus BAC clone RP24-129K7 from 6, complet... 40 6.3
22emb|BX000990.6| Mouse DNA sequence from clone RP23-128J19 on chr... 40 6.3
23gb|AC109446.2| Homo sapiens chromosome 16 clone CTD-2576D5, comp... 40 6.3
24emb|AL672222.11| Mouse DNA sequence from clone RP23-330A15 on ch... 40 6.3
25emb|AL772293.7| Mouse DNA sequence from clone RP23-57D24 on chro... 40 6.3

>gb|DP000016.1| Pan troglodytes target 1 genomic scaffold
          Length = 1623484

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 95     gttacatagactcaaaaacatataaat 121
              |||||||||||| ||||||||||||||
Sbjct: 274055 gttacatagacttaaaaacatataaat 274029



to top

>gb|AC087512.2| Pan troglodytes clone RP43-144M20, complete sequence
          Length = 120797

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 95    gttacatagactcaaaaacatataaat 121
             |||||||||||| ||||||||||||||
Sbjct: 63233 gttacatagacttaaaaacatataaat 63207



to top

>gb|AC147106.2| Pan troglodytes BAC clone RP43-15F7 from 7, complete sequence
          Length = 193107

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 95     gttacatagactcaaaaacatataaat 121
              |||||||||||| ||||||||||||||
Sbjct: 151352 gttacatagacttaaaaacatataaat 151378



to top

>gb|AC146205.2| Pan troglodytes BAC clone RP43-34B6 from 7, complete sequence
          Length = 187725

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 95    gttacatagactcaaaaacatataaat 121
             |||||||||||| ||||||||||||||
Sbjct: 74261 gttacatagacttaaaaacatataaat 74235



to top

>emb|BX927225.7| Zebrafish DNA sequence from clone CH211-106F9 in linkage group 6,
             complete sequence
          Length = 161068

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 93    cagttacatagactcaaaaac 113
             |||||||||||||||||||||
Sbjct: 51898 cagttacatagactcaaaaac 51878



to top

>emb|AL035475.7|PFMAL4P2 Plasmodium falciparum MAL4P2
          Length = 234081

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 107    caaaaacatataaattaatta 127
              |||||||||||||||||||||
Sbjct: 179133 caaaaacatataaattaatta 179153



to top

>emb|BX005355.10| Zebrafish DNA sequence from clone CH211-222M2, complete sequence
          Length = 227182

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 418   ttgatgaattcaaggagctgg 438
             |||||||||||||||||||||
Sbjct: 83216 ttgatgaattcaaggagctgg 83236



to top

>emb|AL451082.6| Human DNA sequence from clone RP11-307B16 on chromosome 1 Contains the
             5' end of the PPFIA4 gene for eceptor type protein
             tyrosine phosphatase f polypeptide (PTPRF) interacting
             protein (liprin) alpha 4, complete sequence
          Length = 64355

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 410   acaaatgcttgatgaattcaagga 433
             |||||||||||||||||| |||||
Sbjct: 18419 acaaatgcttgatgaattaaagga 18396



to top

>gb|AC105515.5| Rattus norvegicus 14 BAC CH230-13H11 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 221805

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 419    tgatgaattcaaggagctggcgaggtgg 446
              ||||||||||| |||||||| |||||||
Sbjct: 120427 tgatgaattcagggagctggggaggtgg 120454



to top

>emb|AL158813.16| Human DNA sequence from clone RP11-29C12 on chromosome 6 Contains part
             of the MDN1 gene for midasin homolog (yeast)(KIAA0301) and
             a pseudogene similar to part of a novel protein (similar
             to 1810055D05RIK), complete sequence
          Length = 57084

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 412   aaatgcttgatgaattcaag 431
             ||||||||||||||||||||
Sbjct: 29672 aaatgcttgatgaattcaag 29653



to top

>emb|AL109614.28|HSBA425M5 Human DNA sequence from clone RP11-425M5 on chromosome 20 Contains the
              GLRXP gene for glutaredoxin (thioltransferase) pseudogene,
              the PPIAP3 gene for peptidylprolyl isomerase A (cyclophilin
              A) pseudogene 3, the NNAT gene for neuronatin, the BLCAP
              gene for bladder cancer 10 kD protein BC10, a novel gene
              and three CpG islands, complete sequence
          Length = 194433

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 11     aaatacccagagttcttaca 30
              ||||||||||||||||||||
Sbjct: 157260 aaatacccagagttcttaca 157241



to top

>ref|XM_782192.1| PREDICTED: Strongylocentrotus purpuratus similar to diacylglycerol
            kinase, delta 130kDa isoform 1 (LOC582232), mRNA
          Length = 3723

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 370  tctgggggaccaacaaggaa 389
            ||||||||||||||||||||
Sbjct: 2456 tctgggggaccaacaaggaa 2475



to top

>emb|AL935257.1| Lactobacillus plantarum strain WCFS1 complete genome; segment 6/11
          Length = 302050

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 106   tcaaaaacatataaattaattata 129
             ||||||||| ||||||||||||||
Sbjct: 22734 tcaaaaacagataaattaattata 22711



to top

>gb|AC007187.5| Arabidopsis thaliana chromosome 2 clone F7E22 map mi421, complete
             sequence
          Length = 98432

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 102   agactcaaaaacatataaattaat 125
             ||||| ||||||||||||||||||
Sbjct: 15066 agacttaaaaacatataaattaat 15043



to top

>gb|AC105940.2| Homo sapiens chromosome 1 clone RP11-335O13, complete sequence
          Length = 177140

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 410  acaaatgcttgatgaattcaagga 433
            |||||||||||||||||| |||||
Sbjct: 8165 acaaatgcttgatgaattaaagga 8142



to top

>gb|AY900631.1| Drosophila buzzatii clone BAC 5H14, complete sequence
          Length = 124024

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 109   aaaacatataaattaattat 128
             ||||||||||||||||||||
Sbjct: 42065 aaaacatataaattaattat 42046



to top

>gb|AC154323.3| Mus musculus BAC clone RP23-307K19 from chromosome 14, complete
            sequence
          Length = 191902

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 221  tttggtacatttattattca 240
            ||||||||||||||||||||
Sbjct: 4673 tttggtacatttattattca 4654



to top

>gb|AC073616.17| Homo sapiens 12 BAC RP3-361K10 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 128936

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 170   ccacaggtgtggatgtaattacta 193
             |||||| |||||||||||||||||
Sbjct: 64163 ccacagatgtggatgtaattacta 64186



to top

>gb|AC009306.5| Homo sapiens BAC clone RP11-290K24 from 2, complete sequence
          Length = 176602

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 110   aaacatataaattaattata 129
             ||||||||||||||||||||
Sbjct: 66327 aaacatataaattaattata 66346



to top

>gb|AC154407.2| Mus musculus BAC clone RP24-257B4 from 14, complete sequence
          Length = 158436

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 221   tttggtacatttattattca 240
             ||||||||||||||||||||
Sbjct: 47934 tttggtacatttattattca 47953



to top

>gb|AC146598.4| Mus musculus BAC clone RP24-129K7 from 6, complete sequence
          Length = 168141

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 299   aaactcccttggatgttcat 318
             ||||||||||||||||||||
Sbjct: 64534 aaactcccttggatgttcat 64515



to top

>emb|BX000990.6| Mouse DNA sequence from clone RP23-128J19 on chromosome X, complete
             sequence
          Length = 19228

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 108   aaaaacatataaattaatta 127
             ||||||||||||||||||||
Sbjct: 19038 aaaaacatataaattaatta 19019



to top

>gb|AC109446.2| Homo sapiens chromosome 16 clone CTD-2576D5, complete sequence
          Length = 193519

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 400   gacctcaatgacaaatgctt 419
             ||||||||||||||||||||
Sbjct: 97232 gacctcaatgacaaatgctt 97213



to top

>emb|AL672222.11| Mouse DNA sequence from clone RP23-330A15 on chromosome X, complete
            sequence
          Length = 194025

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 108  aaaaacatataaattaatta 127
            ||||||||||||||||||||
Sbjct: 1810 aaaaacatataaattaatta 1791



to top

>emb|AL772293.7| Mouse DNA sequence from clone RP23-57D24 on chromosome 4, complete
              sequence
          Length = 251930

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 109    aaaacatataaattaattat 128
              ||||||||||||||||||||
Sbjct: 194495 aaaacatataaattaattat 194476


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,932,864
Number of Sequences: 3902068
Number of extensions: 4932864
Number of successful extensions: 103516
Number of sequences better than 10.0: 25
Number of HSP's better than 10.0 without gapping: 25
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 103441
Number of HSP's gapped (non-prelim): 75
length of query: 464
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 442
effective length of database: 17,147,199,772
effective search space: 7579062299224
effective search space used: 7579062299224
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top