Clone Name | rbastl29g04 |
---|---|
Clone Library Name | barley_pub |
>ref|NM_186147.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3033 Score = 71.9 bits (36), Expect = 1e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 262 acgctgtcgagccaaacaacgacttgctctatggatggacgctggcgagggtcagtgctg 321 |||||||| |||||| |||| ||||| || || ||||| ||||| ||||||||||||||| Sbjct: 3029 acgctgtcaagccaagcaacaacttgttcgatcgatgggcgctgccgagggtcagtgctg 2970 Query: 322 atgcacct 329 |||||||| Sbjct: 2969 atgcacct 2962
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 71.9 bits (36), Expect = 1e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 262 acgctgtcgagccaaacaacgacttgctctatggatggacgctggcgagggtcagtgctg 321 |||||||| |||||| |||| ||||| || || ||||| ||||| ||||||||||||||| Sbjct: 427125 acgctgtcaagccaagcaacaacttgttcgatcgatgggcgctgccgagggtcagtgctg 427066 Query: 322 atgcacct 329 |||||||| Sbjct: 427065 atgcacct 427058
>dbj|AP004342.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0585H11 Length = 149371 Score = 71.9 bits (36), Expect = 1e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 262 acgctgtcgagccaaacaacgacttgctctatggatggacgctggcgagggtcagtgctg 321 |||||||| |||||| |||| ||||| || || ||||| ||||| ||||||||||||||| Sbjct: 29289 acgctgtcaagccaagcaacaacttgttcgatcgatgggcgctgccgagggtcagtgctg 29230 Query: 322 atgcacct 329 |||||||| Sbjct: 29229 atgcacct 29222
>dbj|AK121984.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033108O10, full insert sequence Length = 3392 Score = 71.9 bits (36), Expect = 1e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 262 acgctgtcgagccaaacaacgacttgctctatggatggacgctggcgagggtcagtgctg 321 |||||||| |||||| |||| ||||| || || ||||| ||||| ||||||||||||||| Sbjct: 3155 acgctgtcaagccaagcaacaacttgttcgatcgatgggcgctgccgagggtcagtgctg 3096 Query: 322 atgcacct 329 |||||||| Sbjct: 3095 atgcacct 3088
>dbj|AK103166.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033121E13, full insert sequence Length = 2958 Score = 71.9 bits (36), Expect = 1e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 262 acgctgtcgagccaaacaacgacttgctctatggatggacgctggcgagggtcagtgctg 321 |||||||| |||||| |||| ||||| || || ||||| ||||| ||||||||||||||| Sbjct: 2693 acgctgtcaagccaagcaacaacttgttcgatcgatgggcgctgccgagggtcagtgctg 2634 Query: 322 atgcacct 329 |||||||| Sbjct: 2633 atgcacct 2626
>dbj|AK064359.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-108-B08, full insert sequence Length = 2238 Score = 71.9 bits (36), Expect = 1e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 262 acgctgtcgagccaaacaacgacttgctctatggatggacgctggcgagggtcagtgctg 321 |||||||| |||||| |||| ||||| || || ||||| ||||| ||||||||||||||| Sbjct: 1840 acgctgtcaagccaagcaacaacttgttcgatcgatgggcgctgccgagggtcagtgctg 1781 Query: 322 atgcacct 329 |||||||| Sbjct: 1780 atgcacct 1773
>gb|AC008747.5|AC008747 Homo sapiens chromosome 19 clone CTD-2588C8, complete sequence Length = 159597 Score = 44.1 bits (22), Expect = 0.30 Identities = 22/22 (100%) Strand = Plus / Minus Query: 230 actgggaaagcaacacagggta 251 |||||||||||||||||||||| Sbjct: 31391 actgggaaagcaacacagggta 31370
>gb|AC117221.3| Mus musculus BAC clone RP23-347F2 from 1, complete sequence Length = 194077 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 154 ttgatagttctcagatagtttctc 177 |||||||||||||||| ||||||| Sbjct: 98498 ttgatagttctcagattgtttctc 98475
>emb|CR524821.5| Zebrafish DNA sequence from clone CH211-192F15 in linkage group 16, complete sequence Length = 152728 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 215 attgaccaaaagagaactgg 234 |||||||||||||||||||| Sbjct: 17880 attgaccaaaagagaactgg 17899 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 215 attgaccaaaagagaactgg 234 |||||||||||||||||||| Sbjct: 17632 attgaccaaaagagaactgg 17651
>gb|AC092832.7| Homo sapiens X BAC RP11-494I9 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 196491 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 89 cagcatctataaaaaagaaa 108 |||||||||||||||||||| Sbjct: 156952 cagcatctataaaaaagaaa 156971
>gb|AC016450.10| Homo sapiens chromosome 11, clone RP11-361K15, complete sequence Length = 187449 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 81 tgccggttcagcatctataaaaaa 104 |||| ||||||||||||||||||| Sbjct: 100258 tgccagttcagcatctataaaaaa 100281
>gb|AC068107.6| Homo sapiens chromosome 11, clone RP11-807F21, complete sequence Length = 177969 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 81 tgccggttcagcatctataaaaaa 104 |||| ||||||||||||||||||| Sbjct: 58768 tgccagttcagcatctataaaaaa 58745
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 188 gtttatcacccatgtcaaga 207 |||||||||||||||||||| Sbjct: 7581080 gtttatcacccatgtcaaga 7581099
>emb|AL662960.3|OSJN00162 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0021F22, complete sequence Length = 181498 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 188 gtttatcacccatgtcaaga 207 |||||||||||||||||||| Sbjct: 103553 gtttatcacccatgtcaaga 103572 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,818,222 Number of Sequences: 3902068 Number of extensions: 3818222 Number of successful extensions: 63918 Number of sequences better than 10.0: 14 Number of HSP's better than 10.0 without gapping: 14 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 63859 Number of HSP's gapped (non-prelim): 59 length of query: 350 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 328 effective length of database: 17,147,199,772 effective search space: 5624281525216 effective search space used: 5624281525216 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)