ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl29e07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT009535.1| Triticum aestivum clone wr1.pk0136.c2:fis, full i... 412 e-112
2emb|X59873.1|TAHISTH2B T.aestivum L mRNA for histone H2B 408 e-111
3dbj|D37945.1|WHTPH2B15D Triticum aestivum gene for protein H2B15... 408 e-111
4dbj|D37943.1|WHTPH2B8B Triticum aestivum mRNA for protein H2B-8,... 408 e-111
5gb|BT016429.1| Zea mays clone Contig262 mRNA sequence 404 e-110
6emb|X57313.1|ZMH2B221 Z.mays mRNA for H2B histone (clone cH2B221) 404 e-110
7dbj|D37942.1|WHTPH2B6A Triticum aestivum mRNA for protein H2B-6,... 398 e-108
8ref|XM_483094.1| Oryza sativa (japonica cultivar-group), mRNA 396 e-107
9dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 396 e-107
10dbj|AP004620.3| Oryza sativa (japonica cultivar-group) genomic D... 396 e-107
11ref|NM_184399.1| Oryza sativa (japonica cultivar-group), mRNA 392 e-106
12dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 392 e-106
13dbj|AP003045.2| Oryza sativa (japonica cultivar-group) genomic D... 392 e-106
14dbj|AP002522.1| Oryza sativa (japonica cultivar-group) genomic D... 392 e-106
15gb|BT017477.1| Zea mays clone EL01N0408F05.c mRNA sequence 387 e-104
16ref|NM_184371.1| Oryza sativa (japonica cultivar-group), mRNA 377 e-101
17ref|XM_475912.1| Oryza sativa (japonica cultivar-group), predic... 377 e-101
18gb|AC104284.2| Oryza sativa (japonica cultivar-group) chromosome... 377 e-101
19gb|AC098832.3| Oryza sativa (japonica cultivar-group) chromosome... 377 e-101
20dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 377 e-101
21dbj|AP002540.2| Oryza sativa (japonica cultivar-group) genomic D... 377 e-101
22ref|NM_184403.1| Oryza sativa (japonica cultivar-group), mRNA 375 e-101
23ref|NM_184405.1| Oryza sativa (japonica cultivar-group), mRNA 373 e-100
24dbj|AB075378.1| Oryza sativa OsH2B mRNA for histone H2B, complet... 373 e-100
25ref|NM_184407.1| Oryza sativa (japonica cultivar-group), mRNA 371 1e-99
26ref|NM_184409.1| Oryza sativa (japonica cultivar-group), mRNA 369 5e-99
27ref|NM_184374.1| Oryza sativa (japonica cultivar-group), mRNA 369 5e-99
28gb|BT009118.1| Triticum aestivum clone wl1n.pk0003.e12:fis, full... 367 2e-98
29gb|U08226.1|ZMU08226 Zea mays W-22 histone H2B mRNA, complete cds 359 4e-96
30gb|BT016519.1| Zea mays clone Contig352 mRNA sequence 341 1e-90
31emb|X57312.1|ZMH2B214 Z.mays mRNA for H2B histone (clone cH2B214) 339 4e-90
32emb|X69960.1|ZMH2B3A Z.mays gene for H2B histone (gH2B3) 337 2e-89
33gb|BT016478.1| Zea mays clone Contig311 mRNA sequence 335 6e-89
34gb|BT016885.1| Zea mays clone Contig718 mRNA sequence 325 6e-86
35gb|BT016350.1| Zea mays clone Contig183 mRNA sequence 325 6e-86
36gb|BT017438.1| Zea mays clone EL01N0404D07.c mRNA sequence 317 1e-83
37gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 317 1e-83
38gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare str... 317 1e-83
39dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 317 1e-83
40gb|AY581839.1| Cynodon dactylon putative histone H2B mRNA, parti... 309 4e-81
41emb|X69961.1|SMH2B4A Z.mays gene for H2B histone (gH2B4) 301 9e-79
42dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic D... 301 9e-79
43ref|XM_475367.1| Oryza sativa (japonica cultivar-group), predic... 293 2e-76
44gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome... 293 2e-76
45gb|AF356817.1|AF356817 Lolium perenne histone H2B-1 mRNA, partia... 283 2e-73
46ref|NM_190523.1| Oryza sativa (japonica cultivar-group), predic... 248 1e-62
47dbj|AP003241.3| Oryza sativa (japonica cultivar-group) genomic D... 248 1e-62
48dbj|AP003231.3| Oryza sativa (japonica cultivar-group) genomic D... 248 1e-62
49dbj|AK059159.1| Oryza sativa (japonica cultivar-group) cDNA clon... 208 1e-50
50dbj|D37944.1|WHTPH2B12C Triticum aestivum gene for protein H2B12... 206 4e-50
51emb|X82362.1|AOHIS2B A.officinalis mRNA for histone 2B 190 2e-45
52gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1),... 186 4e-44
53gb|AY389709.1| Hyacinthus orientalis histone H2B mRNA, partial cds 174 1e-40
54gb|AF048824.1|AF048824 Malus domestica histone H2B mRNA, partial... 174 1e-40
55gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histo... 172 5e-40
56gb|AF356818.1|AF356818 Lolium perenne histone H2B-2 mRNA, partia... 161 2e-36
57gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I... 157 3e-35
58gb|AF356821.1|AF356821 Lolium perenne histone H2B-5 mRNA, partia... 153 5e-34
59gb|AF356819.1|AF356819 Lolium perenne histone H2B-3 mRNA, partia... 145 1e-31
60ref|XM_391802.1| Gibberella zeae PH-1 H2B_NEUCR Histone H2B (FG1... 133 5e-28
61emb|BX088700.1|CNS09S4S DNA centromeric region sequence from BAC... 133 5e-28
62emb|AL590462.1|CNS07EGJ DNA centromeric region sequence BAC 34F0... 133 5e-28
63gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, c... 129 7e-27
64dbj|AB124798.1| Rhacophorus schlegelii histh2b mRNA for histone ... 125 1e-25
65ref|XM_789621.1| PREDICTED: Strongylocentrotus purpuratus simila... 119 7e-24
66ref|XM_540291.2| PREDICTED: Canis familiaris similar to H2B hist... 117 3e-23
67ref|XM_540282.2| PREDICTED: Canis familiaris similar to Histone ... 117 3e-23
68ref|XM_540287.2| PREDICTED: Canis familiaris similar to H2B hist... 117 3e-23
69ref|XM_844635.1| PREDICTED: Canis familiaris similar to H2B hist... 117 3e-23
70ref|XM_854499.1| PREDICTED: Canis familiaris similar to H2B hist... 117 3e-23
71ref|XM_540288.2| PREDICTED: Canis familiaris similar to H2B hist... 117 3e-23
72emb|AL109948.9|HSJ998N21 Human DNA sequence from clone RP5-998N2... 117 3e-23
73gb|BC073925.1| Homo sapiens similar to histone H2B histone famil... 117 3e-23
74gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-I... 117 3e-23
75ref|XM_866738.1| PREDICTED: Bos taurus similar to Histone H2B 29... 113 4e-22
76ref|XM_618175.2| PREDICTED: Bos taurus similar to H2B histone fa... 113 4e-22
77ref|XM_782648.1| PREDICTED: Strongylocentrotus purpuratus simila... 113 4e-22
78ref|XM_785670.1| PREDICTED: Strongylocentrotus purpuratus simila... 113 4e-22
79emb|X59961.1|RNH2AB R.norvegicus genes for H2A and H2B histones 113 4e-22
80ref|NM_022647.1| Rattus norvegicus histone 1, H2bl (Hist1h2bl), ... 113 4e-22
81gb|DQ215263.1| Taeniopygia guttata clone 0058P0013D11 histone 1 ... 109 7e-21
82gb|BC107084.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MG... 109 7e-21
83gb|BC107085.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MG... 109 7e-21
84ref|XM_513763.1| PREDICTED: Pan troglodytes LOC457260 (LOC457260... 109 7e-21
85gb|BC069193.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MG... 109 7e-21
86gb|BC005827.2| Homo sapiens histone 2, H2be, mRNA (cDNA clone IM... 109 7e-21
87ref|NM_003528.2| Homo sapiens histone 2, H2be (HIST2H2BE), mRNA 109 7e-21
88emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on ch... 109 7e-21
89emb|AL357493.8| Human DNA sequence from clone RP11-439A17 on chr... 109 7e-21
90emb|BX072512.1|CNS09S44 Single read from an extremity of a full-... 109 7e-21
91emb|BX072414.1|CNS09S1E Single read from an extremity of a full-... 109 7e-21
92emb|BX051496.1|CNS09BWC Single read from an extremity of a full-... 109 7e-21
93emb|BX051495.1|CNS09BWB Single read from an extremity of a full-... 109 7e-21
94emb|BX047440.1|CNS098RO Single read from an extremity of a full-... 109 7e-21
95emb|BX038423.1|CNS091T7 Single read from an extremity of a full-... 109 7e-21
96emb|BX032827.1|CNS08XHR Single read from an extremity of a full-... 109 7e-21
97emb|BX031663.1|CNS08WLF Single read from an extremity of a full-... 109 7e-21
98emb|BX021771.1|CNS08OYN Single read from an extremity of a full-... 109 7e-21
99emb|BX013307.1|CNS08IFJ Single read from an extremity of a full-... 109 7e-21
100emb|BX012776.1|CNS08I0S Single read from an extremity of a full-... 109 7e-21
101emb|BX012380.1|CNS08HPS Single read from an extremity of a full-... 109 7e-21
102emb|BX009211.1|CNS08F9R Single read from an extremity of a full-... 109 7e-21
103emb|X98185.1|AGH2B A.gambiae mRNA for histone H2B 109 7e-21
104emb|X57985.1|HSHIST H.sapiens genes for histones H2B.1 and H2A 109 7e-21
105emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A... 109 7e-21
106emb|CR541895.1| Homo sapiens full open reading frame cDNA clone ... 109 7e-21
107gb|BC096121.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MG... 109 7e-21
108emb|CR858221.1| Pongo pygmaeus mRNA; cDNA DKFZp469C0528 (from cl... 109 7e-21
109ref|NG_002621.1| Homo sapiens histone 2, H2ba (HIST2H2BA) pseudo... 109 7e-21
110ref|NG_002652.1| Homo sapiens histone 2, H2bb (HIST2H2BB) pseudo... 109 7e-21
111gb|AY131975.1| Homo sapiens histone H2B (HIST2H2BA) pseudogene, ... 109 7e-21
112gb|AY131976.1| Homo sapiens histone H2B (HIST2H2BB) pseudogene, ... 109 7e-21
113gb|AY131979.1| Homo sapiens histone H2B (HIST2H2BE) gene, comple... 109 7e-21
114ref|XM_558160.1| Anopheles gambiae str. PEST ENSANGP00000027582 ... 109 7e-21
115ref|XM_320334.2| Anopheles gambiae str. PEST ENSANGP00000014097 ... 109 7e-21
116ref|XM_320329.2| Anopheles gambiae str. PEST ENSANGP00000014080 ... 109 7e-21
117ref|XM_314450.2| Anopheles gambiae str. PEST ENSANGP00000000674 ... 109 7e-21
118ref|XM_314448.2| Anopheles gambiae str. PEST ENSANGP00000016043 ... 109 7e-21
119ref|XM_306853.2| Anopheles gambiae str. PEST ENSANGP00000000106 ... 109 7e-21
120ref|XM_306255.2| Anopheles gambiae str. PEST ENSANGP00000000003 ... 109 7e-21
121gb|AY893641.1| Synthetic construct Homo sapiens clone FLH130870.... 109 7e-21
122gb|BC098289.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG... 109 7e-21
123gb|BC098112.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG... 109 7e-21
124gb|BC077399.1| Xenopus laevis histone H2B, mRNA (cDNA clone MGC:... 109 7e-21
125ref|NM_001024599.2| Homo sapiens histone 2, H2bf (HIST2H2BF), mRNA 109 7e-21
126emb|CR855675.2| Xenopus tropicalis finished cDNA, clone TGas058p09 109 7e-21
127gb|BC110793.1| Homo sapiens histone 2, H2bf, mRNA (cDNA clone MG... 109 7e-21
128gb|BC106916.1| Homo sapiens similar to histone H2B histone famil... 109 7e-21
129gb|M60756.1|HUMHISH2BA Human histone H2B.1 mRNA, 3' end 109 7e-21
130gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene... 109 7e-21
131gb|M31921.1|VVCH2AB V.carteri histone H2A-III and H2B-III genes,... 109 7e-21
132ref|XM_513764.1| PREDICTED: Pan troglodytes LOC457261 (LOC457261... 107 3e-20
133gb|AY656810.1| Homo sapiens H2B/t variant gene, complete cds 107 3e-20
134gb|AY648853.1| Homo sapiens histone H2B/s (HIST2H2BD) gene, comp... 107 3e-20
135gb|BC071638.1| Homo sapiens cDNA clone IMAGE:4390105, containing... 107 3e-20
136gb|BC068044.1| Homo sapiens cDNA clone IMAGE:6380649, containing... 107 3e-20
137emb|BX008531.1|CNS08EQV Single read from an extremity of a full-... 107 3e-20
138ref|XM_936779.1| PREDICTED: Homo sapiens similar to H2B histone ... 107 3e-20
139ref|NG_002619.1| Homo sapiens histone 2, H2bc (HIST2H2BC) pseudo... 107 3e-20
140ref|NG_002620.1| Homo sapiens histone 2, H2bd (HIST2H2BD) pseudo... 107 3e-20
141gb|AY131977.1| Homo sapiens histone H2B (HIST2H2BC) pseudogene, ... 107 3e-20
142gb|AY131978.1| Homo sapiens histone H2B (HIST2H2BD) pseudogene, ... 107 3e-20
143ref|XM_425468.1| PREDICTED: Gallus gallus similar to H2B histone... 105 1e-19
144ref|XM_425462.1| PREDICTED: Gallus gallus similar to H2B histone... 105 1e-19
145ref|XM_425457.1| PREDICTED: Gallus gallus similar to H2B histone... 105 1e-19
146ref|XM_416196.1| PREDICTED: Gallus gallus similar to H2B histone... 105 1e-19
147ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, ... 105 1e-19
148ref|XM_582734.2| PREDICTED: Bos taurus similar to Histone H2B 29... 105 1e-19
149gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co... 105 1e-19
150ref|XM_535910.2| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
151ref|XM_843136.1| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
152ref|XM_849151.1| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
153ref|XM_849134.1| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
154ref|XM_545412.2| PREDICTED: Canis familiaris similar to H2B hist... 105 1e-19
155ref|XM_545410.2| PREDICTED: Canis familiaris similar to H2B hist... 105 1e-19
156ref|XM_545401.2| PREDICTED: Canis familiaris similar to H2B hist... 105 1e-19
157ref|XM_545398.2| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
158ref|XM_848802.1| PREDICTED: Canis familiaris similar to H2B hist... 105 1e-19
159ref|XM_848767.1| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
160ref|XM_545418.1| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
161ref|XM_848724.1| PREDICTED: Canis familiaris similar to H2B hist... 105 1e-19
162ref|XM_545375.1| PREDICTED: Canis familiaris similar to testis-s... 105 1e-19
163ref|XM_545374.2| PREDICTED: Canis familiaris similar to testis-s... 105 1e-19
164ref|XM_844623.1| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
165ref|XM_854475.1| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
166ref|XM_854447.1| PREDICTED: Canis familiaris similar to H2B hist... 105 1e-19
167ref|XM_545425.2| PREDICTED: Canis familiaris similar to H2B hist... 105 1e-19
168ref|XM_854265.1| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
169ref|XM_545389.2| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
170ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone ... 105 1e-19
171ref|XM_854116.1| PREDICTED: Canis familiaris similar to histone ... 105 1e-19
172ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone ... 105 1e-19
173ref|NM_022643.1| Rattus norvegicus histone 1, H2ba (Hist1h2ba), ... 105 1e-19
174ref|XM_781061.1| PREDICTED: Strongylocentrotus purpuratus simila... 105 1e-19
175emb|X59962.1|RNTH2AB R.norvegicus genes for TH2A and TH2B histones 105 1e-19
176emb|X07766.1|GGH2AB11 Chicken DNA for CH1-10 histone H2A/H2B seq... 105 1e-19
177emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A) 105 1e-19
178emb|X02621.1|MMHISH2B Mouse gene for histone H2b 105 1e-19
179emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr... 105 1e-19
180emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr... 105 1e-19
181gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone... 105 1e-19
182emb|CR353801.1| Gallus gallus finished cDNA, clone ChEST919h3 105 1e-19
183gb|BC092138.1| Mus musculus histone 1, H2bh, mRNA (cDNA clone MG... 105 1e-19
184ref|NM_178195.1| Mus musculus histone 1, H2bf (Hist1h2bf), mRNA 105 1e-19
185ref|NM_178199.1| Mus musculus histone 1, H2bl (Hist1h2bl), mRNA 105 1e-19
186ref|XM_214483.3| PREDICTED: Rattus norvegicus histone 1, H2bn (p... 105 1e-19
187gb|AY158935.1| Mus musculus histone protein Hist1h2bf gene, comp... 105 1e-19
188gb|AY158933.1| Mus musculus histone protein Hist1h2bh gene, comp... 105 1e-19
189gb|AY158927.1| Mus musculus histone protein Hist1h2bl gene, comp... 105 1e-19
190emb|X05099.1|GGH2B6 Chicken histone H2B gene (pBRA-5.4) 105 1e-19
191emb|X57263.1|GGH2B4G Chicken gene for histone H2B-IV 105 1e-19
192gb|U37575.1|GGU37575 Gallus gallus histones H4-VI, H2B-VII and H... 105 1e-19
193gb|U93853.1|ECU93853 Euplotes crassus histone H2B (H2B(2)) gene,... 105 1e-19
194ref|NM_178197.1| Mus musculus histone 1, H2bh (Hist1h2bh), mRNA 105 1e-19
195gb|M18046.1|RATHISTSA Rat testis-specific histone H2B mRNA, comp... 105 1e-19
196gb|M18045.1|RATHISTS Rat testis-specific histone TH2B mRNA, comp... 105 1e-19
197gb|M57901.1|CHKH2BB Chicken histone H2B gene, complete cds 105 1e-19
198ref|XM_427116.1| PREDICTED: Gallus gallus similar to histone H2B... 103 4e-19
199ref|XM_427013.1| PREDICTED: Gallus gallus similar to histone H2B... 103 4e-19
200ref|XM_786200.1| PREDICTED: Strongylocentrotus purpuratus simila... 103 4e-19
201ref|XM_786178.1| PREDICTED: Strongylocentrotus purpuratus simila... 103 4e-19
202emb|X06643.1|SPH2BL4 Strongylocentrotus purpuratus late histone ... 103 4e-19
203emb|X06640.1|SPH2BL1 Strongylocentrotus purpuratus late histone ... 103 4e-19
204emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chrom... 103 4e-19
205gb|AY158931.1| Mus musculus histone protein Hist1h2bk gene, comp... 103 4e-19
206ref|NM_214552.1| Strongylocentrotus purpuratus late histone L1 H... 103 4e-19
207emb|X05100.1|GGH2B7 Chicken histone H2B gene (pPP2d-4.0) 103 4e-19
208ref|NM_175665.1| Mus musculus histone 1, H2bk (Hist1h2bk), mRNA 103 4e-19
209gb|BC077692.1| Xenopus tropicalis histone 1, H2bk, mRNA (cDNA cl... 101 2e-18
210ref|XM_954347.1| Neurospora crassa OR74A hypothetical protein (N... 101 2e-18
211ref|XM_331210.1| Neurospora crassa OR74A hypothetical protein (N... 101 2e-18
212ref|XM_545431.2| PREDICTED: Canis familiaris similar to Histone ... 101 2e-18
213emb|BX068880.1|CNS09PB8 Single read from an extremity of a full-... 101 2e-18
214emb|BX053939.1|CNS09DS7 Single read from an extremity of a full-... 101 2e-18
215emb|BX053938.1|CNS09DS6 Single read from an extremity of a full-... 101 2e-18
216ref|NM_001006890.1| Xenopus tropicalis histone 1, H2bk (hist1h2b... 101 2e-18
217dbj|AK108119.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 2e-18
218dbj|AB085854.1| Rosellinia necatrix hh2b gene for histone H2B, c... 101 2e-18
219emb|BX034441.1|CNS08YQL Single read from an extremity of a full-... 100 7e-18
220emb|BX014617.1|CNS08JFX Single read from an extremity of a full-... 100 7e-18
221dbj|AK158416.1| Mus musculus adult inner ear cDNA, RIKEN full-le... 100 7e-18
222emb|X05094.1|GGH2B1 Chicken histone H2B gene (pKR1a-1.3) 100 7e-18
223gb|J00865.1|CHKH2B Chicken histone H2B gene and flanks 100 7e-18
224ref|NM_023422.2| Mus musculus histone 1, H2bc (Hist1h2bc), mRNA 98 3e-17
225ref|NM_175664.1| Mus musculus histone 1, H2bb (Hist1h2bb), mRNA 98 3e-17
226gb|BC082774.1| Mus musculus histone 1, H2bg, mRNA (cDNA clone IM... 98 3e-17
227ref|XM_416197.1| PREDICTED: Gallus gallus similar to H2B histone... 98 3e-17
228gb|BC060304.1| Mus musculus histone 1, H2bg, mRNA (cDNA clone MG... 98 3e-17
229ref|XM_607722.1| PREDICTED: Bos taurus similar to Histone H2B 29... 98 3e-17
230ref|XM_868885.1| PREDICTED: Bos taurus similar to Histone H2B 29... 98 3e-17
231ref|XM_988254.1| PREDICTED: Mus musculus similar to Histone H2B ... 98 3e-17
232ref|XM_978232.1| PREDICTED: Mus musculus similar to Histone H2B ... 98 3e-17
233ref|XM_978035.1| PREDICTED: Mus musculus similar to Histone H2B ... 98 3e-17
234gb|BC061044.1| Mus musculus histone 1, H2bp, mRNA (cDNA clone MG... 98 3e-17
235gb|BC011440.1| Mus musculus histone 1, H2bc, mRNA (cDNA clone MG... 98 3e-17
236ref|XM_787146.1| PREDICTED: Strongylocentrotus purpuratus simila... 98 3e-17
237emb|X90778.1|MMTSHIS2B M.musculus H2B gene 98 3e-17
238emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143 98 3e-17
239ref|NM_001031481.1| Gallus gallus histone H2B (LOC427886), mRNA 98 3e-17
240emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B) 98 3e-17
241emb|AL606464.11| Mouse DNA sequence from clone RP23-462P2 on chr... 98 3e-17
242emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chr... 98 3e-17
243emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr... 98 3e-17
244emb|V00415.1|GGHI02 Gallus gallus gene coding for histone H2b 98 3e-17
245gb|BC019673.1| Mus musculus histone 1, H2bc, mRNA (cDNA clone MG... 98 3e-17
246dbj|AK036389.1| Mus musculus adult male bone cDNA, RIKEN full-le... 98 3e-17
247dbj|AK005191.1| Mus musculus adult male cerebellum cDNA, RIKEN f... 98 3e-17
248dbj|AK005407.1| Mus musculus adult female placenta cDNA, RIKEN f... 98 3e-17
249dbj|AK011516.1| Mus musculus 10 days embryo whole body cDNA, RIK... 98 3e-17
250ref|NM_178196.2| Mus musculus histone 1, H2bg (Hist1h2bg), mRNA 98 3e-17
251ref|NM_175663.1| Mus musculus histone 1, H2ba (Hist1h2ba), mRNA 98 3e-17
252ref|NM_178198.1| Mus musculus histone 1, H2bj (Hist1h2bj), mRNA 98 3e-17
253ref|NM_178201.1| Mus musculus histone 1, H2bn (Hist1h2bn), mRNA 98 3e-17
254ref|NM_178200.1| Mus musculus histone 1, H2bm (Hist1h2bm), mRNA 98 3e-17
255ref|NM_178202.1| Mus musculus histone 1, H2bp (Hist1h2bp), mRNA 98 3e-17
256ref|XM_220506.2| PREDICTED: Rattus norvegicus histone 3, H2ba (p... 98 3e-17
257gb|AY158939.1| Mus musculus histone protein Hist1h2ba gene, comp... 98 3e-17
258gb|AY158938.1| Mus musculus histone protein Hist1h2bb gene, comp... 98 3e-17
259gb|AY158937.1| Mus musculus histone protein Hist1h2bc gene, comp... 98 3e-17
260gb|AY158934.1| Mus musculus histone protein Hist1h2bg gene, comp... 98 3e-17
261gb|AY158932.1| Mus musculus histone protein Hist1h2bj gene, comp... 98 3e-17
262gb|AY158930.1| Mus musculus histone protein Hist1h2bp gene, comp... 98 3e-17
263gb|AY158929.1| Mus musculus histone protein Hist1h2bn gene, comp... 98 3e-17
264gb|AY158928.1| Mus musculus histone protein Hist1h2bm gene, comp... 98 3e-17
265gb|AY158907.1| Mus musculus histone protein Hist1h1e gene, compl... 98 3e-17
266emb|X05098.1|GGH2B5 Chicken histone H2B gene (pBBA-3.0) 98 3e-17
267emb|X05096.1|GGH2B3 Chicken histone H2B gene (pRR3c-3.5) 98 3e-17
268emb|X05095.1|GGH2B2 Chicken histone H2B gene (pRR2e-3.5) 98 3e-17
269gb|BC079458.1| Rattus norvegicus histone 1, H2bh, mRNA (cDNA clo... 98 3e-17
270gb|M25487.1|MUSHIS2B Mus musculus histone H2b mRNA, 3' end 98 3e-17
271gb|J00864.1|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks 98 3e-17
272dbj|D70896.1| Gallus gallus DNA for histone H2B, complete cds 98 3e-17
273ref|XM_524860.1| PREDICTED: Pan troglodytes LOC469477 (LOC469477... 96 1e-16
274ref|XM_539321.2| PREDICTED: Canis familiaris similar to histone ... 96 1e-16
275emb|CR669650.2|CNS0FFO8 Tetraodon nigroviridis full-length cDNA 96 1e-16
276ref|XM_792924.1| PREDICTED: Strongylocentrotus purpuratus simila... 96 1e-16
277emb|BX014618.1|CNS08JFY Single read from an extremity of a full-... 96 1e-16
278emb|X14731.1|CMHIST2B Duck H2B histone gene 96 1e-16
279gb|M14142.1|SUPH2B1 P.miliaris histone H2B-2.1 gene, complete cds 96 1e-16
280ref|NM_175055.2| Homo sapiens histone 3, H2bb (HIST3H2BB), mRNA 94 4e-16
281ref|XM_532763.2| PREDICTED: Canis familiaris similar to testis-s... 94 4e-16
282gb|BC100857.1| Homo sapiens cDNA clone IMAGE:40002416, partial cds 94 4e-16
283ref|XM_504425.1| Yarrowia lipolytica CLIB122, YALI0E26455g predi... 94 4e-16
284emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chr... 94 4e-16
285emb|BX013308.1|CNS08IFK Single read from an extremity of a full-... 94 4e-16
286emb|BX008532.1|CNS08EQW Single read from an extremity of a full-... 94 4e-16
287dbj|AK091220.1| Homo sapiens cDNA FLJ33901 fis, clone CTONG20083... 94 4e-16
288gb|AY131981.1| Homo sapiens histone H2B (HIST3H2BB) gene, comple... 94 4e-16
289emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 94 4e-16
290ref|XM_868991.1| PREDICTED: Bos taurus similar to Histone H2B 29... 92 2e-15
291gb|AY271238.1| Homo sapiens clone RM2-A03 putative promoter sequ... 92 2e-15
292emb|BX038797.1|CNS0923L Single read from an extremity of a full-... 92 2e-15
293gb|BC108143.1| Bos taurus similar to Histone H2B 291B, mRNA (cDN... 92 2e-15
294ref|NM_001037469.1| Bos taurus similar to Histone H2B 291B (MGC1... 92 2e-15
295dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 92 2e-15
296dbj|AP006162.2| Oryza sativa (japonica cultivar-group) genomic D... 92 2e-15
297dbj|AK106505.1| Oryza sativa (japonica cultivar-group) cDNA clon... 92 2e-15
298emb|Z59559.1|HS163A6R H.sapiens CpG island DNA genomic Mse1 frag... 92 2e-15
299gb|K01888.1|HUMH2BPS2 Human histone H2B pseudogene (lambda-HHG55) 92 2e-15
300gb|BC051872.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MG... 90 6e-15
301gb|BC107301.1| Mus musculus histone 3, H2bb, mRNA (cDNA clone MG... 90 6e-15
302gb|BC106899.1| Homo sapiens histone 1, H2bg, mRNA (cDNA clone IM... 90 6e-15
303ref|XM_518302.1| PREDICTED: Pan troglodytes similar to H2B histo... 90 6e-15
304ref|XM_518301.1| PREDICTED: Pan troglodytes similar to histone H... 90 6e-15
305ref|XM_518294.1| PREDICTED: Pan troglodytes similar to H2B histo... 90 6e-15
306ref|XM_527258.1| PREDICTED: Pan troglodytes similar to histone H... 90 6e-15
307gb|BC107302.1| Mus musculus histone 3, H2bb, mRNA (cDNA clone MG... 90 6e-15
308gb|BC106720.1| Homo sapiens histone 1, H2bo, mRNA (cDNA clone MG... 90 6e-15
309ref|XM_525086.1| PREDICTED: Pan troglodytes similar to Histone H... 90 6e-15
310ref|XM_525085.1| PREDICTED: Pan troglodytes similar to histone 3... 90 6e-15
311ref|NM_017445.1| Homo sapiens H2B histone family, member S (H2BF... 90 6e-15
312ref|NM_178194.2| Mus musculus histone 1, H2be (Hist1h2be), mRNA 90 6e-15
313ref|NM_003527.4| Homo sapiens histone 1, H2bo (HIST1H2BO), mRNA 90 6e-15
314ref|XM_608099.2| PREDICTED: Bos taurus similar to Histone H2B 29... 90 6e-15
315ref|XM_868522.1| PREDICTED: Bos taurus similar to Histone H2B 29... 90 6e-15
316gb|BC051921.1| Mus musculus histone 3, H2ba, mRNA (cDNA clone MG... 90 6e-15
317gb|BC000893.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MG... 90 6e-15
318ref|XM_868693.1| PREDICTED: Bos taurus similar to H2B histone fa... 90 6e-15
319ref|NG_001335.1| Homo sapiens genomic large histone family clust... 90 6e-15
320ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@... 90 6e-15
321ref|NM_080593.1| Homo sapiens histone 1, H2bk (HIST1H2BK), mRNA 90 6e-15
322ref|NM_003526.2| Homo sapiens histone 1, H2bc (HIST1H2BC), mRNA 90 6e-15
323gb|BC009612.1| Homo sapiens histone 1, H2bc, mRNA (cDNA clone IM... 90 6e-15
324gb|BC038854.1| Homo sapiens SECIS binding protein 2, mRNA (cDNA ... 90 6e-15
325gb|AF531298.1| Homo sapiens histone H2B (HIST1H2BO) gene, comple... 90 6e-15
326gb|AF531294.1| Homo sapiens histone H2B (HIST1H2BK) gene, comple... 90 6e-15
327gb|AF531286.1| Homo sapiens histone H2B (HIST1H2BC) gene, comple... 90 6e-15
328emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 o... 90 6e-15
329emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chro... 90 6e-15
330emb|AL021807.2|HS86C11 Human DNA sequence from clone RP1-86C11 o... 90 6e-15
331emb|X57138.1|HSH2B2H2 Human H2B.2 and H2A.1 genes for Histone H2... 90 6e-15
332emb|X06642.1|SPH2BAL3 Strongylocentrotus purpuratus late histone... 90 6e-15
333emb|AJ223352.1|HSAJ3352 Homo sapiens mRNA for for histone H2B, c... 90 6e-15
334gb|BC064959.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MG... 90 6e-15
335gb|BC069889.1| Mus musculus histone 1, H2be, mRNA (cDNA clone MG... 90 6e-15
336emb|CR859861.1| Pongo pygmaeus mRNA; cDNA DKFZp469M064 (from clo... 90 6e-15
337dbj|AK093747.1| Homo sapiens cDNA FLJ36428 fis, clone THYMU20115... 90 6e-15
338gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, h... 90 6e-15
339dbj|AK049948.1| Mus musculus adult male hippocampus cDNA, RIKEN ... 90 6e-15
340ref|NG_002618.1| Homo sapiens histone 3, H2ba (HIST3H2BA) pseudo... 90 6e-15
341dbj|AK030546.1| Mus musculus adult male pituitary gland cDNA, RI... 90 6e-15
342dbj|AK018765.1| Mus musculus adult male cerebellum cDNA, RIKEN f... 90 6e-15
343ref|NM_030082.1| Mus musculus histone 3, H2ba (Hist3h2ba), mRNA 90 6e-15
344gb|AY131980.1| Homo sapiens histone H2B (HIST3H2BA) pseudogene, ... 90 6e-15
345gb|AY158942.1| Mus musculus histone protein Hist3h2ba gene, comp... 90 6e-15
346gb|AY158936.1| Mus musculus histone protein Hist1h2be gene, comp... 90 6e-15
347dbj|AB041017.1| Homo sapiens H2BFS gene for H2B histone family p... 90 6e-15
348ref|NM_214554.1| Strongylocentrotus purpuratus late histone L3 H... 90 6e-15
349emb|BX647290.1|HSM807434 Homo sapiens mRNA; cDNA DKFZp781B2436 (... 90 6e-15
350emb|X05097.1|GGH2B4 Chicken histone H2B gene (pPP2d-2.3) 90 6e-15
351emb|AJ329611.1|HSA329611 Homo sapiens genomic sequence surroundi... 90 6e-15
352emb|Z57636.1|HS187F7F H.sapiens CpG island DNA genomic Mse1 frag... 90 6e-15
353gb|BC111653.1| Bos taurus cDNA clone MGC:137516 IMAGE:8026091, c... 90 6e-15
354dbj|AP001751.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 90 6e-15
355ref|NG_000827.2| Homo sapiens genomic histone family microcluste... 90 6e-15
356emb|AL662809.14| Mouse DNA sequence from clone RP23-441I8 on chr... 90 6e-15
357gb|BC108737.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MG... 90 6e-15
358emb|Z80783.1|HSH2BL H.sapiens H2B/l gene 90 6e-15
359emb|AJ343028.1|HSA343028 Homo sapiens genomic sequence surroundi... 90 6e-15
360gb|M14143.1|SUPH2A1 P.miliaris histone H2B-2.2 gene, complete cds 90 6e-15
361dbj|AP001051.1| Homo sapiens genomic DNA, chromosome 21, clone:K... 90 6e-15
362dbj|AP001050.1| Homo sapiens genomic DNA, chromosome 21, clone:K... 90 6e-15
363ref|NM_100653.2| Arabidopsis thaliana DNA binding AT1G07790 mRNA... 88 2e-14
364ref|XM_527282.1| PREDICTED: Pan troglodytes similar to HIST1H2BM... 88 2e-14
365ref|XM_581429.2| PREDICTED: Bos taurus similar to Histone H2B 29... 88 2e-14
366ref|XM_602005.2| PREDICTED: Bos taurus similar to H2B histone fa... 88 2e-14
367ref|XM_608871.1| PREDICTED: Bos taurus similar to Histone H2B 29... 88 2e-14
368ref|XM_867420.1| PREDICTED: Bos taurus similar to Histone H2B 29... 88 2e-14
369ref|XM_604423.1| PREDICTED: Bos taurus similar to H2B histone fa... 88 2e-14
370ref|XM_609153.2| PREDICTED: Bos taurus similar to Histone H2B 29... 88 2e-14
371ref|XM_593475.2| PREDICTED: Bos taurus similar to Histone H2B 29... 88 2e-14
372ref|XM_599845.2| PREDICTED: Bos taurus similar to Histone H2B 29... 88 2e-14
373ref|XM_870240.1| PREDICTED: Bos taurus similar to Histone H2B 29... 88 2e-14
374emb|CR708520.2|CNS0G9N8 Tetraodon nigroviridis full-length cDNA 88 2e-14
375emb|X07763.1|GGH2AB8 Chicken DNA for pCH3.5E histone H2A/H2B seq... 88 2e-14
376emb|X03017.1|XLHISH1 Xenopus laevis histone gene cluster Xlh1 wi... 88 2e-14
377gb|DQ118972.1| Toxoplasma gondii histone 2B variant 2 mRNA, comp... 88 2e-14
378gb|AY133638.1| Arabidopsis thaliana At1g07790/F24B9_10 mRNA, com... 88 2e-14
379dbj|AB220463.1| Macaca fascicularis mRNA, clone QflA-14990: simi... 88 2e-14
380gb|AY070760.1| Arabidopsis thaliana At1g07790/F24B9_10 mRNA, com... 88 2e-14
381gb|AF332446.1| Arabidopsis thaliana clone C00142 (p) putative hi... 88 2e-14
382gb|AC007583.2|F24B9 Arabidopsis thaliana chromosome 1 BAC F24B9 ... 88 2e-14
383dbj|D10396.1|RICT20 Oryza sativa mRNA for histone H2B (T20 gene)... 88 2e-14
384gb|AF130878.1|AF130878 Arabidopsis thaliana phosphoribosylanthra... 88 2e-14
385gb|M84798.1|TIGH2B2A Tigriopus californicus histone H2B-2 gene, ... 88 2e-14
386gb|M21286.1|XELHX1H1 X.laevis histone H1B, H2A, H2B, and H4 gene... 88 2e-14
387ref|NM_003522.3| Homo sapiens histone 1, H2bf (HIST1H2BF), mRNA 86 1e-13
388gb|AF531289.1| Homo sapiens histone H2B (HIST1H2BF) gene, comple... 86 1e-13
389gb|BC056264.1| Homo sapiens histone 1, H2bg, mRNA (cDNA clone IM... 86 1e-13
390emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 o... 86 1e-13
391emb|BX047441.1|CNS098RP Single read from an extremity of a full-... 86 1e-13
392emb|BX026873.1|CNS08SWD Single read from an extremity of a full-... 86 1e-13
393emb|X02916.1|SGH4H2B Rainbow trout histone H4 and H2B genes 86 1e-13
394emb|AJ556871.1|XLA556871 Expression vector pET3-H2B H2B gene for... 86 1e-13
395gb|BC096123.1| Homo sapiens histone 1, H2bf, mRNA (cDNA clone MG... 86 1e-13
396gb|BC096120.1| Homo sapiens histone 1, H2bf, mRNA (cDNA clone MG... 86 1e-13
397ref|XM_341530.2| PREDICTED: Rattus norvegicus histone 1, H2bm (p... 86 1e-13
398dbj|AP006674.1| Lotus japonicus genomic DNA, chromosome 3, clone... 86 1e-13
399gb|J00981.1|XELHIS2BL xenopus laevis h2b histone gene & flanks 86 1e-13
400emb|Z80779.1|HSH2BG H.sapiens H2B/g gene 86 1e-13
401ref|XM_518295.1| PREDICTED: Pan troglodytes similar to H2B histo... 84 4e-13
402gb|U62673.1|MMU62673 Mus musculus histone H2a(A)-613, histone H2... 84 4e-13
403gb|AY088636.1| Arabidopsis thaliana clone 8711 mRNA, complete se... 84 4e-13
404gb|U34757.2|ATU34757 Arabidopsis thaliana phosphoribosylanthrani... 84 4e-13
405ref|XM_527280.1| PREDICTED: Pan troglodytes similar to ribosomal... 82 2e-12
406ref|XM_518287.1| PREDICTED: Pan troglodytes similar to Histone H... 82 2e-12
407ref|NM_206882.1| Mus musculus histone 3, H2bb (Hist3h2bb), mRNA 82 2e-12
408ref|XM_605634.1| PREDICTED: Bos taurus similar to Histone H2B 29... 82 2e-12
409ref|XM_870058.1| PREDICTED: Bos taurus similar to Histone H2B 29... 82 2e-12
410ref|XM_865948.1| PREDICTED: Bos taurus similar to Histone H2B 29... 82 2e-12
411ref|NM_021063.2| Homo sapiens histone 1, H2bd (HIST1H2BD), trans... 82 2e-12
412ref|NM_138720.1| Homo sapiens histone 1, H2bd (HIST1H2BD), trans... 82 2e-12
413ref|NM_003519.3| Homo sapiens histone 1, H2bl (HIST1H2BL), mRNA 82 2e-12
414gb|AF531295.1| Homo sapiens histone H2B (HIST1H2BL) gene, comple... 82 2e-12
415gb|AF531287.1| Homo sapiens histone H2B (HIST1H2BD) gene, comple... 82 2e-12
416emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 o... 82 2e-12
417emb|Z83740.1|HSZ83740 H.sapiens hH2B/c gene 82 2e-12
418emb|X07762.1|GGH2AB7 Chicken DNA for pCH22.0B histone H2A/H2B se... 82 2e-12
419emb|AJ223353.1|HSAJ3353 Homo sapiens mRNA for histone H2B, clone... 82 2e-12
420gb|BC095697.1| Danio rerio zgc:112234, mRNA (cDNA clone MGC:1122... 82 2e-12
421gb|BC096122.1| Homo sapiens histone 1, H2bd, transcript variant ... 82 2e-12
422gb|BC002842.2| Homo sapiens histone 1, H2bd, transcript variant ... 82 2e-12
423ref|XM_686839.1| PREDICTED: Danio rerio similar to histone 2, H2... 82 2e-12
424ref|XM_693375.1| PREDICTED: Danio rerio similar to histone 2, H2... 82 2e-12
425dbj|AB168579.1| Macaca fascicularis testis cDNA clone: QtsA-1317... 82 2e-12
426gb|BC109769.1| Bos taurus cDNA clone MGC:133753 IMAGE:8062200, c... 82 2e-12
427ref|NM_001024398.1| Danio rerio zgc:112234 (zgc:112234), mRNA 82 2e-12
428gb|BC093761.1| Homo sapiens histone 1, H2bl, mRNA (cDNA clone MG... 82 2e-12
429gb|BC093759.1| Homo sapiens histone 1, H2bl, mRNA (cDNA clone MG... 82 2e-12
430gb|AY158943.1| Mus musculus histone protein Hist3h2bb gene, comp... 82 2e-12
431gb|AY158926.1| Mus musculus histone protein Hist3h2a gene, compl... 82 2e-12
432gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, comp... 82 2e-12
433gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, comp... 82 2e-12
434gb|M60751.1|HUMHISAF Human histone H2B.1 (H2B) gene, complete cds 82 2e-12
435ref|XM_595386.2| PREDICTED: Bos taurus similar to Histone H2B F ... 80 6e-12
436ref|XM_867424.1| PREDICTED: Bos taurus similar to Histone H2B 29... 80 6e-12
437ref|XM_605298.2| PREDICTED: Bos taurus similar to Histone H2B 29... 80 6e-12
438ref|XM_865334.1| PREDICTED: Bos taurus similar to Histone H2B 29... 80 6e-12
439ref|XM_869222.1| PREDICTED: Bos taurus similar to histone 1, H2b... 80 6e-12
440gb|BC067486.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone MG... 80 6e-12
441gb|BC067489.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone MG... 80 6e-12
442gb|BC067488.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone MG... 80 6e-12
443gb|BC067487.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone MG... 80 6e-12
444ref|XM_601249.2| PREDICTED: Bos taurus similar to H2B histone fa... 80 6e-12
445ref|XM_599789.2| PREDICTED: Bos taurus similar to H2B histone fa... 80 6e-12
446ref|NM_003521.2| Homo sapiens histone 1, H2bm (HIST1H2BM), mRNA 80 6e-12
447gb|AF531296.1| Homo sapiens histone H2B (HIST1H2BM) gene, comple... 80 6e-12
448emb|AL049822.30|HSJ160A22 Human DNA sequence from clone RP1-160A... 80 6e-12
449gb|AC092896.9| Homo sapiens 3 BAC RP11-274J15 (Roswell Park Canc... 80 6e-12
450emb|BX022107.1|CNS08P7Z Single read from an extremity of a full-... 80 6e-12
451emb|BX021770.1|CNS08OYM Single read from an extremity of a full-... 80 6e-12
452emb|Z83738.1|HSZ83738 H.sapiens hH2B/e gene 80 6e-12
453emb|Z46225.1|HTHISH2B H.tubulosa gene encoding histone H2B 80 6e-12
454gb|BC058562.1| Mus musculus cDNA clone IMAGE:6389884 80 6e-12
455gb|BC047137.1| Mus musculus histone 2, H2be, mRNA (cDNA clone MG... 80 6e-12
456gb|U64845.1| Caenorhabditis elegans cosmid F45F2, complete sequence 80 6e-12
457dbj|AK143398.1| Mus musculus 2 days pregnant adult female ovary ... 80 6e-12
458dbj|AK162494.1| Mus musculus adult male urinary bladder cDNA, RI... 80 6e-12
459dbj|AK168767.1| Mus musculus 16 days embryo kidney cDNA, RIKEN f... 80 6e-12
460dbj|AK167546.1| Mus musculus 14 days embryo liver cDNA, RIKEN fu... 80 6e-12
461dbj|AK170749.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 80 6e-12
462ref|NM_072796.1| Caenorhabditis elegans HIStone family member (h... 80 6e-12
463dbj|AK090189.1| Mus musculus 14 days embryo lung cDNA, RIKEN ful... 80 6e-12
464dbj|AK078533.1| Mus musculus 12 days embryo female mullerian duc... 80 6e-12
465gb|BC067485.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone IM... 80 6e-12
466ref|XM_577578.1| PREDICTED: Rattus norvegicus similar to H2B his... 80 6e-12
467gb|AY158940.1| Mus musculus histone protein Hist2h2be gene, comp... 80 6e-12
468emb|Z58592.1|HS45C9F H.sapiens CpG island DNA genomic Mse1 fragm... 80 6e-12
469gb|BC066244.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone MG... 80 6e-12
470gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, comp... 80 6e-12
471gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, comple... 80 6e-12
472ref|NM_178214.2| Mus musculus histone 2, H2be (Hist2h2be), mRNA 80 6e-12
473ref|XM_527996.1| PREDICTED: Pan troglodytes similar to Histone H... 78 2e-11
474ref|XM_866923.1| PREDICTED: Bos taurus similar to testis-specifi... 78 2e-11
475gb|AY769467.1| Stylonychia lemnae macronuclear development prote... 78 2e-11
476ref|XM_752559.1| Ustilago maydis 521 histone H2B (UM01505.1) par... 78 2e-11
477emb|BX032828.1|CNS08XHS Single read from an extremity of a full-... 78 2e-11
478emb|BX009212.1|CNS08F9S Single read from an extremity of a full-... 78 2e-11
479ref|XM_683203.1| PREDICTED: Danio rerio similar to histone 1, H2... 78 2e-11
480emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 ... 78 2e-11
481ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudo... 76 9e-11
482emb|AJ494848.1|ODI494848 Oikopleura dioica H3.1 gene, H4.1 gene,... 76 9e-11
483ref|XM_227459.1| PREDICTED: Rattus norvegicus similar to histone... 76 9e-11
484gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, comp... 76 9e-11
485gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, comp... 76 9e-11
486gb|AY158910.1| Mus musculus histone protein Hist1h2aj pseudogene... 76 9e-11
487emb|Z57637.1|HS187F7R H.sapiens CpG island DNA genomic Mse1 frag... 76 9e-11
488gb|M84799.1|TIGH2B3A Tigriopus californicus histone H2B-3 gene, ... 76 9e-11
489ref|XM_518889.1| PREDICTED: Pan troglodytes similar to histone H... 74 4e-10
490ref|XM_518288.1| PREDICTED: Pan troglodytes similar to Histone H... 74 4e-10
491gb|BC101411.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG... 74 4e-10
492gb|BC101413.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG... 74 4e-10
493gb|BC101412.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG... 74 4e-10
494ref|XM_598166.2| PREDICTED: Bos taurus similar to Histone H2B 29... 74 4e-10
495ref|XM_868231.1| PREDICTED: Bos taurus similar to testis-specifi... 74 4e-10
496ref|XM_866798.1| PREDICTED: Bos taurus similar to Histone H2B 29... 74 4e-10
497ref|NM_003524.2| Homo sapiens histone 1, H2bh (HIST1H2BH), mRNA 74 4e-10
498ref|NM_003520.3| Homo sapiens histone 1, H2bn (HIST1H2BN), mRNA 74 4e-10
499gb|BC011372.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone IM... 74 4e-10
500gb|AF531297.1| Homo sapiens histone H2B (HIST1H2BN) gene, comple... 74 4e-10

>gb|BT009535.1| Triticum aestivum clone wr1.pk0136.c2:fis, full insert mRNA
           sequence
          Length = 940

 Score =  412 bits (208), Expect = e-112
 Identities = 247/260 (95%)
 Strand = Plus / Minus

                                                                       
Query: 132 agcctaggacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggc 191
           ||||||||| ||||||||||||||||| |||||||||||||| |||||||||||||||||
Sbjct: 782 agcctaggatgaggtgaacttggtgacggccttggtgccctctgagacggcgtgcttggc 723

                                                                       
Query: 192 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtggg 251
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 722 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtggg 663

                                                                       
Query: 252 cttcttgttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgtt 311
           |||||||||||| |  |||||||||||||| || || ||||||||||| || ||||||||
Sbjct: 662 cttcttgttgtagcgggcgagcttggcggactccccagcgagcttctcgaagatgtcgtt 603

                                                                       
Query: 312 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctg 371
           |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 602 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctg 543

                               
Query: 372 cttgagcaccttgaagatgt 391
           ||||||||||||||||||||
Sbjct: 542 cttgagcaccttgaagatgt 523



to top

>emb|X59873.1|TAHISTH2B T.aestivum L mRNA for histone H2B
          Length = 712

 Score =  408 bits (206), Expect = e-111
 Identities = 239/250 (95%)
 Strand = Plus / Minus

                                                                       
Query: 142 gaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccg 201
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 516 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 457

                                                                       
Query: 202 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 456 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 397

                                                                       
Query: 262 tacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggag 321
           |||| ||| ||||||||||  ||||||||||||||||| || ||||||||||||||||||
Sbjct: 396 taccgcgccagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 337

                                                                       
Query: 322 ttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacc 381
           |||||||||||||||||||||||||||||||||||||| || || |||||||| ||||||
Sbjct: 336 ttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttcagcacc 277

                     
Query: 382 ttgaagatgt 391
           ||||||||||
Sbjct: 276 ttgaagatgt 267



to top

>dbj|D37945.1|WHTPH2B15D Triticum aestivum gene for protein H2B153, complete cds
          Length = 3209

 Score =  408 bits (206), Expect = e-111
 Identities = 239/250 (95%)
 Strand = Plus / Minus

                                                                        
Query: 142  gaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccg 201
            ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1698 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcct 1639

                                                                        
Query: 202  gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 261
            |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 1638 gggaggacgaggcggacggaggtctggatctcccgggatgtgatggtgggcttcttgttg 1579

                                                                        
Query: 262  tacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggag 321
            |||| ||| ||||||||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 1578 taccgcgccagcttggcggactcgccggcgagcttctcgaagatgtcgttgatgaaggag 1519

                                                                        
Query: 322  ttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacc 381
            ||| ||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||
Sbjct: 1518 ttcgtgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttcagcacc 1459

                      
Query: 382  ttgaagatgt 391
            ||||||||||
Sbjct: 1458 ttgaagatgt 1449



to top

>dbj|D37943.1|WHTPH2B8B Triticum aestivum mRNA for protein H2B-8, complete cds
          Length = 592

 Score =  408 bits (206), Expect = e-111
 Identities = 239/250 (95%)
 Strand = Plus / Minus

                                                                       
Query: 142 gaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccg 201
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 472 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 413

                                                                       
Query: 202 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 261
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 412 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 353

                                                                       
Query: 262 tacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggag 321
           || |  |||||||||||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 352 tagcgggcgagcttggcggactcgccggcgagcttctcgaagatgtcgttgatgaaggag 293

                                                                       
Query: 322 ttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacc 381
           |||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||
Sbjct: 292 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 233

                     
Query: 382 ttgaagatgt 391
           ||||||||||
Sbjct: 232 ttgaagatgt 223



to top

>gb|BT016429.1| Zea mays clone Contig262 mRNA sequence
          Length = 564

 Score =  404 bits (204), Expect = e-110
 Identities = 246/260 (94%)
 Strand = Plus / Minus

                                                                       
Query: 132 agcctaggacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggc 191
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 407 agcctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggc 348

                                                                       
Query: 192 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtggg 251
           |||||| ||||||||||||||||| ||||||||||||||||| ||||| |||||||||||
Sbjct: 347 gagctccccggggaggacgaggcgcacggaggtctggatctcacgggaggtgatggtggg 288

                                                                       
Query: 252 cttcttgttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgtt 311
           |||||||||||||| ||||||||||||||  ||| ||||||||||||| || ||||||||
Sbjct: 287 cttcttgttgtaccgcgcgagcttggcggcctcggcggcgagcttctcgaagatgtcgtt 228

                                                                       
Query: 312 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctg 371
           |||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||
Sbjct: 227 gatgaaggagttcatgatggacatggccttagaggagatgccgatgtccgggtgcacctg 168

                               
Query: 372 cttgagcaccttgaagatgt 391
           ||| ||||||||||||||||
Sbjct: 167 cttcagcaccttgaagatgt 148



to top

>emb|X57313.1|ZMH2B221 Z.mays mRNA for H2B histone (clone cH2B221)
          Length = 653

 Score =  404 bits (204), Expect = e-110
 Identities = 246/260 (94%)
 Strand = Plus / Minus

                                                                       
Query: 132 agcctaggacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggc 191
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 473 agcctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggc 414

                                                                       
Query: 192 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtggg 251
           |||||| ||||||||||||||||| ||||||||||||||||| ||||| |||||||||||
Sbjct: 413 gagctccccggggaggacgaggcgcacggaggtctggatctcacgggaggtgatggtggg 354

                                                                       
Query: 252 cttcttgttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgtt 311
           |||||||||||||| ||||||||||||||  ||| ||||||||||||| || ||||||||
Sbjct: 353 cttcttgttgtaccgcgcgagcttggcggcctcggcggcgagcttctcgaagatgtcgtt 294

                                                                       
Query: 312 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctg 371
           |||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||
Sbjct: 293 gatgaaggagttcatgatggacatggccttagaggagatgccgatgtccgggtgcacctg 234

                               
Query: 372 cttgagcaccttgaagatgt 391
           ||| ||||||||||||||||
Sbjct: 233 cttcagcaccttgaagatgt 214



to top

>dbj|D37942.1|WHTPH2B6A Triticum aestivum mRNA for protein H2B-6, complete cds
          Length = 564

 Score =  398 bits (201), Expect = e-108
 Identities = 243/257 (94%)
 Strand = Plus / Minus

                                                                       
Query: 135 ctaggacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgag 194
           |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 414 ctaggaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 355

                                                                       
Query: 195 ctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggctt 254
           ||||||||||||||||||||| |||| |||||||||||||||||| ||||||||||||||
Sbjct: 354 ctcgccggggaggacgaggcgcacggcggtctggatctcccgggaggtgatggtgggctt 295

                                                                       
Query: 255 cttgttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgat 314
           ||||||||| | ||| |||||||| || ||||||||||||||||| || |||||||||||
Sbjct: 294 cttgttgtagcgcgccagcttggccgactcgccggcgagcttctcgaagatgtcgttgat 235

                                                                       
Query: 315 gaaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgctt 374
           ||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||
Sbjct: 234 gaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgctt 175

                            
Query: 375 gagcaccttgaagatgt 391
           |||||||||||||||||
Sbjct: 174 gagcaccttgaagatgt 158



to top

>ref|XM_483094.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 453

 Score =  396 bits (200), Expect = e-107
 Identities = 236/248 (95%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 444 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 385

                                                                       
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
           |||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||
Sbjct: 384 gaggacgaggcggacggaggtctggatctccctggaggtgatggtgggcttcttgttgta 325

                                                                       
Query: 264 cctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggagtt 323
           ||| |||||||||||||  ||||||||||||||||| || |||||||||||||| |||||
Sbjct: 324 cctggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaacgagtt 265

                                                                       
Query: 324 catgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacctt 383
           |||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||||||
Sbjct: 264 catgattgacatggccttggaggagatcccgatgtccgggtgcacctgcttgagcacctt 205

                   
Query: 384 gaagatgt 391
           ||||||||
Sbjct: 204 gaagatgt 197



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  396 bits (200), Expect = e-107
 Identities = 236/248 (95%)
 Strand = Plus / Minus

                                                                            
Query: 144      ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
                ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24254615 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 24254556

                                                                            
Query: 204      gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
                |||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||
Sbjct: 24254555 gaggacgaggcggacggaggtctggatctccctggaggtgatggtgggcttcttgttgta 24254496

                                                                            
Query: 264      cctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggagtt 323
                ||| |||||||||||||  ||||||||||||||||| || |||||||||||||| |||||
Sbjct: 24254495 cctggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaacgagtt 24254436

                                                                            
Query: 324      catgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacctt 383
                |||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||||||
Sbjct: 24254435 catgattgacatggccttggaggagatcccgatgtccgggtgcacctgcttgagcacctt 24254376

                        
Query: 384      gaagatgt 391
                ||||||||
Sbjct: 24254375 gaagatgt 24254368



 Score =  186 bits (94), Expect = 4e-44
 Identities = 142/158 (89%)
 Strand = Plus / Minus

                                                                            
Query: 145      gtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 204
                |||||||||||||| ||||| |  |||||||||||||| |||||||||||||||||| ||
Sbjct: 24251113 gtgaacttggtgacggccttagcaccctcggagacggcatgcttggcgagctcgccgagg 24251054

                                                                            
Query: 205      aggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtac 264
                |||||||||||||| |||||||||||||||| ||| ||||||||||||||||||||||||
Sbjct: 24251053 aggacgaggcggacagaggtctggatctccctggaggtgatggtgggcttcttgttgtac 24250994

                                                      
Query: 265      ctcgcgagcttggcggattcgccggcgagcttctcaaa 302
                |  |||||||||||||  || ||| | |||||||||||
Sbjct: 24250993 cgggcgagcttggcggcctcaccgacaagcttctcaaa 24250956



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                                   
Query: 308      cgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgt 358
                ||||||||||||||||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 21802115 cgttgatgaaggagttcataatggacatggccttagaggatatgccaatgt 21802065



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                            
Query: 310      ttgatgaaggagttcatgatggacatggccttggaggagatgcc 353
                ||||||||||||||||||||||||||| ||||||| || |||||
Sbjct: 11770145 ttgatgaaggagttcatgatggacatgaccttggacgatatgcc 11770188



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                                   
Query: 310      ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 360
                |||||||||||||||||||||||| |  |||||| ||| |||| |||||||
Sbjct: 17523219 ttgatgaaggagttcatgatggacgtaaccttgggggatatgctgatgtcc 17523269



to top

>dbj|AP004620.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0605H02
          Length = 175547

 Score =  396 bits (200), Expect = e-107
 Identities = 236/248 (95%)
 Strand = Plus / Minus

                                                                          
Query: 144    ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 120954 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 120895

                                                                          
Query: 204    gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
              |||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||
Sbjct: 120894 gaggacgaggcggacggaggtctggatctccctggaggtgatggtgggcttcttgttgta 120835

                                                                          
Query: 264    cctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggagtt 323
              ||| |||||||||||||  ||||||||||||||||| || |||||||||||||| |||||
Sbjct: 120834 cctggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaacgagtt 120775

                                                                          
Query: 324    catgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacctt 383
              |||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||||||
Sbjct: 120774 catgattgacatggccttggaggagatcccgatgtccgggtgcacctgcttgagcacctt 120715

                      
Query: 384    gaagatgt 391
              ||||||||
Sbjct: 120714 gaagatgt 120707



 Score =  186 bits (94), Expect = 4e-44
 Identities = 142/158 (89%)
 Strand = Plus / Minus

                                                                          
Query: 145    gtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 204
              |||||||||||||| ||||| |  |||||||||||||| |||||||||||||||||| ||
Sbjct: 117452 gtgaacttggtgacggccttagcaccctcggagacggcatgcttggcgagctcgccgagg 117393

                                                                          
Query: 205    aggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtac 264
              |||||||||||||| |||||||||||||||| ||| ||||||||||||||||||||||||
Sbjct: 117392 aggacgaggcggacagaggtctggatctccctggaggtgatggtgggcttcttgttgtac 117333

                                                    
Query: 265    ctcgcgagcttggcggattcgccggcgagcttctcaaa 302
              |  |||||||||||||  || ||| | |||||||||||
Sbjct: 117332 cgggcgagcttggcggcctcaccgacaagcttctcaaa 117295



to top

>ref|NM_184399.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  392 bits (198), Expect = e-106
 Identities = 237/250 (94%)
 Strand = Plus / Minus

                                                                       
Query: 142 gaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccg 201
           |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 455 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgagctcgccg 396

                                                                       
Query: 202 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 261
           ||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||
Sbjct: 395 gggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggcttcttgttg 336

                                                                       
Query: 262 tacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggag 321
           || | ||||||||||||||| || |||||||||||||| || ||||||||||||||||||
Sbjct: 335 tagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 276

                                                                       
Query: 322 ttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacc 381
           |||||||||||||||||||||||||||||||||||||| || || |||||||||||||||
Sbjct: 275 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 216

                     
Query: 382 ttgaagatgt 391
           ||||||||||
Sbjct: 215 ttgaagatgt 206



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score =  392 bits (198), Expect = e-106
 Identities = 237/250 (94%)
 Strand = Plus / Plus

                                                                           
Query: 142     gaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccg 201
               |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2819242 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgagctcgccg 2819301

                                                                           
Query: 202     gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 261
               ||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||
Sbjct: 2819302 gggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggcttcttgttg 2819361

                                                                           
Query: 262     tacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggag 321
               || | ||||||||||||||| || |||||||||||||| || ||||||||||||||||||
Sbjct: 2819362 tagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 2819421

                                                                           
Query: 322     ttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacc 381
               |||||||||||||||||||||||||||||||||||||| || || |||||||||||||||
Sbjct: 2819422 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 2819481

                         
Query: 382     ttgaagatgt 391
               ||||||||||
Sbjct: 2819482 ttgaagatgt 2819491



 Score =  381 bits (192), Expect = e-102
 Identities = 243/260 (93%)
 Strand = Plus / Plus

                                                                           
Query: 132     agcctaggacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggc 191
               ||||||||| || ||||||||||| || ||||||||||||||||||||||||||||||||
Sbjct: 2837043 agcctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggc 2837102

                                                                           
Query: 192     gagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtggg 251
               ||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||
Sbjct: 2837103 gagctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtggg 2837162

                                                                           
Query: 252     cttcttgttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgtt 311
               |||||||||||| | ||||||||||||||| || |||||||||||||| || || || ||
Sbjct: 2837163 cttcttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatcatt 2837222

                                                                           
Query: 312     gatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctg 371
               |||||||||||||||||||||||||||||||||||||||||||||||| || || |||||
Sbjct: 2837223 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctg 2837282

                                   
Query: 372     cttgagcaccttgaagatgt 391
               ||||||||||||||||||||
Sbjct: 2837283 cttgagcaccttgaagatgt 2837302



 Score =  377 bits (190), Expect = e-101
 Identities = 235/250 (94%)
 Strand = Plus / Minus

                                                                           
Query: 142     gaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccg 201
               |||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2673933 gaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 2673874

                                                                           
Query: 202     gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 261
               |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 2673873 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 2673814

                                                                           
Query: 262     tacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggag 321
               || |  |||||||||||||| || |||||||||||||| || ||||||||||||||||||
Sbjct: 2673813 tagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 2673754

                                                                           
Query: 322     ttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacc 381
               ||||||||||||||||||||||||||||||||||| || || || |||||||||||||||
Sbjct: 2673753 ttcatgatggacatggccttggaggagatgccgatatcggggtggacctgcttgagcacc 2673694

                         
Query: 382     ttgaagatgt 391
               ||||||||||
Sbjct: 2673693 ttgaagatgt 2673684



 Score =  373 bits (188), Expect = e-100
 Identities = 242/260 (93%)
 Strand = Plus / Plus

                                                                           
Query: 132     agcctaggacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggc 191
               |||||| || || |||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 2856595 agcctaagaggaagtgaacttggtgacggccttggtgccctcggagacggcgtgcttggc 2856654

                                                                           
Query: 192     gagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtggg 251
                |||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||
Sbjct: 2856655 aagctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtggg 2856714

                                                                           
Query: 252     cttcttgttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgtt 311
               |||||||||||| |  |||||||||||||  ||| ||||||||||||| || ||||||||
Sbjct: 2856715 cttcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgtt 2856774

                                                                           
Query: 312     gatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctg 371
               |||||||||||||||||||||||||||||||||||||||||||||||| || || |||||
Sbjct: 2856775 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctg 2856834

                                   
Query: 372     cttgagcaccttgaagatgt 391
               ||||||||||||||||||||
Sbjct: 2856835 cttgagcaccttgaagatgt 2856854



 Score =  373 bits (188), Expect = e-100
 Identities = 230/244 (94%)
 Strand = Plus / Plus

                                                                           
Query: 148     aacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 207
               ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2843672 aacttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggagg 2843731

                                                                           
Query: 208     acgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtacctc 267
               |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |  
Sbjct: 2843732 acgaggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgg 2843791

                                                                           
Query: 268     gcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggagttcatg 327
               |||||||||||||| || |||||||||||||| || ||||||||||||||||||||||||
Sbjct: 2843792 gcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 2843851

                                                                           
Query: 328     atggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcaccttgaag 387
               |||||||||||||||||||||||||||||||| || || |||||||||||||||||||||
Sbjct: 2843852 atggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttgaag 2843911

                   
Query: 388     atgt 391
               ||||
Sbjct: 2843912 atgt 2843915



 Score =  369 bits (186), Expect = 5e-99
 Identities = 234/250 (93%)
 Strand = Plus / Minus

                                                                           
Query: 142     gaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccg 201
               |||||||||||||| || |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 2871648 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcaagctcgccg 2871589

                                                                           
Query: 202     gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 261
               |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 2871588 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 2871529

                                                                           
Query: 262     tacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggag 321
               || |  |||||||||||||  ||| ||||||||||||| || ||||||||||||||||||
Sbjct: 2871528 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 2871469

                                                                           
Query: 322     ttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacc 381
               |||||||||||||||||||||||||||||||||||||| || || |||||||||||||||
Sbjct: 2871468 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 2871409

                         
Query: 382     ttgaagatgt 391
               ||||||||||
Sbjct: 2871408 ttgaagatgt 2871399



 Score =  369 bits (186), Expect = 5e-99
 Identities = 234/250 (93%)
 Strand = Plus / Minus

                                                                           
Query: 142     gaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccg 201
               |||||||| || ||||| |||||||||||||| |||||||||||||||||||||||||||
Sbjct: 2686256 gaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccg 2686197

                                                                           
Query: 202     gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 261
               |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 2686196 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 2686137

                                                                           
Query: 262     tacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggag 321
               || |  |||||||||||||| || |||||||||||||| || ||||| ||||||||||||
Sbjct: 2686136 tagcgggcgagcttggcggactctccggcgagcttctcgaagatgtcattgatgaaggag 2686077

                                                                           
Query: 322     ttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacc 381
               |||||||||||||||||||||||||||||||||||||| || || |||||||||||||||
Sbjct: 2686076 ttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcacc 2686017

                         
Query: 382     ttgaagatgt 391
               ||||||||||
Sbjct: 2686016 ttgaagatgt 2686007



 Score =  301 bits (152), Expect = 9e-79
 Identities = 224/248 (90%)
 Strand = Plus / Plus

                                                                            
Query: 144      ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
                ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 17421734 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 17421793

                                                                            
Query: 204      gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
                ||||||||||||||||||||||| |||||| ||||| |||  | ||||||||||||||||
Sbjct: 17421794 gaggacgaggcggacggaggtctagatctcgcgggaggtggcgatgggcttcttgttgta 17421853

                                                                            
Query: 264      cctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggagtt 323
                 |  ||||| | |||||  ||    ||||||||||| || ||||||||||||||||||||
Sbjct: 17421854 gcgggcgaggtgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 17421913

                                                                            
Query: 324      catgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacctt 383
                |||||| |||||||||||||||||||||||||||||||| ||||||||||| || |||||
Sbjct: 17421914 catgatcgacatggccttggaggagatgccgatgtccgggtgcacctgcttcaggacctt 17421973

                        
Query: 384      gaagatgt 391
                ||||||||
Sbjct: 17421974 gaagatgt 17421981



 Score =  248 bits (125), Expect = 1e-62
 Identities = 221/253 (87%)
 Strand = Plus / Plus

                                                                            
Query: 139      gacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcg 198
                ||||| |||||||||||||| |||||||||||||| ||||||||||||||||||||||||
Sbjct: 36007436 gacgacgtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagctcg 36007495

                                                                            
Query: 199      ccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttg 258
                ||||||||||||||||| || |||||||||||||| ||||| |||||||| |||||||||
Sbjct: 36007496 ccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttcttg 36007555

                                                                            
Query: 259      ttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaag 318
                ||||| |  |||||   |||||  ||   |||||||||||| || || ||||||||||| 
Sbjct: 36007556 ttgtagcgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatgaac 36007615

                                                                            
Query: 319      gagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagc 378
                ||||||||||| |||||||||||||| || || ||||| || || |||||||||||||| 
Sbjct: 36007616 gagttcatgatcgacatggccttggacgatatcccgatatcgggatgcacctgcttgagg 36007675

                             
Query: 379      accttgaagatgt 391
                |||||||| ||||
Sbjct: 36007676 accttgaaaatgt 36007688



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 45/49 (91%)
 Strand = Plus / Plus

                                                                 
Query: 292      agcttctcaaaaatgtcgttgatgaaggagttcatgatggacatggcct 340
                |||||||| |||| ||||||||||||||| |||||||| ||||||||||
Sbjct: 30942127 agcttctcgaaaacgtcgttgatgaaggatttcatgatagacatggcct 30942175



to top

>dbj|AP003045.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0030H07
          Length = 168253

 Score =  392 bits (198), Expect = e-106
 Identities = 237/250 (94%)
 Strand = Plus / Plus

                                                                         
Query: 142   gaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccg 201
             |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 26240 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgagctcgccg 26299

                                                                         
Query: 202   gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 261
             ||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||
Sbjct: 26300 gggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggcttcttgttg 26359

                                                                         
Query: 262   tacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggag 321
             || | ||||||||||||||| || |||||||||||||| || ||||||||||||||||||
Sbjct: 26360 tagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 26419

                                                                         
Query: 322   ttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacc 381
             |||||||||||||||||||||||||||||||||||||| || || |||||||||||||||
Sbjct: 26420 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 26479

                       
Query: 382   ttgaagatgt 391
             ||||||||||
Sbjct: 26480 ttgaagatgt 26489



 Score =  381 bits (192), Expect = e-102
 Identities = 243/260 (93%)
 Strand = Plus / Plus

                                                                         
Query: 132   agcctaggacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggc 191
             ||||||||| || ||||||||||| || ||||||||||||||||||||||||||||||||
Sbjct: 44041 agcctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggc 44100

                                                                         
Query: 192   gagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtggg 251
             ||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||
Sbjct: 44101 gagctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtggg 44160

                                                                         
Query: 252   cttcttgttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgtt 311
             |||||||||||| | ||||||||||||||| || |||||||||||||| || || || ||
Sbjct: 44161 cttcttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatcatt 44220

                                                                         
Query: 312   gatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctg 371
             |||||||||||||||||||||||||||||||||||||||||||||||| || || |||||
Sbjct: 44221 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctg 44280

                                 
Query: 372   cttgagcaccttgaagatgt 391
             ||||||||||||||||||||
Sbjct: 44281 cttgagcaccttgaagatgt 44300



 Score =  373 bits (188), Expect = e-100
 Identities = 242/260 (93%)
 Strand = Plus / Plus

                                                                         
Query: 132   agcctaggacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggc 191
             |||||| || || |||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 63593 agcctaagaggaagtgaacttggtgacggccttggtgccctcggagacggcgtgcttggc 63652

                                                                         
Query: 192   gagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtggg 251
              |||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||
Sbjct: 63653 aagctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtggg 63712

                                                                         
Query: 252   cttcttgttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgtt 311
             |||||||||||| |  |||||||||||||  ||| ||||||||||||| || ||||||||
Sbjct: 63713 cttcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgtt 63772

                                                                         
Query: 312   gatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctg 371
             |||||||||||||||||||||||||||||||||||||||||||||||| || || |||||
Sbjct: 63773 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctg 63832

                                 
Query: 372   cttgagcaccttgaagatgt 391
             ||||||||||||||||||||
Sbjct: 63833 cttgagcaccttgaagatgt 63852



 Score =  373 bits (188), Expect = e-100
 Identities = 230/244 (94%)
 Strand = Plus / Plus

                                                                         
Query: 148   aacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 207
             ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 50670 aacttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggagg 50729

                                                                         
Query: 208   acgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtacctc 267
             |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |  
Sbjct: 50730 acgaggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgg 50789

                                                                         
Query: 268   gcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggagttcatg 327
             |||||||||||||| || |||||||||||||| || ||||||||||||||||||||||||
Sbjct: 50790 gcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 50849

                                                                         
Query: 328   atggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcaccttgaag 387
             |||||||||||||||||||||||||||||||| || || |||||||||||||||||||||
Sbjct: 50850 atggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttgaag 50909

                 
Query: 388   atgt 391
             ||||
Sbjct: 50910 atgt 50913



 Score =  369 bits (186), Expect = 5e-99
 Identities = 234/250 (93%)
 Strand = Plus / Minus

                                                                         
Query: 142   gaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccg 201
             |||||||||||||| || |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 78646 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcaagctcgccg 78587

                                                                         
Query: 202   gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 261
             |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 78586 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 78527

                                                                         
Query: 262   tacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggag 321
             || |  |||||||||||||  ||| ||||||||||||| || ||||||||||||||||||
Sbjct: 78526 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 78467

                                                                         
Query: 322   ttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacc 381
             |||||||||||||||||||||||||||||||||||||| || || |||||||||||||||
Sbjct: 78466 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 78407

                       
Query: 382   ttgaagatgt 391
             ||||||||||
Sbjct: 78406 ttgaagatgt 78397



to top

>dbj|AP002522.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0009G03
          Length = 163526

 Score =  392 bits (198), Expect = e-106
 Identities = 237/250 (94%)
 Strand = Plus / Plus

                                                                          
Query: 142    gaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccg 201
              |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 124919 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgagctcgccg 124978

                                                                          
Query: 202    gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 261
              ||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||
Sbjct: 124979 gggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggcttcttgttg 125038

                                                                          
Query: 262    tacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggag 321
              || | ||||||||||||||| || |||||||||||||| || ||||||||||||||||||
Sbjct: 125039 tagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 125098

                                                                          
Query: 322    ttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacc 381
              |||||||||||||||||||||||||||||||||||||| || || |||||||||||||||
Sbjct: 125099 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 125158

                        
Query: 382    ttgaagatgt 391
              ||||||||||
Sbjct: 125159 ttgaagatgt 125168



 Score =  381 bits (192), Expect = e-102
 Identities = 243/260 (93%)
 Strand = Plus / Plus

                                                                          
Query: 132    agcctaggacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggc 191
              ||||||||| || ||||||||||| || ||||||||||||||||||||||||||||||||
Sbjct: 142720 agcctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggc 142779

                                                                          
Query: 192    gagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtggg 251
              ||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||
Sbjct: 142780 gagctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtggg 142839

                                                                          
Query: 252    cttcttgttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgtt 311
              |||||||||||| | ||||||||||||||| || |||||||||||||| || || || ||
Sbjct: 142840 cttcttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatcatt 142899

                                                                          
Query: 312    gatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctg 371
              |||||||||||||||||||||||||||||||||||||||||||||||| || || |||||
Sbjct: 142900 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctg 142959

                                  
Query: 372    cttgagcaccttgaagatgt 391
              ||||||||||||||||||||
Sbjct: 142960 cttgagcaccttgaagatgt 142979



 Score =  373 bits (188), Expect = e-100
 Identities = 242/260 (93%)
 Strand = Plus / Plus

                                                                          
Query: 132    agcctaggacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggc 191
              |||||| || || |||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 162272 agcctaagaggaagtgaacttggtgacggccttggtgccctcggagacggcgtgcttggc 162331

                                                                          
Query: 192    gagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtggg 251
               |||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||
Sbjct: 162332 aagctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtggg 162391

                                                                          
Query: 252    cttcttgttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgtt 311
              |||||||||||| |  |||||||||||||  ||| ||||||||||||| || ||||||||
Sbjct: 162392 cttcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgtt 162451

                                                                          
Query: 312    gatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctg 371
              |||||||||||||||||||||||||||||||||||||||||||||||| || || |||||
Sbjct: 162452 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctg 162511

                                  
Query: 372    cttgagcaccttgaagatgt 391
              ||||||||||||||||||||
Sbjct: 162512 cttgagcaccttgaagatgt 162531



 Score =  373 bits (188), Expect = e-100
 Identities = 230/244 (94%)
 Strand = Plus / Plus

                                                                          
Query: 148    aacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 207
              ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 149349 aacttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggagg 149408

                                                                          
Query: 208    acgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtacctc 267
              |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |  
Sbjct: 149409 acgaggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgg 149468

                                                                          
Query: 268    gcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggagttcatg 327
              |||||||||||||| || |||||||||||||| || ||||||||||||||||||||||||
Sbjct: 149469 gcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 149528

                                                                          
Query: 328    atggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcaccttgaag 387
              |||||||||||||||||||||||||||||||| || || |||||||||||||||||||||
Sbjct: 149529 atggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttgaag 149588

                  
Query: 388    atgt 391
              ||||
Sbjct: 149589 atgt 149592



to top

>gb|BT017477.1| Zea mays clone EL01N0408F05.c mRNA sequence
          Length = 574

 Score =  387 bits (195), Expect = e-104
 Identities = 246/263 (93%)
 Strand = Plus / Minus

                                                                       
Query: 129 aggagcctaggacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgctt 188
           |||||| ||||||||||||||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 532 aggagcttaggacgaggtgaacttggtgacggccttggtgccctccgagacggcgtgctt 473

                                                                       
Query: 189 ggcgagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
           ||||||||||||||| || |||||||||||||||||||||||||||||||| ||||||||
Sbjct: 472 ggcgagctcgccgggtagaacgaggcggacggaggtctggatctcccgggaggtgatggt 413

                                                                       
Query: 249 gggcttcttgttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtc 308
           ||||||||||||||| |  ||||||||||| |  ||||||||||||||||| || |||||
Sbjct: 412 gggcttcttgttgtagcgggcgagcttggccgcctcgccggcgagcttctcgaagatgtc 353

                                                                       
Query: 309 gttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcac 368
           ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 352 gttgatgaatgagttcatgatggacatggccttggaggagatgccgatgtccgggtgcac 293

                                  
Query: 369 ctgcttgagcaccttgaagatgt 391
           |||||| ||||||||||||||||
Sbjct: 292 ctgcttcagcaccttgaagatgt 270



to top

>ref|NM_184371.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  377 bits (190), Expect = e-101
 Identities = 235/250 (94%)
 Strand = Plus / Minus

                                                                       
Query: 142 gaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccg 201
           |||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 455 gaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 396

                                                                       
Query: 202 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 261
           |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 395 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 336

                                                                       
Query: 262 tacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggag 321
           || |  |||||||||||||| || |||||||||||||| || ||||||||||||||||||
Sbjct: 335 tagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 276

                                                                       
Query: 322 ttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacc 381
           ||||||||||||||||||||||||||||||||||| || || || |||||||||||||||
Sbjct: 275 ttcatgatggacatggccttggaggagatgccgatatcggggtggacctgcttgagcacc 216

                     
Query: 382 ttgaagatgt 391
           ||||||||||
Sbjct: 215 ttgaagatgt 206



to top

>ref|XM_475912.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 459

 Score =  377 bits (190), Expect = e-101
 Identities = 235/250 (94%)
 Strand = Plus / Minus

                                                                       
Query: 142 gaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccg 201
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 452 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 393

                                                                       
Query: 202 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 261
           |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 392 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 333

                                                                       
Query: 262 tacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggag 321
           || |  |||||||||||||  ||| ||||||||||||| || ||||||||||||||||||
Sbjct: 332 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 273

                                                                       
Query: 322 ttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacc 381
           |||||||||||||||||||||||||||||||||||||| || || ||||||||||| |||
Sbjct: 272 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagaacc 213

                     
Query: 382 ttgaagatgt 391
           ||||||||||
Sbjct: 212 ttgaagatgt 203



to top

>gb|AC104284.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1735_C10,
              complete sequence
          Length = 187034

 Score =  377 bits (190), Expect = e-101
 Identities = 235/250 (94%)
 Strand = Plus / Minus

                                                                          
Query: 142    gaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccg 201
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 176400 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 176341

                                                                          
Query: 202    gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 261
              |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 176340 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 176281

                                                                          
Query: 262    tacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggag 321
              || |  |||||||||||||  ||| ||||||||||||| || ||||||||||||||||||
Sbjct: 176280 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 176221

                                                                          
Query: 322    ttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacc 381
              |||||||||||||||||||||||||||||||||||||| || || ||||||||||| |||
Sbjct: 176220 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagaacc 176161

                        
Query: 382    ttgaagatgt 391
              ||||||||||
Sbjct: 176160 ttgaagatgt 176151



to top

>gb|AC098832.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1268_B08,
             complete sequence
          Length = 119500

 Score =  377 bits (190), Expect = e-101
 Identities = 235/250 (94%)
 Strand = Plus / Minus

                                                                         
Query: 142   gaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccg 201
             ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 27082 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 27023

                                                                         
Query: 202   gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 261
             |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 27022 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 26963

                                                                         
Query: 262   tacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggag 321
             || |  |||||||||||||  ||| ||||||||||||| || ||||||||||||||||||
Sbjct: 26962 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 26903

                                                                         
Query: 322   ttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacc 381
             |||||||||||||||||||||||||||||||||||||| || || ||||||||||| |||
Sbjct: 26902 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagaacc 26843

                       
Query: 382   ttgaagatgt 391
             ||||||||||
Sbjct: 26842 ttgaagatgt 26833



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  377 bits (190), Expect = e-101
 Identities = 235/250 (94%)
 Strand = Plus / Minus

                                                                            
Query: 142      gaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccg 201
                ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 28392158 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 28392099

                                                                            
Query: 202      gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 261
                |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 28392098 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 28392039

                                                                            
Query: 262      tacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggag 321
                || |  |||||||||||||  ||| ||||||||||||| || ||||||||||||||||||
Sbjct: 28392038 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 28391979

                                                                            
Query: 322      ttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacc 381
                |||||||||||||||||||||||||||||||||||||| || || ||||||||||| |||
Sbjct: 28391978 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagaacc 28391919

                          
Query: 382      ttgaagatgt 391
                ||||||||||
Sbjct: 28391918 ttgaagatgt 28391909



 Score =  293 bits (148), Expect = 2e-76
 Identities = 229/256 (89%)
 Strand = Plus / Minus

                                                                            
Query: 136      taggacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagc 195
                ||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |||
Sbjct: 22480470 taggaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagc 22480411

                                                                            
Query: 196      tcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttc 255
                ||||||||||||||||| || || |||||||||||||| ||||| ||||| |||||||||
Sbjct: 22480410 tcgccggggaggacgagacgaacagaggtctggatctcgcgggaggtgattgtgggcttc 22480351

                                                                            
Query: 256      ttgttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatg 315
                ||||||||||| || ||| | ||||  ||     |||||||||| ||||||||||||| |
Sbjct: 22480350 ttgttgtacctggcaagcctcgcggcctcctgctcgagcttctcgaaaatgtcgttgacg 22480291

                                                                            
Query: 316      aaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttg 375
                ||||| ||||||||||||||||||||||||||||| || ||||| || ||||||||||||
Sbjct: 22480290 aaggaattcatgatggacatggccttggaggagattcctatgtctggatgcacctgcttg 22480231

                                
Query: 376      agcaccttgaagatgt 391
                ||||||||||||||||
Sbjct: 22480230 agcaccttgaagatgt 22480215



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 144      ggtgaacttggtgactgccttggtg 168
                |||||||||||||||||| ||||||
Sbjct: 27534236 ggtgaacttggtgactgctttggtg 27534212



to top

>dbj|AP002540.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0434B04
          Length = 167029

 Score =  377 bits (190), Expect = e-101
 Identities = 235/250 (94%)
 Strand = Plus / Minus

                                                                          
Query: 142    gaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccg 201
              |||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 123708 gaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 123649

                                                                          
Query: 202    gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 261
              |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 123648 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 123589

                                                                          
Query: 262    tacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggag 321
              || |  |||||||||||||| || |||||||||||||| || ||||||||||||||||||
Sbjct: 123588 tagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 123529

                                                                          
Query: 322    ttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacc 381
              ||||||||||||||||||||||||||||||||||| || || || |||||||||||||||
Sbjct: 123528 ttcatgatggacatggccttggaggagatgccgatatcggggtggacctgcttgagcacc 123469

                        
Query: 382    ttgaagatgt 391
              ||||||||||
Sbjct: 123468 ttgaagatgt 123459



 Score =  369 bits (186), Expect = 5e-99
 Identities = 234/250 (93%)
 Strand = Plus / Minus

                                                                          
Query: 142    gaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccg 201
              |||||||| || ||||| |||||||||||||| |||||||||||||||||||||||||||
Sbjct: 136031 gaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccg 135972

                                                                          
Query: 202    gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 261
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 135971 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 135912

                                                                          
Query: 262    tacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggag 321
              || |  |||||||||||||| || |||||||||||||| || ||||| ||||||||||||
Sbjct: 135911 tagcgggcgagcttggcggactctccggcgagcttctcgaagatgtcattgatgaaggag 135852

                                                                          
Query: 322    ttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacc 381
              |||||||||||||||||||||||||||||||||||||| || || |||||||||||||||
Sbjct: 135851 ttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcacc 135792

                        
Query: 382    ttgaagatgt 391
              ||||||||||
Sbjct: 135791 ttgaagatgt 135782



to top

>ref|NM_184403.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  375 bits (189), Expect = e-101
 Identities = 240/257 (93%)
 Strand = Plus / Minus

                                                                       
Query: 135 ctaggacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgag 194
           |||||| || ||||||||||| || |||||||||||||||||||||||||||||||||||
Sbjct: 462 ctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcgag 403

                                                                       
Query: 195 ctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggctt 254
           |||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||
Sbjct: 402 ctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggctt 343

                                                                       
Query: 255 cttgttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgat 314
           ||||||||| | ||||||||||||||| || |||||||||||||| || || || |||||
Sbjct: 342 cttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatcattgat 283

                                                                       
Query: 315 gaaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgctt 374
           ||||||||||||||||||||||||||||||||||||||||||||| || || ||||||||
Sbjct: 282 gaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgctt 223

                            
Query: 375 gagcaccttgaagatgt 391
           |||||||||||||||||
Sbjct: 222 gagcaccttgaagatgt 206



to top

>ref|NM_184405.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  373 bits (188), Expect = e-100
 Identities = 230/244 (94%)
 Strand = Plus / Minus

                                                                       
Query: 148 aacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 207
           ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 449 aacttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggagg 390

                                                                       
Query: 208 acgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtacctc 267
           |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |  
Sbjct: 389 acgaggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgg 330

                                                                       
Query: 268 gcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggagttcatg 327
           |||||||||||||| || |||||||||||||| || ||||||||||||||||||||||||
Sbjct: 329 gcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 270

                                                                       
Query: 328 atggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcaccttgaag 387
           |||||||||||||||||||||||||||||||| || || |||||||||||||||||||||
Sbjct: 269 atggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttgaag 210

               
Query: 388 atgt 391
           ||||
Sbjct: 209 atgt 206



to top

>dbj|AB075378.1| Oryza sativa OsH2B mRNA for histone H2B, complete cds
          Length = 552

 Score =  373 bits (188), Expect = e-100
 Identities = 230/244 (94%)
 Strand = Plus / Minus

                                                                       
Query: 148 aacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 207
           ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 465 aacttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggagg 406

                                                                       
Query: 208 acgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtacctc 267
           |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |  
Sbjct: 405 acgaggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgg 346

                                                                       
Query: 268 gcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggagttcatg 327
           |||||||||||||| || |||||||||||||| || ||||||||||||||||||||||||
Sbjct: 345 gcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 286

                                                                       
Query: 328 atggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcaccttgaag 387
           |||||||||||||||||||||||||||||||| || || |||||||||||||||||||||
Sbjct: 285 atggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttgaag 226

               
Query: 388 atgt 391
           ||||
Sbjct: 225 atgt 222



to top

>ref|NM_184407.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  371 bits (187), Expect = 1e-99
 Identities = 232/247 (93%)
 Strand = Plus / Minus

                                                                       
Query: 145 gtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 204
           |||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 452 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccgggg 393

                                                                       
Query: 205 aggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtac 264
           |||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 392 aggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtag 333

                                                                       
Query: 265 ctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggagttc 324
           |  |||||||||||||  ||| ||||||||||||| || |||||||||||||||||||||
Sbjct: 332 cgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggagttc 273

                                                                       
Query: 325 atgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcaccttg 384
           ||||||||||||||||||||||||||||||||||| || || ||||||||||||||||||
Sbjct: 272 atgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttg 213

                  
Query: 385 aagatgt 391
           |||||||
Sbjct: 212 aagatgt 206



to top

>ref|NM_184409.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 468

 Score =  369 bits (186), Expect = 5e-99
 Identities = 234/250 (93%)
 Strand = Plus / Minus

                                                                       
Query: 142 gaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccg 201
           |||||||||||||| || |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 461 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcaagctcgccg 402

                                                                       
Query: 202 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 261
           |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 401 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 342

                                                                       
Query: 262 tacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggag 321
           || |  |||||||||||||  ||| ||||||||||||| || ||||||||||||||||||
Sbjct: 341 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 282

                                                                       
Query: 322 ttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacc 381
           |||||||||||||||||||||||||||||||||||||| || || |||||||||||||||
Sbjct: 281 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 222

                     
Query: 382 ttgaagatgt 391
           ||||||||||
Sbjct: 221 ttgaagatgt 212



to top

>ref|NM_184374.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  369 bits (186), Expect = 5e-99
 Identities = 234/250 (93%)
 Strand = Plus / Minus

                                                                       
Query: 142 gaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccg 201
           |||||||| || ||||| |||||||||||||| |||||||||||||||||||||||||||
Sbjct: 455 gaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccg 396

                                                                       
Query: 202 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 261
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 395 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 336

                                                                       
Query: 262 tacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggag 321
           || |  |||||||||||||| || |||||||||||||| || ||||| ||||||||||||
Sbjct: 335 tagcgggcgagcttggcggactctccggcgagcttctcgaagatgtcattgatgaaggag 276

                                                                       
Query: 322 ttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacc 381
           |||||||||||||||||||||||||||||||||||||| || || |||||||||||||||
Sbjct: 275 ttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcacc 216

                     
Query: 382 ttgaagatgt 391
           ||||||||||
Sbjct: 215 ttgaagatgt 206



to top

>gb|BT009118.1| Triticum aestivum clone wl1n.pk0003.e12:fis, full insert mRNA
           sequence
          Length = 764

 Score =  367 bits (185), Expect = 2e-98
 Identities = 236/253 (93%)
 Strand = Plus / Minus

                                                                       
Query: 139 gacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcg 198
           |||||||||||||||||||| |||||||| ||||| ||||||||||||||||||||||||
Sbjct: 548 gacgaggtgaacttggtgacggccttggtaccctccgagacggcgtgcttggcgagctcg 489

                                                                       
Query: 199 ccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttg 258
           ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 488 ccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 429

                                                                       
Query: 259 ttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaag 318
           |||||||  |||||||||||||  ||  ||||||||||||| || |||||||||||||||
Sbjct: 428 ttgtaccgggcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaag 369

                                                                       
Query: 319 gagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagc 378
           ||||||||||||||||||||||||||||||||||||||||| || ||||||||||| || 
Sbjct: 368 gagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagg 309

                        
Query: 379 accttgaagatgt 391
           |||||||||||||
Sbjct: 308 accttgaagatgt 296



to top

>gb|U08226.1|ZMU08226 Zea mays W-22 histone H2B mRNA, complete cds
          Length = 678

 Score =  359 bits (181), Expect = 4e-96
 Identities = 235/253 (92%)
 Strand = Plus / Minus

                                                                       
Query: 139 gacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcg 198
           |||||||||||||||||||| |||||||| ||||| ||||||||||||||||||||||||
Sbjct: 481 gacgaggtgaacttggtgacggccttggtaccctccgagacggcgtgcttggcgagctcg 422

                                                                       
Query: 199 ccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttg 258
           ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 421 ccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 362

                                                                       
Query: 259 ttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaag 318
           |||||||  |||||||||||||  ||  ||||||||||||| || |||||||||||||||
Sbjct: 361 ttgtaccgggcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaag 302

                                                                       
Query: 319 gagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagc 378
           ||||||||||||||||||||||||||||||||||||||||| || || |||||||| || 
Sbjct: 301 gagttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttcagg 242

                        
Query: 379 accttgaagatgt 391
           |||||||||||||
Sbjct: 241 accttgaagatgt 229



to top

>gb|BT016519.1| Zea mays clone Contig352 mRNA sequence
          Length = 789

 Score =  341 bits (172), Expect = 1e-90
 Identities = 229/248 (92%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           ||||||||||||||| |||||||| ||||||||||||||||| ||||||||||| || ||
Sbjct: 522 ggtgaacttggtgacggccttggttccctcggagacggcgtgtttggcgagctctcctgg 463

                                                                       
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
           |||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 462 gaggacgaggcgcacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 403

                                                                       
Query: 264 cctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggagtt 323
           ||  |||||||| ||||  ||||||||||||||||| || ||||||||||||||||||||
Sbjct: 402 ccgggcgagcttagcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 343

                                                                       
Query: 324 catgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacctt 383
           |||||||||||||||||||||||||||||||||||| || ||||||||||| || |||||
Sbjct: 342 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcaggacctt 283

                   
Query: 384 gaagatgt 391
           ||||||||
Sbjct: 282 gaagatgt 275



to top

>emb|X57312.1|ZMH2B214 Z.mays mRNA for H2B histone (clone cH2B214)
          Length = 580

 Score =  339 bits (171), Expect = 4e-90
 Identities = 240/263 (91%)
 Strand = Plus / Minus

                                                                       
Query: 129 aggagcctaggacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgctt 188
           |||| |||| |||||||||||||| || || ||||| |||||||||||||||||||||||
Sbjct: 465 aggatcctaagacgaggtgaacttcgtaacggccttagtgccctcggagacggcgtgctt 406

                                                                       
Query: 189 ggcgagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
           ||||||||| ||||||||||||||||| || |||||||||||||| ||||| ||||||||
Sbjct: 405 ggcgagctccccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggt 346

                                                                       
Query: 249 gggcttcttgttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtc 308
           ||||||||||||||| | ||| ||||||||||| ||| | ||||||||||| || |||||
Sbjct: 345 gggcttcttgttgtagcgcgccagcttggcggactcggccgcgagcttctcgaagatgtc 286

                                                                       
Query: 309 gttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcac 368
           |||||||||||||||||||||||||||||||||||| |||||||||||||| || |||||
Sbjct: 285 gttgatgaaggagttcatgatggacatggccttggacgagatgccgatgtcggggtgcac 226

                                  
Query: 369 ctgcttgagcaccttgaagatgt 391
           |||||| ||||||||||||||||
Sbjct: 225 ctgcttcagcaccttgaagatgt 203



to top

>emb|X69960.1|ZMH2B3A Z.mays gene for H2B histone (gH2B3)
          Length = 1728

 Score =  337 bits (170), Expect = 2e-89
 Identities = 230/250 (92%)
 Strand = Plus / Minus

                                                                       
Query: 142 gaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccg 201
           ||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 489 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 430

                                                                       
Query: 202 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 261
           |||||||||||||| || |||||||||||||| ||||| |||| ||||||||||||||| 
Sbjct: 429 gggaggacgaggcgcaccgaggtctggatctcgcgggaggtgacggtgggcttcttgtta 370

                                                                       
Query: 262 tacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggag 321
           || | ||| ||||||||||| ||| | ||||||||||| || ||||||||||||||||||
Sbjct: 369 tagcgcgccagcttggcggactcggccgcgagcttctcgaagatgtcgttgatgaaggag 310

                                                                       
Query: 322 ttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacc 381
           ||||||||||||||||||||||| |||||||||||||| || ||||||||||| ||||||
Sbjct: 309 ttcatgatggacatggccttggacgagatgccgatgtcggggtgcacctgcttcagcacc 250

                     
Query: 382 ttgaagatgt 391
           ||||||||||
Sbjct: 249 ttgaagatgt 240



to top

>gb|BT016478.1| Zea mays clone Contig311 mRNA sequence
          Length = 836

 Score =  335 bits (169), Expect = 6e-89
 Identities = 232/253 (91%)
 Strand = Plus / Minus

                                                                       
Query: 139 gacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcg 198
           ||||| |||||||||||||| ||||| ||||| || ||||||||||||||||||||||||
Sbjct: 548 gacgaagtgaacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgagctcg 489

                                                                       
Query: 199 ccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttg 258
           ||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 488 ccgggtaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 429

                                                                       
Query: 259 ttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaag 318
           ||||| |  |||||||||||||  ||  ||||||||||||| || |||||||||||||||
Sbjct: 428 ttgtagcgggcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaag 369

                                                                       
Query: 319 gagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagc 378
           || ||||||||||||||||||||||| |||||||||||||| || |||||||||||||||
Sbjct: 368 gaattcatgatggacatggccttggacgagatgccgatgtcggggtgcacctgcttgagc 309

                        
Query: 379 accttgaagatgt 391
           |||||||||||||
Sbjct: 308 accttgaagatgt 296



to top

>gb|BT016885.1| Zea mays clone Contig718 mRNA sequence
          Length = 568

 Score =  325 bits (164), Expect = 6e-86
 Identities = 227/248 (91%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           ||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||
Sbjct: 326 ggtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcgccggg 267

                                                                       
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
           |||||||||||| ||||||||||||||||| |||||||| ||||| ||||||||||||||
Sbjct: 266 gaggacgaggcgaacggaggtctggatctcgcgggacgtaatggtaggcttcttgttgta 207

                                                                       
Query: 264 cctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggagtt 323
           || ||| |||||||| |  ||  | || |||||||| || ||||||||||||||||||||
Sbjct: 206 ccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcgttgatgaaggagtt 147

                                                                       
Query: 324 catgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacctt 383
           ||||||||||||||||||||| |||||||| |||||||| ||||||||||| ||||||||
Sbjct: 146 catgatggacatggccttggacgagatgccaatgtccgggtgcacctgcttcagcacctt 87

                   
Query: 384 gaagatgt 391
           ||||||||
Sbjct: 86  gaagatgt 79



to top

>gb|BT016350.1| Zea mays clone Contig183 mRNA sequence
          Length = 706

 Score =  325 bits (164), Expect = 6e-86
 Identities = 236/260 (90%)
 Strand = Plus / Minus

                                                                       
Query: 132 agcctaggacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggc 191
           |||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 517 agcctaggccgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggc 458

                                                                       
Query: 192 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtggg 251
           |||||| ||||| ||||||||||| ||||||||||||||||| ||||| |||||||| ||
Sbjct: 457 gagctccccgggaaggacgaggcgcacggaggtctggatctcacgggaggtgatggtagg 398

                                                                       
Query: 252 cttcttgttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgtt 311
           ||||||||| || | ||||||||||||||  ||  | ||||||||||| || || |||||
Sbjct: 397 cttcttgttatagcgcgcgagcttggcggcctcagcagcgagcttctcgaagatatcgtt 338

                                                                       
Query: 312 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctg 371
            ||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 337 aatgaaggagttcatgatcgacatggccttggaggagatgccaatgtccgggtgcacctg 278

                               
Query: 372 cttgagcaccttgaagatgt 391
           ||| ||||||||||||||||
Sbjct: 277 cttcagcaccttgaagatgt 258



to top

>gb|BT017438.1| Zea mays clone EL01N0404D07.c mRNA sequence
          Length = 574

 Score =  317 bits (160), Expect = 1e-83
 Identities = 235/260 (90%)
 Strand = Plus / Minus

                                                                       
Query: 132 agcctaggacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggc 191
           |||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 309 agcctaggccgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggc 250

                                                                       
Query: 192 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtggg 251
           |||||| ||||| ||||||||||| ||||||||||||||||| ||||| |||||||| ||
Sbjct: 249 gagctccccgggaaggacgaggcgcacggaggtctggatctcacgggaggtgatggtagg 190

                                                                       
Query: 252 cttcttgttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgtt 311
           ||||||||| || | ||| ||||||||||  ||  | ||||||||||| || || |||||
Sbjct: 189 cttcttgttatagcgcgccagcttggcggcctcagcagcgagcttctcgaagatatcgtt 130

                                                                       
Query: 312 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctg 371
            ||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 129 aatgaaggagttcatgatcgacatggccttggaggagatgccaatgtccgggtgcacctg 70

                               
Query: 372 cttgagcaccttgaagatgt 391
           ||| ||||||||||||||||
Sbjct: 69  cttcagcaccttgaagatgt 50



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  317 bits (160), Expect = 1e-83
 Identities = 226/248 (91%)
 Strand = Plus / Minus

                                                                           
Query: 144     ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
               ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 9465324 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 9465265

                                                                           
Query: 204     gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
               |||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 9465264 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 9465205

                                                                           
Query: 264     cctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggagtt 323
                |  |||||   |||||  ||    ||||||||||| || ||||||||||||||||||||
Sbjct: 9465204 gcgggcgaggcgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 9465145

                                                                           
Query: 324     catgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacctt 383
               |||||| |||||||||||||||||||| ||||||||||| ||||||||||| || |||||
Sbjct: 9465144 catgatcgacatggccttggaggagattccgatgtccgggtgcacctgcttcaggacctt 9465085

                       
Query: 384     gaagatgt 391
               ||||||||
Sbjct: 9465084 gaagatgt 9465077



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 49/54 (90%)
 Strand = Plus / Plus

                                                                      
Query: 307      tcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 360
                ||||||||||||||||| ||||||| ||||||||| ||||| ||||| ||||||
Sbjct: 11567075 tcgttgatgaaggagttgatgatggtcatggccttagaggatatgccaatgtcc 11567128



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                      
Query: 290      cgagcttctcaaaaatgtcgttgatgaaggagttcatg 327
                |||||||||| || ||||||  ||||||||||||||||
Sbjct: 25627557 cgagcttctcgaagatgtcgaggatgaaggagttcatg 25627594



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                              
Query: 288      ggcgagcttctcaaaaatgtcgttgatgaa 317
                ||||||||||||||| ||||| ||||||||
Sbjct: 23486139 ggcgagcttctcaaagatgtctttgatgaa 23486110



to top

>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0002D01, from chromosome 3, complete sequence
          Length = 187589

 Score =  317 bits (160), Expect = 1e-83
 Identities = 226/248 (91%)
 Strand = Plus / Minus

                                                                          
Query: 144    ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 162724 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 162665

                                                                          
Query: 204    gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
              |||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 162664 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 162605

                                                                          
Query: 264    cctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggagtt 323
               |  |||||   |||||  ||    ||||||||||| || ||||||||||||||||||||
Sbjct: 162604 gcgggcgaggcgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 162545

                                                                          
Query: 324    catgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacctt 383
              |||||| |||||||||||||||||||| ||||||||||| ||||||||||| || |||||
Sbjct: 162544 catgatcgacatggccttggaggagattccgatgtccgggtgcacctgcttcaggacctt 162485

                      
Query: 384    gaagatgt 391
              ||||||||
Sbjct: 162484 gaagatgt 162477



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  317 bits (160), Expect = 1e-83
 Identities = 226/248 (91%)
 Strand = Plus / Minus

                                                                           
Query: 144     ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
               ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 9463445 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 9463386

                                                                           
Query: 204     gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
               |||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 9463385 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 9463326

                                                                           
Query: 264     cctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggagtt 323
                |  |||||   |||||  ||    ||||||||||| || ||||||||||||||||||||
Sbjct: 9463325 gcgggcgaggcgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 9463266

                                                                           
Query: 324     catgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacctt 383
               |||||| |||||||||||||||||||| ||||||||||| ||||||||||| || |||||
Sbjct: 9463265 catgatcgacatggccttggaggagattccgatgtccgggtgcacctgcttcaggacctt 9463206

                       
Query: 384     gaagatgt 391
               ||||||||
Sbjct: 9463205 gaagatgt 9463198



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 49/54 (90%)
 Strand = Plus / Plus

                                                                      
Query: 307      tcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 360
                ||||||||||||||||| ||||||| ||||||||| ||||| ||||| ||||||
Sbjct: 11563838 tcgttgatgaaggagttgatgatggtcatggccttagaggatatgccaatgtcc 11563891



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                      
Query: 290      cgagcttctcaaaaatgtcgttgatgaaggagttcatg 327
                |||||||||| || ||||||  ||||||||||||||||
Sbjct: 25718866 cgagcttctcgaagatgtcgaggatgaaggagttcatg 25718903



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                              
Query: 288      ggcgagcttctcaaaaatgtcgttgatgaa 317
                ||||||||||||||| ||||| ||||||||
Sbjct: 23479167 ggcgagcttctcaaagatgtctttgatgaa 23479138



to top

>gb|AY581839.1| Cynodon dactylon putative histone H2B mRNA, partial cds
          Length = 427

 Score =  309 bits (156), Expect = 4e-81
 Identities = 225/248 (90%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           ||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||
Sbjct: 289 ggtgaacttggtgacggccttagttccctcggagacggcgtgcttggcgagctcgccggg 230

                                                                       
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
           |||||||||||| || |||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 229 gaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 170

                                                                       
Query: 264 cctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggagtt 323
            |  |||||    |||| |||    ||||||||||| || ||||||||||||||||||||
Sbjct: 169 gcgggcgaggcgtgcggcttcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 110

                                                                       
Query: 324 catgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacctt 383
           |||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||
Sbjct: 109 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 50

                   
Query: 384 gaagatgt 391
           ||||||||
Sbjct: 49  gaagatgt 42



to top

>emb|X69961.1|SMH2B4A Z.mays gene for H2B histone (gH2B4)
          Length = 2361

 Score =  301 bits (152), Expect = 9e-79
 Identities = 221/244 (90%)
 Strand = Plus / Minus

                                                                        
Query: 148  aacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 207
            |||||||| || ||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 1365 aacttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggaagg 1306

                                                                        
Query: 208  acgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtacctc 267
            |||||||| || || ||||||||||||||||| || |||||||||||||||||||| |  
Sbjct: 1305 acgaggcgcaccgaagtctggatctcccgggaggttatggtgggcttcttgttgtagcgg 1246

                                                                        
Query: 268  gcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggagttcatg 327
            |||||||||||||  ||| | || |||||||| || ||||||||||||||||||||||||
Sbjct: 1245 gcgagcttggcggcctcggcagccagcttctcgaagatgtcgttgatgaaggagttcatg 1186

                                                                        
Query: 328  atggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcaccttgaag 387
            ||||||||||||||||| ||||| || |||||||| ||||||||||||||||||||||||
Sbjct: 1185 atggacatggccttggacgagataccaatgtccgggtgcacctgcttgagcaccttgaag 1126

                
Query: 388  atgt 391
            ||||
Sbjct: 1125 atgt 1122



to top

>dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0507H06
          Length = 136351

 Score =  301 bits (152), Expect = 9e-79
 Identities = 224/248 (90%)
 Strand = Plus / Plus

                                                                         
Query: 144   ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
             ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 75126 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 75185

                                                                         
Query: 204   gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
             ||||||||||||||||||||||| |||||| ||||| |||  | ||||||||||||||||
Sbjct: 75186 gaggacgaggcggacggaggtctagatctcgcgggaggtggcgatgggcttcttgttgta 75245

                                                                         
Query: 264   cctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggagtt 323
              |  ||||| | |||||  ||    ||||||||||| || ||||||||||||||||||||
Sbjct: 75246 gcgggcgaggtgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 75305

                                                                         
Query: 324   catgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacctt 383
             |||||| |||||||||||||||||||||||||||||||| ||||||||||| || |||||
Sbjct: 75306 catgatcgacatggccttggaggagatgccgatgtccgggtgcacctgcttcaggacctt 75365

                     
Query: 384   gaagatgt 391
             ||||||||
Sbjct: 75366 gaagatgt 75373



to top

>ref|XM_475367.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 375

 Score =  293 bits (148), Expect = 2e-76
 Identities = 229/256 (89%)
 Strand = Plus / Minus

                                                                       
Query: 136 taggacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagc 195
           ||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |||
Sbjct: 374 taggaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagc 315

                                                                       
Query: 196 tcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttc 255
           ||||||||||||||||| || || |||||||||||||| ||||| ||||| |||||||||
Sbjct: 314 tcgccggggaggacgagacgaacagaggtctggatctcgcgggaggtgattgtgggcttc 255

                                                                       
Query: 256 ttgttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatg 315
           ||||||||||| || ||| | ||||  ||     |||||||||| ||||||||||||| |
Sbjct: 254 ttgttgtacctggcaagcctcgcggcctcctgctcgagcttctcgaaaatgtcgttgacg 195

                                                                       
Query: 316 aaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttg 375
           ||||| ||||||||||||||||||||||||||||| || ||||| || ||||||||||||
Sbjct: 194 aaggaattcatgatggacatggccttggaggagattcctatgtctggatgcacctgcttg 135

                           
Query: 376 agcaccttgaagatgt 391
           ||||||||||||||||
Sbjct: 134 agcaccttgaagatgt 119



to top

>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05,
             complete sequence
          Length = 163130

 Score =  293 bits (148), Expect = 2e-76
 Identities = 229/256 (89%)
 Strand = Plus / Minus

                                                                         
Query: 136   taggacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagc 195
             ||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |||
Sbjct: 69877 taggaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagc 69818

                                                                         
Query: 196   tcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttc 255
             ||||||||||||||||| || || |||||||||||||| ||||| ||||| |||||||||
Sbjct: 69817 tcgccggggaggacgagacgaacagaggtctggatctcgcgggaggtgattgtgggcttc 69758

                                                                         
Query: 256   ttgttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatg 315
             ||||||||||| || ||| | ||||  ||     |||||||||| ||||||||||||| |
Sbjct: 69757 ttgttgtacctggcaagcctcgcggcctcctgctcgagcttctcgaaaatgtcgttgacg 69698

                                                                         
Query: 316   aaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttg 375
             ||||| ||||||||||||||||||||||||||||| || ||||| || ||||||||||||
Sbjct: 69697 aaggaattcatgatggacatggccttggaggagattcctatgtctggatgcacctgcttg 69638

                             
Query: 376   agcaccttgaagatgt 391
             ||||||||||||||||
Sbjct: 69637 agcaccttgaagatgt 69622



to top

>gb|AF356817.1|AF356817 Lolium perenne histone H2B-1 mRNA, partial cds
          Length = 410

 Score =  283 bits (143), Expect = 2e-73
 Identities = 188/203 (92%)
 Strand = Plus / Minus

                                                                       
Query: 145 gtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 204
           |||||||||||||| |||||||||||||| || |||||||||||||||||||||||||||
Sbjct: 203 gtgaacttggtgacggccttggtgccctcagacacggcgtgcttggcgagctcgccgggg 144

                                                                       
Query: 205 aggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtac 264
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 143 aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtac 84

                                                                       
Query: 265 ctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggagttc 324
           || |||||||||||||| || || || |  ||||| || |||||| ||||||||||||||
Sbjct: 83  ctggcgagcttggcggactcaccagccaatttctcgaagatgtcgctgatgaaggagttc 24

                                  
Query: 325 atgatggacatggccttggagga 347
           ||||||||||||||| |||||||
Sbjct: 23  atgatggacatggccctggagga 1



to top

>ref|NM_190523.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 420

 Score =  248 bits (125), Expect = 1e-62
 Identities = 221/253 (87%)
 Strand = Plus / Minus

                                                                       
Query: 139 gacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcg 198
           ||||| |||||||||||||| |||||||||||||| ||||||||||||||||||||||||
Sbjct: 416 gacgacgtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagctcg 357

                                                                       
Query: 199 ccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttg 258
           ||||||||||||||||| || |||||||||||||| ||||| |||||||| |||||||||
Sbjct: 356 ccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttcttg 297

                                                                       
Query: 259 ttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaag 318
           ||||| |  |||||   |||||  ||   |||||||||||| || || ||||||||||| 
Sbjct: 296 ttgtagcgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatgaac 237

                                                                       
Query: 319 gagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagc 378
           ||||||||||| |||||||||||||| || || ||||| || || |||||||||||||| 
Sbjct: 236 gagttcatgatcgacatggccttggacgatatcccgatatcgggatgcacctgcttgagg 177

                        
Query: 379 accttgaagatgt 391
           |||||||| ||||
Sbjct: 176 accttgaaaatgt 164



to top

>dbj|AP003241.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0408C03
          Length = 141273

 Score =  248 bits (125), Expect = 1e-62
 Identities = 221/253 (87%)
 Strand = Plus / Plus

                                                                         
Query: 139   gacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcg 198
             ||||| |||||||||||||| |||||||||||||| ||||||||||||||||||||||||
Sbjct: 20161 gacgacgtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagctcg 20220

                                                                         
Query: 199   ccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttg 258
             ||||||||||||||||| || |||||||||||||| ||||| |||||||| |||||||||
Sbjct: 20221 ccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttcttg 20280

                                                                         
Query: 259   ttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaag 318
             ||||| |  |||||   |||||  ||   |||||||||||| || || ||||||||||| 
Sbjct: 20281 ttgtagcgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatgaac 20340

                                                                         
Query: 319   gagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagc 378
             ||||||||||| |||||||||||||| || || ||||| || || |||||||||||||| 
Sbjct: 20341 gagttcatgatcgacatggccttggacgatatcccgatatcgggatgcacctgcttgagg 20400

                          
Query: 379   accttgaagatgt 391
             |||||||| ||||
Sbjct: 20401 accttgaaaatgt 20413



to top

>dbj|AP003231.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0031D11
          Length = 138108

 Score =  248 bits (125), Expect = 1e-62
 Identities = 221/253 (87%)
 Strand = Plus / Plus

                                                                          
Query: 139    gacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcg 198
              ||||| |||||||||||||| |||||||||||||| ||||||||||||||||||||||||
Sbjct: 106114 gacgacgtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagctcg 106173

                                                                          
Query: 199    ccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttg 258
              ||||||||||||||||| || |||||||||||||| ||||| |||||||| |||||||||
Sbjct: 106174 ccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttcttg 106233

                                                                          
Query: 259    ttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaag 318
              ||||| |  |||||   |||||  ||   |||||||||||| || || ||||||||||| 
Sbjct: 106234 ttgtagcgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatgaac 106293

                                                                          
Query: 319    gagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagc 378
              ||||||||||| |||||||||||||| || || ||||| || || |||||||||||||| 
Sbjct: 106294 gagttcatgatcgacatggccttggacgatatcccgatatcgggatgcacctgcttgagg 106353

                           
Query: 379    accttgaagatgt 391
              |||||||| ||||
Sbjct: 106354 accttgaaaatgt 106366



to top

>dbj|AK059159.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-023-D03, full
           insert sequence
          Length = 288

 Score =  208 bits (105), Expect = 1e-50
 Identities = 123/129 (95%)
 Strand = Plus / Minus

                                                                       
Query: 132 agcctaggacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggc 191
           ||||||||| || ||||||||||| || ||||||||||||||||||||||||||||||||
Sbjct: 137 agcctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggc 78

                                                                       
Query: 192 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtggg 251
           ||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||
Sbjct: 77  gagctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtggg 18

                    
Query: 252 cttcttgtt 260
           |||||||||
Sbjct: 17  cttcttgtt 9



to top

>dbj|D37944.1|WHTPH2B12C Triticum aestivum gene for protein H2B123, complete cds
          Length = 2901

 Score =  206 bits (104), Expect = 4e-50
 Identities = 200/232 (86%)
 Strand = Plus / Minus

                                                                        
Query: 160  gccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacgaggcggacg 219
            |||||||| ||||||||||||||||||||||| |||||||| || | ||| ||||| |||
Sbjct: 1977 gccttggttccctcggagacggcgtgcttggcaagctcgcctggaaagacaaggcgcacg 1918

                                                                        
Query: 220  gaggtctggatctcccgggacgtgatggtgggcttcttgttgtacctcgcgagcttggcg 279
            |  |||||||||||||| || ||||||||||||||||||||||| |  |||||||| || 
Sbjct: 1917 gcagtctggatctcccgagaggtgatggtgggcttcttgttgtagcgtgcgagctttgcc 1858

                                                                        
Query: 280  gattcgccggcgagcttctcaaaaatgtcgttgatgaaggagttcatgatggacatggcc 339
            || || |||||||||||||| || ||||||||||||| |||||| ||||||||||| |  
Sbjct: 1857 gactctccggcgagcttctcgaagatgtcgttgatgatggagttgatgatggacattgat 1798

                                                                
Query: 340  ttggaggagatgccgatgtccggctgcacctgcttgagcaccttgaagatgt 391
            ||||||||||| || |||| ||| |  | |||||||||||||||||||||||
Sbjct: 1797 ttggaggagatacccatgttcgggtcaatctgcttgagcaccttgaagatgt 1746



to top

>emb|X82362.1|AOHIS2B A.officinalis mRNA for histone 2B
          Length = 492

 Score =  190 bits (96), Expect = 2e-45
 Identities = 114/120 (95%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 452 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccggg 393

                                                                       
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
           ||||||||| | |||||||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 392 gaggacgagcctgacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 333



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                       
Query: 292 agcttctcaaaaatgtcgttgatgaaggagttcatgatggacatggccttggaggagatg 351
           |||||||| || |||||||||||||| |||||||||||   ||| ||||||   ||||| 
Sbjct: 304 agcttctcgaagatgtcgttgatgaacgagttcatgatccccatcgccttgctcgagatc 245

                                                   
Query: 352 ccgatgtccggctgcacctgcttgagcaccttgaagatgt 391
           ||||||||||| || |||||||| || |||||||||||||
Sbjct: 244 ccgatgtccgggtggacctgcttcaggaccttgaagatgt 205



to top

>gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1), histone H2A (ch2a-IV),
            and histone H2B (ch2b-IV) genes, complete cds
          Length = 4502

 Score =  186 bits (94), Expect = 4e-44
 Identities = 211/250 (84%)
 Strand = Plus / Minus

                                                                        
Query: 142  gaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccg 201
            |||||||||||||| || |||||||||||||| || || ||||||||||| |||||||||
Sbjct: 4211 gaggtgaacttggtcacggccttggtgccctccgacaccgcgtgcttggccagctcgccg 4152

                                                                        
Query: 202  gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 261
            || || || ||||| |||| |||||||||||| ||||| || | ||||||||||||||||
Sbjct: 4151 ggcagcaccaggcgcacggcggtctggatctcgcgggaggtcacggtgggcttcttgttg 4092

                                                                        
Query: 262  tacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggag 321
            || |     ||||||| ||  |||  ||| | ||||||||| |||||||||||||||  |
Sbjct: 4091 tagcggctcagcttggaggcctcggtggccaccttctcaaagatgtcgttgatgaagctg 4032

                                                                        
Query: 322  ttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacc 381
            |||||||||||||||||||||  |  ||||||| |||| || ||||||||||||||||||
Sbjct: 4031 ttcatgatggacatggccttgctgctgatgccggtgtcggggtgcacctgcttgagcacc 3972

                      
Query: 382  ttgaagatgt 391
            ||| ||||||
Sbjct: 3971 ttgtagatgt 3962



to top

>gb|AY389709.1| Hyacinthus orientalis histone H2B mRNA, partial cds
          Length = 627

 Score =  174 bits (88), Expect = 1e-40
 Identities = 112/120 (93%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 519 ggtgaacttggtcacggccttggtgccgtcggagacggcgtgcttggcgagctcgccggg 460

                                                                       
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
           ||| ||||| | |||||||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 459 gagcacgagcctgacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 400



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 90/104 (86%)
 Strand = Plus / Minus

                                                                       
Query: 288 ggcgagcttctcaaaaatgtcgttgatgaaggagttcatgatggacatggccttggagga 347
           |||||||||||| || ||||||||||||||||||||||||||   ||||||||||   ||
Sbjct: 375 ggcgagcttctcgaagatgtcgttgatgaaggagttcatgatccccatggccttgctcga 316

                                                       
Query: 348 gatgccgatgtccggctgcacctgcttgagcaccttgaagatgt 391
           ||| || |||||||| || |||||||| ||||||||||| ||||
Sbjct: 315 gatccctatgtccgggtggacctgcttcagcaccttgaatatgt 272



to top

>gb|AF048824.1|AF048824 Malus domestica histone H2B mRNA, partial cds
          Length = 478

 Score =  174 bits (88), Expect = 1e-40
 Identities = 208/248 (83%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           ||||||||| || || |||||||| || || || || ||||||||||||||||| || ||
Sbjct: 274 ggtgaacttagtcacggccttggtcccttccgaaacagcgtgcttggcgagctcaccagg 215

                                                                       
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
           ||| ||||| |  |||||||||||||| |||||||| ||||| || || |||||||||||
Sbjct: 214 gagcacgagcctcacggaggtctggatttcccgggaagtgatcgtcggtttcttgttgta 155

                                                                       
Query: 264 cctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggagtt 323
           |||||||||| |||  || ||   |||||||||||| ||||||||||||||||||  |||
Sbjct: 154 cctcgcgagcctggacgactcctgggcgagcttctcgaaaatgtcgttgatgaagctgtt 95

                                                                       
Query: 324 catgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacctt 383
           ||||||   ||||||||||  |||||| |||||||| || || |||||||| ||||||||
Sbjct: 94  catgattcccatggccttgctggagatcccgatgtcagggtggacctgcttcagcacctt 35

                   
Query: 384 gaagatgt 391
           ||| ||||
Sbjct: 34  gaaaatgt 27



to top

>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and
            histone H2A genes, complete cds
          Length = 4358

 Score =  172 bits (87), Expect = 5e-40
 Identities = 210/251 (83%)
 Strand = Plus / Plus

                                                                        
Query: 141  cgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgcc 200
            ||||||||||||||| || |||||||||||||| || || ||||||||||| ||||||||
Sbjct: 3039 cgaggtgaacttggtcacggccttggtgccctccgacaccgcgtgcttggccagctcgcc 3098

                                                                        
Query: 201  ggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgtt 260
             || || || ||||| |||| |||||||||||| ||||| || | |||||||||||||||
Sbjct: 3099 aggcagcaccaggcgcacggcggtctggatctcacgggaggtcacggtgggcttcttgtt 3158

                                                                        
Query: 261  gtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaagga 320
            ||| |     ||||||| ||  |||  ||| | ||||||||| |||||||||||||||  
Sbjct: 3159 gtagcggctcagcttggaggcctcggtggccaccttctcaaagatgtcgttgatgaagct 3218

                                                                        
Query: 321  gttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcac 380
            ||||||||| ||||||||||||  |  ||||||| |||| || |||||||||||||||||
Sbjct: 3219 gttcatgatagacatggccttgctgctgatgccggtgtcggggtgcacctgcttgagcac 3278

                       
Query: 381  cttgaagatgt 391
            |||| ||||||
Sbjct: 3279 cttgtagatgt 3289



to top

>gb|AF356818.1|AF356818 Lolium perenne histone H2B-2 mRNA, partial cds
          Length = 402

 Score =  161 bits (81), Expect = 2e-36
 Identities = 93/97 (95%)
 Strand = Plus / Minus

                                                                       
Query: 295 ttctcaaaaatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 354
           ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 386 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 327

                                                
Query: 355 atgtccggctgcacctgcttgagcaccttgaagatgt 391
           ||||| || ||||||||||||||||||||||||||||
Sbjct: 326 atgtcggggtgcacctgcttgagcaccttgaagatgt 290



to top

>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II),
            histone H2B (ch2b-II) and histone H2A (ch2a-II) genes,
            complete cds
          Length = 3777

 Score =  157 bits (79), Expect = 3e-35
 Identities = 202/243 (83%)
 Strand = Plus / Plus

                                                                        
Query: 142  gaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccg 201
            |||||||||||||| || |||||||||||||| || || |||||||| || ||||| |||
Sbjct: 2456 gaggtgaacttggtcacggccttggtgccctctgacaccgcgtgcttagccagctcaccg 2515

                                                                        
Query: 202  gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 261
            || || || ||||| |||| |||||||||||| || || || | ||||||||||||||||
Sbjct: 2516 ggcagcaccaggcgcacggcggtctggatctcgcgagaggtcacggtgggcttcttgttg 2575

                                                                        
Query: 262  tacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggag 321
            || |     ||||||| ||  |||  ||| | ||||||||| |||||||||||||||  |
Sbjct: 2576 tagcggctcagcttggaggcctcggtggccaccttctcaaagatgtcgttgatgaagctg 2635

                                                                        
Query: 322  ttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacc 381
            |||||||||||||||||||||  |  ||||||| |||| || ||||||||||||||||||
Sbjct: 2636 ttcatgatggacatggccttgctgctgatgccggtgtcggggtgcacctgcttgagcacc 2695

               
Query: 382  ttg 384
            |||
Sbjct: 2696 ttg 2698



to top

>gb|AF356821.1|AF356821 Lolium perenne histone H2B-5 mRNA, partial cds
          Length = 375

 Score =  153 bits (77), Expect = 5e-34
 Identities = 92/97 (94%)
 Strand = Plus / Minus

                                                                       
Query: 295 ttctcaaaaatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 354
           ||||| || |||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 359 ttctcgaagatgtcgttgatgaaggagctcatgatggacatggccttggaggagatgccg 300

                                                
Query: 355 atgtccggctgcacctgcttgagcaccttgaagatgt 391
           ||||| || ||||||||||||||||||||||||||||
Sbjct: 299 atgtcggggtgcacctgcttgagcaccttgaagatgt 263



to top

>gb|AF356819.1|AF356819 Lolium perenne histone H2B-3 mRNA, partial cds
          Length = 397

 Score =  145 bits (73), Expect = 1e-31
 Identities = 91/97 (93%)
 Strand = Plus / Minus

                                                                       
Query: 295 ttctcaaaaatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 354
           ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 322

                                                
Query: 355 atgtccggctgcacctgcttgagcaccttgaagatgt 391
           ||||| || || |||||||||||||||||||| ||||
Sbjct: 321 atgtcggggtggacctgcttgagcaccttgaaaatgt 285



to top

>ref|XM_391802.1| Gibberella zeae PH-1 H2B_NEUCR Histone H2B (FG11626.1) partial mRNA
          Length = 414

 Score =  133 bits (67), Expect = 5e-28
 Identities = 103/115 (89%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 208
           ||||||| || |||||||| ||||||||||||||||||||||| ||||| ||||||||||
Sbjct: 394 acttggtaacggccttggtaccctcggagacggcgtgcttggcaagctcaccggggagga 335

                                                                  
Query: 209 cgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
            ||||||||| |||||||| ||||| ||||| | |||||||| ||||||||||||
Sbjct: 334 tgaggcggacagaggtctgaatctctcgggaagagatggtggacttcttgttgta 280



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 75/91 (82%)
 Strand = Plus / Minus

                                                                       
Query: 301 aaaatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 360
           ||||||||||||| ||| ||||||| ||||||||||||   |  |||||| ||  |||| 
Sbjct: 242 aaaatgtcgttgacgaaagagttcaggatggacatggcacggttggagataccagtgtcg 183

                                          
Query: 361 ggctgcacctgcttgagcaccttgaagatgt 391
           || || ||||||||||| |||||| ||||||
Sbjct: 182 gggtggacctgcttgaggaccttgtagatgt 152



to top

>emb|BX088700.1|CNS09S4S DNA centromeric region sequence from BAC DP26B06, DP34F04, DP16D11,
             DP09G08, DP35C12 of chromosome 5  of Podospora anserina
          Length = 322194

 Score =  133 bits (67), Expect = 5e-28
 Identities = 103/115 (89%)
 Strand = Plus / Minus

                                                                         
Query: 149   acttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 208
             |||||||||| ||||||||||| || || |||||||||||||| ||||||||||| ||||
Sbjct: 23470 acttggtgacggccttggtgccttcagacacggcgtgcttggcaagctcgccgggaagga 23411

                                                                    
Query: 209   cgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
              |||||| ||||||||||||||||| ||||| | |||||||| ||||||||||||
Sbjct: 23410 tgaggcgcacggaggtctggatctcacgggatgagatggtggacttcttgttgta 23356



to top

>emb|AL590462.1|CNS07EGJ DNA centromeric region sequence BAC 34F04 of chromosome 5 of Podospora
             anserina
          Length = 103568

 Score =  133 bits (67), Expect = 5e-28
 Identities = 103/115 (89%)
 Strand = Plus / Plus

                                                                         
Query: 149   acttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 208
             |||||||||| ||||||||||| || || |||||||||||||| ||||||||||| ||||
Sbjct: 81641 acttggtgacggccttggtgccttcagacacggcgtgcttggcaagctcgccgggaagga 81700

                                                                    
Query: 209   cgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
              |||||| ||||||||||||||||| ||||| | |||||||| ||||||||||||
Sbjct: 81701 tgaggcgcacggaggtctggatctcacgggatgagatggtggacttcttgttgta 81755



to top

>gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, complete cds
          Length = 2132

 Score =  129 bits (65), Expect = 7e-27
 Identities = 203/249 (81%)
 Strand = Plus / Minus

                                                                        
Query: 136  taggacgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagc 195
            |||| ||| |||||||||||||| ||||||||||||||||| |||||||||||||| |||
Sbjct: 1592 taggccgacgtgaacttggtgacagccttggtgccctcggacacggcgtgcttggccagc 1533

                                                                        
Query: 196  tcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttc 255
            ||||| || || || ||||| || |  ||||| || || || ||||| | ||||||||||
Sbjct: 1532 tcgcccggaagaaccaggcgcacagcagtctgaatttcgcgcgacgtcacggtgggcttc 1473

                                                                        
Query: 256  ttgttgtacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatg 315
            |||||||| |     ||||||| ||  |||  ||| | ||||||||| ||||||||||||
Sbjct: 1472 ttgttgtagcggctcagcttggaggcctcggtggcaaccttctcaaagatgtcgttgatg 1413

                                                                        
Query: 316  aaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttg 375
            |||  |||||| || ||||||||||| |||  ||||||| | || || ||||||||||| 
Sbjct: 1412 aagctgttcataatcgacatggccttcgagctgatgccggtatcggggtgcacctgcttc 1353

                     
Query: 376  agcaccttg 384
            | |||||||
Sbjct: 1352 aacaccttg 1344



to top

>dbj|AB124798.1| Rhacophorus schlegelii histh2b mRNA for histone H2B, complete cds
          Length = 425

 Score =  125 bits (63), Expect = 1e-25
 Identities = 96/107 (89%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| || ||||||||||||||||||||||||||||| ||||| |||||
Sbjct: 369 ggtgtacttggtgacggctttggtgccctcggagacggcgtgcttggccagctctccggg 310

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  |||||||||| |||||||||||||||||| ||||||||||
Sbjct: 309 cagcagcaggcggacggcggtctggatctcccgggaggtgatggtgg 263



 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 209 atgtcgttgacgaaggagttcatgatgctcatggccttggaggagatgccggtgtcgggg 150

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || ||||||||||||||||||
Sbjct: 149 tggacctgcttgagcaccttg 129



to top

>ref|XM_789621.1| PREDICTED: Strongylocentrotus purpuratus similar to testis-specific
           histone 2b (LOC589998), mRNA
          Length = 372

 Score =  119 bits (60), Expect = 7e-24
 Identities = 105/120 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| |||||
Sbjct: 360 ggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggccagctctccggg 301

                                                                       
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
           ||||| ||| ||||| | |||||||||||| |||    ||||||||| ||||||||||||
Sbjct: 300 gaggaggagacggacagcggtctggatctctcggctgctgatggtggccttcttgttgta 241



 Score = 48.1 bits (24), Expect = 0.021
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 307 tcgttgatgaaggagttcatgatggacatggccttg 342
           ||||||| ||||  ||||||||||||||||||||||
Sbjct: 197 tcgttgacgaagctgttcatgatggacatggccttg 162



to top

>ref|XM_540291.2| PREDICTED: Canis familiaris similar to H2B histone family, member F
           (LOC483173), mRNA
          Length = 2193

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 385 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 326

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||||||||| ||||||||||
Sbjct: 325 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtgg 279



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 225 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgccggtgtcgggg 166

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 165 tgcacctgcttcagcaccttg 145



to top

>ref|XM_540282.2| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC483164), mRNA
          Length = 659

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 392 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 333

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||||||||| ||||||||||
Sbjct: 332 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtgg 286



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 232 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgccggtgtcgggg 173

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 172 tgcacctgcttcagcaccttg 152



to top

>ref|XM_540287.2| PREDICTED: Canis familiaris similar to H2B histone family, member
           F, transcript variant 1 (LOC483169), mRNA
          Length = 432

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 379 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 320

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||||||||| ||||||||||
Sbjct: 319 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtgg 273



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 219 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgccggtgtcgggg 160

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 159 tgcacctgcttcagcaccttg 139



to top

>ref|XM_844635.1| PREDICTED: Canis familiaris similar to H2B histone family, member
           F, transcript variant 2 (LOC483169), mRNA
          Length = 516

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 417 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 358

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||||||||| ||||||||||
Sbjct: 357 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtgg 311



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 257 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgccggtgtcgggg 198

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 197 tgcacctgcttcagcaccttg 177



to top

>ref|XM_854499.1| PREDICTED: Canis familiaris similar to H2B histone family, member
           F, transcript variant 5 (LOC483170), mRNA
          Length = 415

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 310

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||||||||| ||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtgg 263



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 209 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgccggtgtcgggg 150

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 149 tgcacctgcttcagcaccttg 129



to top

>ref|XM_540288.2| PREDICTED: Canis familiaris similar to H2B histone family, member
           F, transcript variant 4 (LOC483170), mRNA
          Length = 597

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 417 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 358

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||||||||| ||||||||||
Sbjct: 357 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtgg 311



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 257 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgccggtgtcgggg 198

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 197 tgcacctgcttcagcaccttg 177



to top

>emb|AL109948.9|HSJ998N21 Human DNA sequence from clone RP5-998N21 on chromosome 1 Contains a
             ubiquitin-conjugating enzyme HBUCE1 pseudogene, the FCGR1C
             gene for Fc fragment of IgG high affinity Ic receptor for
             (CD64), two novel genes, the HIST2H2BA gene for histone 2
             H2ba, the gene for a novel protein similar to histone 2
             H3c (HIST2H3C), a novel gene, a ribosomal protein L22
             (RPL22) pseudogene, a novel gene and three CpG islands,
             complete sequence
          Length = 129426

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Plus

                                                                         
Query: 144   ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
             |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 68592 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 68651

                                                            
Query: 204   gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
              || |  ||||| ||||  ||||||||||| ||||||||||||||||
Sbjct: 68652 cagcagcaggcgcacggccgtctggatctcgcgggacgtgatggtgg 68698



 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 69/79 (87%)
 Strand = Plus / Plus

                                                                         
Query: 304   atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
             |||||||||| ||||||||||||||||  ||||| |||||| ||||||||| |||| || 
Sbjct: 68752 atgtcgttgacgaaggagttcatgatgcccatggtcttggacgagatgccggtgtcgggg 68811

                                
Query: 364   tgcacctgcttgagcacct 382
             || |||||||| |||||||
Sbjct: 68812 tggacctgcttcagcacct 68830



to top

>gb|BC073925.1| Homo sapiens similar to histone H2B histone family, mRNA (cDNA
           clone MGC:90432 IMAGE:5190019), complete cds
          Length = 2221

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 350 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 291

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||| ||||||||||||||||
Sbjct: 290 cagcagcaggcgcacggccgtctggatctcgcgggacgtgatggtgg 244



 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 69/79 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  ||||| |||||| ||||||||| |||| || 
Sbjct: 190 atgtcgttgacgaaggagttcatgatgcccatggtcttggacgagatgccggtgtcgggg 131

                              
Query: 364 tgcacctgcttgagcacct 382
           || |||||||| |||||||
Sbjct: 130 tggacctgcttcagcacct 112



to top

>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4 (ch4-III),
            histone H2B (ch2b-III) and histone H2A (ch2a-III) genes,
            complete cds
          Length = 4582

 Score =  117 bits (59), Expect = 3e-23
 Identities = 107/123 (86%)
 Strand = Plus / Plus

                                                                        
Query: 141  cgaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgcc 200
            ||||||||||||||| || |||||||||||||| || || ||||||||||| ||||||||
Sbjct: 2337 cgaggtgaacttggtcacggccttggtgccctccgacaccgcgtgcttggccagctcgcc 2396

                                                                        
Query: 201  ggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgtt 260
            ||| || || ||||| || | |||||||||||| ||||| || | |||||||||||||||
Sbjct: 2397 gggcagcaccaggcgcaccgcggtctggatctcgcgggaggtcacggtgggcttcttgtt 2456

               
Query: 261  gta 263
            |||
Sbjct: 2457 gta 2459



 Score =  107 bits (54), Expect = 3e-20
 Identities = 87/98 (88%)
 Strand = Plus / Plus

                                                                        
Query: 294  cttctcaaaaatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgcc 353
            ||||||||| |||||||||||||||  ||||||||||||||||||||||  |  ||||||
Sbjct: 2490 cttctcaaagatgtcgttgatgaagctgttcatgatggacatggccttgctgctgatgcc 2549

                                                  
Query: 354  gatgtccggctgcacctgcttgagcaccttgaagatgt 391
            | |||| || ||||||||||||||||||||| ||||||
Sbjct: 2550 ggtgtcggggtgcacctgcttgagcaccttgtagatgt 2587



to top

>ref|XM_866738.1| PREDICTED: Bos taurus similar to Histone H2B 291B (LOC615043), mRNA
          Length = 748

 Score =  113 bits (57), Expect = 4e-22
 Identities = 93/105 (88%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 401 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 342

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  || || ||||  ||||||||||||||||||||||||||
Sbjct: 341 cagcagaagtcgcacggccgtctggatctcccgggacgtgatggt 297



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           ||||||||||  || ||||||||||||  |||||| ||||| ||||||||| ||||||| 
Sbjct: 241 atgtcgttgacaaatgagttcatgatgcccatggctttggacgagatgccggtgtccggg 182

                                
Query: 364 tgcacctgcttgagcaccttg 384
           |||||||| || | |||||||
Sbjct: 181 tgcacctgtttcaacaccttg 161



to top

>ref|XM_618175.2| PREDICTED: Bos taurus similar to H2B histone family, member F,
           transcript variant 1 (LOC537985), mRNA
          Length = 2304

 Score =  113 bits (57), Expect = 4e-22
 Identities = 93/105 (88%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 385 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccagg 326

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 325 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 281



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           ||||||||||  || ||||||||||||  ||| |||||||| || || ||| ||||||| 
Sbjct: 225 atgtcgttgacaaatgagttcatgatgcccatagccttggacgaaataccggtgtccggg 166

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 165 tgcacctgcttcagcaccttg 145



to top

>ref|XM_782648.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B
           (LOC582704), mRNA
          Length = 372

 Score =  113 bits (57), Expect = 4e-22
 Identities = 105/121 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| |||||||| |||||||| ||||| |||||
Sbjct: 360 ggtgtacttggtgacagccttggtgccctcagagacggcatgcttggccagctctccggg 301

                                                                       
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
           ||||| ||| ||||| | |||||||||||| |||    ||||||||| ||||||||||||
Sbjct: 300 gaggaggagacggacagcggtctggatctctcggctgctgatggtggacttcttgttgta 241

            
Query: 264 c 264
           |
Sbjct: 240 c 240



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 71/85 (83%)
 Strand = Plus / Minus

                                                                       
Query: 307 tcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggctgc 366
           ||||||| ||||  ||||||||||||||||||||||  |||||| ||  |||| || || 
Sbjct: 197 tcgttgacgaagctgttcatgatggacatggccttgctggagataccagtgtcggggtgg 138

                                    
Query: 367 acctgcttgagcaccttgaagatgt 391
           |||||||| || |||||| ||||||
Sbjct: 137 acctgcttcagaaccttgtagatgt 113



to top

>ref|XM_785670.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B
           (LOC585864), mRNA
          Length = 372

 Score =  113 bits (57), Expect = 4e-22
 Identities = 105/121 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| |||||||| |||||||| ||||| |||||
Sbjct: 360 ggtgtacttggtgacagccttggtgccctcagagacggcatgcttggccagctctccggg 301

                                                                       
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
           ||||| ||| ||||| | |||||||||||| |||    ||||||||| ||||||||||||
Sbjct: 300 gaggaggagacggacagcggtctggatctctcggctgctgatggtggacttcttgttgta 241

            
Query: 264 c 264
           |
Sbjct: 240 c 240



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 71/85 (83%)
 Strand = Plus / Minus

                                                                       
Query: 307 tcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggctgc 366
           ||||||| ||||  ||||||||||||||||||||||  |||||| ||  |||| || || 
Sbjct: 197 tcgttgacgaagctgttcatgatggacatggccttgctggagataccagtgtcggggtgg 138

                                    
Query: 367 acctgcttgagcaccttgaagatgt 391
           |||||||| || |||||| ||||||
Sbjct: 137 acctgcttcagaaccttgtagatgt 113



to top

>emb|X59961.1|RNH2AB R.norvegicus genes for H2A and H2B histones
          Length = 1635

 Score =  113 bits (57), Expect = 4e-22
 Identities = 93/105 (88%)
 Strand = Plus / Plus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||||||||||||||||||||| || ||||||||||| ||||| |||||
Sbjct: 218 ggtgtacttggtgactgccttggtgccctcggacaccgcgtgcttggccagctccccggg 277

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 278 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 322



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 69/81 (85%)
 Strand = Plus / Plus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||||||||| ||||| ||| | ||||| 
Sbjct: 375 atgtcgttcacgaacgagttcatgatgcccatggccttggaagagattccggtatccggg 434

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 435 tgcacttgcttcagcaccttg 455



to top

>ref|NM_022647.1| Rattus norvegicus histone 1, H2bl (Hist1h2bl), mRNA
          Length = 378

 Score =  113 bits (57), Expect = 4e-22
 Identities = 93/105 (88%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||||||||||||||||||||| || ||||||||||| ||||| |||||
Sbjct: 366 ggtgtacttggtgactgccttggtgccctcggacaccgcgtgcttggccagctccccggg 307

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 306 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 262



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||||||||| ||||| ||| | ||||| 
Sbjct: 209 atgtcgttcacgaacgagttcatgatgcccatggccttggaagagattccggtatccggg 150

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 149 tgcacttgcttcagcaccttg 129



to top

>gb|DQ215263.1| Taeniopygia guttata clone 0058P0013D11 histone 1 H2be -like mRNA,
           complete sequence
          Length = 838

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 416 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccggg 357

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  |||||||||||||| || ||||||||||
Sbjct: 356 cagcagcaggcgcacggccgtctggatctcccgcgaggtgatggtgg 310



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 256 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 197

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 196 tgcacctgcttcagcaccttg 176



to top

>gb|BC107084.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:129733
           IMAGE:40014260), complete cds
          Length = 459

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 370 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 311

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 310 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 264



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 210 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcgggg 151

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || |||||||| |||||||||
Sbjct: 150 tggacctgcttcagcaccttg 130



to top

>gb|BC107085.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:129734
           IMAGE:40014264), complete cds
          Length = 459

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 370 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 311

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 310 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 264



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 210 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcgggg 151

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || |||||||| |||||||||
Sbjct: 150 tggacctgcttcagcaccttg 130



to top

>ref|XM_513763.1| PREDICTED: Pan troglodytes LOC457260 (LOC457260), mRNA
          Length = 753

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 384 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 325

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 324 cagcagcaggcgcacggccgtctggatctcgcgggaggtgatggtgg 278



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 224 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcgggg 165

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || |||||||| |||||||||
Sbjct: 164 tggacctgcttcagcaccttg 144



to top

>gb|BC069193.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:78419
           IMAGE:3936695), complete cds
          Length = 2224

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 393 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 334

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 333 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 287



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 233 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcgggg 174

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || |||||||| |||||||||
Sbjct: 173 tggacctgcttcagcaccttg 153



to top

>gb|BC005827.2| Homo sapiens histone 2, H2be, mRNA (cDNA clone IMAGE:2989788), with
           apparent retained intron
          Length = 2210

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 381 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 322

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 321 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 275



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 221 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcgggg 162

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || |||||||| |||||||||
Sbjct: 161 tggacctgcttcagcaccttg 141



to top

>ref|NM_003528.2| Homo sapiens histone 2, H2be (HIST2H2BE), mRNA
          Length = 2223

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 411 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 352

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 351 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 305



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 251 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcgggg 192

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || |||||||| |||||||||
Sbjct: 191 tggacctgcttcagcaccttg 171



to top

>emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on chromosome 1 Contains a
              ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)
              (UBE2D1) pseudogene, the FCGR1A gene for Fc fragment of
              IgG, high affinity Ia, receptor for (CD64), a novel gene
              similar to histone 2, H2be (HIST2H2BE), a novel gene
              similar to histone 2, H3c (HIST2H3C), the HIST2H4 gene for
              histone 2, H4, the HIST2H3C gene for histone 2, H3c, the
              HIST2H2AA gene for histone 2, H2aa, a histone 2, H2bd
              pseudogene (HIST2H2BD), a histone 2, H2bc pseudogene
              (HIST2H2BC), a novel gene similar to histone 2, H2aa
              (HIST2H2AA), a novel gene similar to histone 2, H3c
              (HIST2H3C), a novel gene similar to histone 1, H4
              (HIST2H4), the HIST2H2BE gene for histone 2, H2be, the
              HIST2H2AC gene for histone 2, H2ac, the HIST2H2AB gene for
              histone 2, H2ab, a novel protein similar to histone 2, a
              novel gene, the SV2A gene for synaptic vesicle glycoprotein
              2A, the 3' end of the SF3B4 gene for splicing factor 3b,
              subunit 4, 49kDa and five CpG islands, complete sequence
          Length = 188956

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                          
Query: 144    ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
              |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 147982 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 148041

                                                             
Query: 204    gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
               || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 148042 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 148088



 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                         
Query: 144   ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
             |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 73670 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 73729

                                                            
Query: 204   gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
              || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 73730 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 73776



 Score =  107 bits (54), Expect = 3e-20
 Identities = 91/102 (89%), Gaps = 1/102 (0%)
 Strand = Plus / Plus

                                                                          
Query: 149    acttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 208
              |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 112138 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 112197

                                                        
Query: 209    cgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
                ||||| ||||  |||||||||| |||||||||||||||||
Sbjct: 112198 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 112238



 Score =  107 bits (54), Expect = 3e-20
 Identities = 91/102 (89%), Gaps = 1/102 (0%)
 Strand = Plus / Minus

                                                                          
Query: 149    acttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 208
              |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 105128 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 105069

                                                        
Query: 209    cgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
                ||||| ||||  |||||||||| |||||||||||||||||
Sbjct: 105068 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 105028



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Plus

                                                                          
Query: 304    atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
              |||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 148142 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcgggg 148201

                                   
Query: 364    tgcacctgcttgagcaccttg 384
              || |||||||| |||||||||
Sbjct: 148202 tggacctgcttcagcaccttg 148222



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Plus

                                                                         
Query: 304   atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
             |||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 73830 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcgggg 73889

                                  
Query: 364   tgcacctgcttgagcaccttg 384
             || |||||||| |||||||||
Sbjct: 73890 tggacctgcttcagcaccttg 73910



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 69/81 (85%)
 Strand = Plus / Plus

                                                                          
Query: 304    atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
              |||||||||| ||||||||||||||||  |||||||||| |  |||||||| |||| || 
Sbjct: 112292 atgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggtgtcgggg 112351

                                   
Query: 364    tgcacctgcttgagcaccttg 384
              || ||| |||| |||||||||
Sbjct: 112352 tggacccgcttcagcaccttg 112372



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                          
Query: 304    atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
              |||||||||| ||||||||||||||||  |||||||||| |  |||||||| |||| || 
Sbjct: 104974 atgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggtgtcgggg 104915

                                   
Query: 364    tgcacctgcttgagcaccttg 384
              || ||| |||| |||||||||
Sbjct: 104914 tggacccgcttcagcaccttg 104894



to top

>emb|AL357493.8| Human DNA sequence from clone RP11-439A17 on chromosome 1 Contains four
              novel genes, a novel gene (MGC57827), a ribosomal protein
              L22 (RPL22) pseudogene, a histone 2 H3c (HIST2H3C)
              pseudogene, the HIST2H2BB gene for histone 2 H2bb, the
              FCGR1B gene for Fc fragment of IgG high affinity Ib
              receptor for (CD64) and three CpG islands, complete
              sequence
          Length = 189539

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                          
Query: 144    ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
              |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 159255 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 159196

                                                             
Query: 204    gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
               || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 159195 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtgg 159149



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 70/79 (88%)
 Strand = Plus / Minus

                                                                          
Query: 304    atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
              |||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 159095 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcgggg 159036

                                 
Query: 364    tgcacctgcttgagcacct 382
              || |||||||| |||||||
Sbjct: 159035 tggacctgcttcagcacct 159017



to top

>emb|BX072512.1|CNS09S44 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 621

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 466 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 407

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
           ||| |  || || || |  ||||||||||| ||||||||||||||||
Sbjct: 406 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 360



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 76/88 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||||||| 
Sbjct: 306 atgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtccggg 247

                                       
Query: 364 tgcacctgcttgagcaccttgaagatgt 391
           ||||||||||| ||||||||| ||||||
Sbjct: 246 tgcacctgcttcagcaccttgtagatgt 219



to top

>emb|BX072414.1|CNS09S1E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 718

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 267 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 326

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
           ||| |  || || || |  ||||||||||| ||||||||||||||||
Sbjct: 327 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 373



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 76/88 (86%)
 Strand = Plus / Plus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||||||| 
Sbjct: 427 atgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtccggg 486

                                       
Query: 364 tgcacctgcttgagcaccttgaagatgt 391
           ||||||||||| ||||||||| ||||||
Sbjct: 487 tgcacctgcttcagcaccttgtagatgt 514



to top

>emb|BX051496.1|CNS09BWC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC28DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 247 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 306

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
           ||| |  || || || |  ||||||||||| ||||||||||||||||
Sbjct: 307 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 353



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 76/88 (86%)
 Strand = Plus / Plus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||||||| 
Sbjct: 407 atgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtccggg 466

                                       
Query: 364 tgcacctgcttgagcaccttgaagatgt 391
           ||||||||||| ||||||||| ||||||
Sbjct: 467 tgcacctgcttcagcaccttgtagatgt 494



to top

>emb|BX051495.1|CNS09BWB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 463 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 404

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
           ||| |  || || || |  ||||||||||| ||||||||||||||||
Sbjct: 403 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 357



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 76/88 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||||||| 
Sbjct: 303 atgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtccggg 244

                                       
Query: 364 tgcacctgcttgagcaccttgaagatgt 391
           ||||||||||| ||||||||| ||||||
Sbjct: 243 tgcacctgcttcagcaccttgtagatgt 216



to top

>emb|BX047440.1|CNS098RO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21CG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 735

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 444 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 385

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
           ||| |  || || || |  ||||||||||| ||||||||||||||||
Sbjct: 384 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 338



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 76/88 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||||||| 
Sbjct: 284 atgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtccggg 225

                                       
Query: 364 tgcacctgcttgagcaccttgaagatgt 391
           ||||||||||| ||||||||| ||||||
Sbjct: 224 tgcacctgcttcagcaccttgtagatgt 197



to top

>emb|BX038423.1|CNS091T7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2DC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 721

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 478 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 419

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
           ||| |  || || || |  ||||||||||| ||||||||||||||||
Sbjct: 418 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 372



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 76/88 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||||||| 
Sbjct: 318 atgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtccggg 259

                                       
Query: 364 tgcacctgcttgagcaccttgaagatgt 391
           ||||||||||| ||||||||| ||||||
Sbjct: 258 tgcacctgcttcagcaccttgtagatgt 231



to top

>emb|BX032827.1|CNS08XHR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 670

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 461 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 402

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
           ||| |  || || || |  ||||||||||| ||||||||||||||||
Sbjct: 401 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 355



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 76/88 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||||||| 
Sbjct: 301 atgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtccggg 242

                                       
Query: 364 tgcacctgcttgagcaccttgaagatgt 391
           ||||||||||| ||||||||| ||||||
Sbjct: 241 tgcacctgcttcagcaccttgtagatgt 214



to top

>emb|BX031663.1|CNS08WLF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47AG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 770

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 236 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 295

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
           ||| |  || || || |  ||||||||||| ||||||||||||||||
Sbjct: 296 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 342



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 76/88 (86%)
 Strand = Plus / Plus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||||||| 
Sbjct: 396 atgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtccggg 455

                                       
Query: 364 tgcacctgcttgagcaccttgaagatgt 391
           ||||||||||| ||||||||| ||||||
Sbjct: 456 tgcacctgcttcagcaccttgtagatgt 483



to top

>emb|BX021771.1|CNS08OYN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32BB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 544

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 245 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 304

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
           ||| |  || || || |  ||||||||||| ||||||||||||||||
Sbjct: 305 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 351



 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                       
Query: 321 gttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcac 380
           ||||||||||  ||| ||||||||||| |||||| ||||||| ||||||||||| |||||
Sbjct: 422 gttcatgatgctcatcgccttggaggaaatgccggtgtccgggtgcacctgcttcagcac 481

                      
Query: 381 cttgaagatgt 391
           |||| ||||||
Sbjct: 482 cttgtagatgt 492



to top

>emb|BX013307.1|CNS08IFJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20AB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 452 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 393

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
           ||| |  || || || |  ||||||||||| ||||||||||||||||
Sbjct: 392 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 346



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 76/88 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||||||| 
Sbjct: 292 atgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtccggg 233

                                       
Query: 364 tgcacctgcttgagcaccttgaagatgt 391
           ||||||||||| ||||||||| ||||||
Sbjct: 232 tgcacctgcttcagcaccttgtagatgt 205



to top

>emb|BX012776.1|CNS08I0S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA2AH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 780

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 470 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 411

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
           ||| |  || || || |  ||||||||||| ||||||||||||||||
Sbjct: 410 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 364



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 76/88 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||||||| 
Sbjct: 310 atgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtccggg 251

                                       
Query: 364 tgcacctgcttgagcaccttgaagatgt 391
           ||||||||||| ||||||||| ||||||
Sbjct: 250 tgcacctgcttcagcaccttgtagatgt 223



to top

>emb|BX012380.1|CNS08HPS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 248 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 307

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
           ||| |  || || || |  ||||||||||| ||||||||||||||||
Sbjct: 308 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 354



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 60/68 (88%)
 Strand = Plus / Plus

                                                                       
Query: 324 catgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcacctt 383
           |||||||  ||| ||||||||||| |||||| ||||||| ||||||||||| ||||||||
Sbjct: 428 catgatgctcatcgccttggaggaaatgccggtgtccgggtgcacctgcttcagcacctt 487

                   
Query: 384 gaagatgt 391
           | ||||||
Sbjct: 488 gtagatgt 495



to top

>emb|BX009211.1|CNS08F9R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 750

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 452 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 393

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
           ||| |  || || || |  ||||||||||| ||||||||||||||||
Sbjct: 392 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 346



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 76/88 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||||||| 
Sbjct: 292 atgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtccggg 233

                                       
Query: 364 tgcacctgcttgagcaccttgaagatgt 391
           ||||||||||| ||||||||| ||||||
Sbjct: 232 tgcacctgcttcagcaccttgtagatgt 205



to top

>emb|X98185.1|AGH2B A.gambiae mRNA for histone H2B
          Length = 698

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 423 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 364

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
           ||| |  || || || |  ||||||||||| ||||||||||||||||
Sbjct: 363 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 317



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 76/88 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||||||| 
Sbjct: 266 atgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtccggg 207

                                       
Query: 364 tgcacctgcttgagcaccttgaagatgt 391
           ||||||||||| ||||||||| ||||||
Sbjct: 206 tgcacctgcttcagcaccttgtagatgt 179



to top

>emb|X57985.1|HSHIST H.sapiens genes for histones H2B.1 and H2A
          Length = 2964

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 869 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 810

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 809 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 763



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 709 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcgggg 650

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || |||||||| |||||||||
Sbjct: 649 tggacctgcttcagcaccttg 629



to top

>emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A with genes H1A, H2B, H3
            and H4
          Length = 8592

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                        
Query: 144  ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
            |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 2063 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccagg 2004

                                                           
Query: 204  gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
             | ||  |||||||| | |||||||||||||||||| ||||||||||
Sbjct: 2003 caagagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 1957



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                        
Query: 316  aaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttg 375
            |||||||||||||||  |||||||||||| ||||||||| | || || ||||||||||||
Sbjct: 1891 aaggagttcatgatgctcatggccttggaagagatgccggtatcggggtgcacctgcttg 1832

                 
Query: 376  agcac 380
            |||||
Sbjct: 1831 agcac 1827



to top

>emb|CR541895.1| Homo sapiens full open reading frame cDNA clone RZPDo834A0933D for
           gene HIST2H2BE, histone 2, H2be; complete cds, incl.
           stopcodon
          Length = 381

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 263



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 209 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcgggg 150

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || |||||||| |||||||||
Sbjct: 149 tggacctgcttcagcaccttg 129



to top

>gb|BC096121.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:116767
           IMAGE:40002353), complete cds
          Length = 430

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 263



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 209 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcgggg 150

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || |||||||| |||||||||
Sbjct: 149 tggacctgcttcagcaccttg 129



to top

>emb|CR858221.1| Pongo pygmaeus mRNA; cDNA DKFZp469C0528 (from clone DKFZp469C0528)
          Length = 2237

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 411 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 352

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 351 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 305



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 251 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcgggg 192

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || |||||||| |||||||||
Sbjct: 191 tggacctgcttcagcaccttg 171



to top

>ref|NG_002621.1| Homo sapiens histone 2, H2ba (HIST2H2BA) pseudogene on chromosome 1
          Length = 1137

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtgg 642



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 70/79 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 588 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcgggg 529

                              
Query: 364 tgcacctgcttgagcacct 382
           || |||||||| |||||||
Sbjct: 528 tggacctgcttcagcacct 510



to top

>ref|NG_002652.1| Homo sapiens histone 2, H2bb (HIST2H2BB) pseudogene on chromosome 1
          Length = 1137

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtgg 642



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 70/79 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 588 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcgggg 529

                              
Query: 364 tgcacctgcttgagcacct 382
           || |||||||| |||||||
Sbjct: 528 tggacctgcttcagcacct 510



to top

>gb|AY131975.1| Homo sapiens histone H2B (HIST2H2BA) pseudogene, complete sequence
          Length = 1137

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtgg 642



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 70/79 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 588 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcgggg 529

                              
Query: 364 tgcacctgcttgagcacct 382
           || |||||||| |||||||
Sbjct: 528 tggacctgcttcagcacct 510



to top

>gb|AY131976.1| Homo sapiens histone H2B (HIST2H2BB) pseudogene, complete sequence
          Length = 1137

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtgg 642



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 70/79 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 588 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcgggg 529

                              
Query: 364 tgcacctgcttgagcacct 382
           || |||||||| |||||||
Sbjct: 528 tggacctgcttcagcacct 510



to top

>gb|AY131979.1| Homo sapiens histone H2B (HIST2H2BE) gene, complete cds
          Length = 1137

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 749 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 690

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 689 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 643



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 589 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcgggg 530

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || |||||||| |||||||||
Sbjct: 529 tggacctgcttcagcaccttg 509



to top

>ref|XM_558160.1| Anopheles gambiae str. PEST ENSANGP00000027582
           (ENSANGG00000022768), partial mRNA
          Length = 513

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 46  ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 105

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
           ||| |  || || || |  ||||||||||| ||||||||||||||||
Sbjct: 106 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 152



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 76/88 (86%)
 Strand = Plus / Plus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||||||| 
Sbjct: 206 atgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtccggg 265

                                       
Query: 364 tgcacctgcttgagcaccttgaagatgt 391
           ||||||||||| ||||||||| ||||||
Sbjct: 266 tgcacctgcttcagcaccttgtagatgt 293



to top

>ref|XM_320334.2| Anopheles gambiae str. PEST ENSANGP00000014097
           (ENSANGG00000011608), mRNA
          Length = 671

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 420 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 361

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
           ||| |  || || || |  ||||||||||| ||||||||||||||||
Sbjct: 360 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 314



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 76/88 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||||||| 
Sbjct: 260 atgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtccggg 201

                                       
Query: 364 tgcacctgcttgagcaccttgaagatgt 391
           ||||||||||| ||||||||| ||||||
Sbjct: 200 tgcacctgcttcagcaccttgtagatgt 173



to top

>ref|XM_320329.2| Anopheles gambiae str. PEST ENSANGP00000014080
           (ENSANGG00000011591), mRNA
          Length = 695

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 464 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 405

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
           ||| |  || || || |  ||||||||||| ||||||||||||||||
Sbjct: 404 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 358



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 76/88 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||||||| 
Sbjct: 304 atgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtccggg 245

                                       
Query: 364 tgcacctgcttgagcaccttgaagatgt 391
           ||||||||||| ||||||||| ||||||
Sbjct: 244 tgcacctgcttcagcaccttgtagatgt 217



to top

>ref|XM_314450.2| Anopheles gambiae str. PEST ENSANGP00000000674
           (ENSANGG00000000607), partial mRNA
          Length = 363

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 351 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 292

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
           ||| |  || || || |  ||||||||||| ||||||||||||||||
Sbjct: 291 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 245



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 76/88 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||||||| 
Sbjct: 191 atgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtccggg 132

                                       
Query: 364 tgcacctgcttgagcaccttgaagatgt 391
           ||||||||||| ||||||||| ||||||
Sbjct: 131 tgcacctgcttcagcaccttgtagatgt 104



to top

>ref|XM_314448.2| Anopheles gambiae str. PEST ENSANGP00000016043
           (ENSANGG00000013554), mRNA
          Length = 704

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 470 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 411

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
           ||| |  || || || |  ||||||||||| ||||||||||||||||
Sbjct: 410 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 364



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 76/88 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||||||| 
Sbjct: 310 atgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtccggg 251

                                       
Query: 364 tgcacctgcttgagcaccttgaagatgt 391
           ||||||||||| ||||||||| ||||||
Sbjct: 250 tgcacctgcttcagcaccttgtagatgt 223



to top

>ref|XM_306853.2| Anopheles gambiae str. PEST ENSANGP00000000106
           (ENSANGG00000000104), partial mRNA
          Length = 321

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 309 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 250

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
           ||| |  || || || |  ||||||||||| ||||||||||||||||
Sbjct: 249 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 203



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||||||| 
Sbjct: 149 atgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtccggg 90

                               
Query: 364 tgcacctgcttgagcacctt 383
           ||||||||||| ||||||||
Sbjct: 89  tgcacctgcttcagcacctt 70



to top

>ref|XM_306255.2| Anopheles gambiae str. PEST ENSANGP00000000003
           (ENSANGG00000000003), partial mRNA
          Length = 375

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 363 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 304

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
           ||| |  || || || |  ||||||||||| ||||||||||||||||
Sbjct: 303 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 257



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 76/88 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||||||| 
Sbjct: 203 atgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtccggg 144

                                       
Query: 364 tgcacctgcttgagcaccttgaagatgt 391
           ||||||||||| ||||||||| ||||||
Sbjct: 143 tgcacctgcttcagcaccttgtagatgt 116



to top

>gb|AY893641.1| Synthetic construct Homo sapiens clone FLH130870.01X histone 2 H2be
           (HIST2H2BE) mRNA, complete cds
          Length = 381

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 263



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 209 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcgggg 150

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || |||||||| |||||||||
Sbjct: 149 tggacctgcttcagcaccttg 129



to top

>gb|BC098289.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:119804
           IMAGE:40014249), complete cds
          Length = 456

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 263



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 209 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcgggg 150

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || |||||||| |||||||||
Sbjct: 149 tggacctgcttcagcaccttg 129



to top

>gb|BC098112.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:119802
           IMAGE:40014245), complete cds
          Length = 458

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 263



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 209 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcgggg 150

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || |||||||| |||||||||
Sbjct: 149 tggacctgcttcagcaccttg 129



to top

>gb|BC077399.1| Xenopus laevis histone H2B, mRNA (cDNA clone MGC:81709
           IMAGE:6865010), complete cds
          Length = 1379

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 392 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccagg 333

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            | ||  |||||||| | |||||||||||||||||| ||||||||||
Sbjct: 332 caagagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 286



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                       
Query: 316 aaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttg 375
           |||||||||||||||  |||||||||||| ||||||||| | || || ||||||||||||
Sbjct: 220 aaggagttcatgatgctcatggccttggaagagatgccggtatcggggtgcacctgcttg 161

                
Query: 376 agcac 380
           |||||
Sbjct: 160 agcac 156



to top

>ref|NM_001024599.2| Homo sapiens histone 2, H2bf (HIST2H2BF), mRNA
          Length = 1858

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 402 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 343

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 342 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 296



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 242 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcgggg 183

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || |||||||| |||||||||
Sbjct: 182 tggacctgcttcagcaccttg 162



to top

>emb|CR855675.2| Xenopus tropicalis finished cDNA, clone TGas058p09
          Length = 484

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 375 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctccccagg 316

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  |||||||| | |||||||||||||||||| ||||||||||
Sbjct: 315 cagcagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 269



 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 68/78 (87%)
 Strand = Plus / Minus

                                                                       
Query: 307 tcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggctgc 366
           |||||||  |||||||||||||||  |||||||||||| ||||||||| | || || |||
Sbjct: 212 tcgttgacaaaggagttcatgatgctcatggccttggaagagatgccggtatcggggtgc 153

                             
Query: 367 acctgcttgagcaccttg 384
           |||||||| |||||||||
Sbjct: 152 acctgcttcagcaccttg 135



to top

>gb|BC110793.1| Homo sapiens histone 2, H2bf, mRNA (cDNA clone MGC:131639
           IMAGE:5224812), complete cds
          Length = 1858

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 402 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 343

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 342 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 296



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 242 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcgggg 183

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || |||||||| |||||||||
Sbjct: 182 tggacctgcttcagcaccttg 162



to top

>gb|BC106916.1| Homo sapiens similar to histone H2B histone family, mRNA (cDNA
           clone MGC:126031 IMAGE:40032208), complete cds
          Length = 520

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 378 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 319

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 318 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtgg 272



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 70/79 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 218 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcgggg 159

                              
Query: 364 tgcacctgcttgagcacct 382
           || |||||||| |||||||
Sbjct: 158 tggacctgcttcagcacct 140



to top

>gb|M60756.1|HUMHISH2BA Human histone H2B.1 mRNA, 3' end
          Length = 2100

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 294 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 235

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 234 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 188



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||| || 
Sbjct: 134 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcgggg 75

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || |||||||| |||||||||
Sbjct: 74  tggacctgcttcagcaccttg 54



to top

>gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 genes, complete cds, and
            histone H3 gene, 3' end, gene cluster X1h3
          Length = 8608

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                        
Query: 144  ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
            |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 2073 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccagg 2014

                                                           
Query: 204  gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
             | ||  |||||||| | |||||||||||||||||| ||||||||||
Sbjct: 2013 caagagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 1967



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                        
Query: 316  aaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttg 375
            |||||||||||||||  |||||||||||| ||||||||| | || || ||||||||||||
Sbjct: 1901 aaggagttcatgatgctcatggccttggaagagatgccggtatcggggtgcacctgcttg 1842

                 
Query: 376  agcac 380
            |||||
Sbjct: 1841 agcac 1837



to top

>gb|M31921.1|VVCH2AB V.carteri histone H2A-III and H2B-III genes, complete cds
          Length = 1442

 Score =  109 bits (55), Expect = 7e-21
 Identities = 103/119 (86%)
 Strand = Plus / Minus

                                                                        
Query: 145  gtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 204
            |||||||||||||| |||||||| |||||||| || ||||||||||| |||||||| || 
Sbjct: 1264 gtgaacttggtgacagccttggttccctcggacacagcgtgcttggccagctcgcctggc 1205

                                                                       
Query: 205  aggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
            ||||| ||||| ||||  |||||||| || || ||||||| ||| ||||||||||||||
Sbjct: 1204 aggacaaggcgcacggcagtctggatttcgcgagacgtgacggtcggcttcttgttgta 1146



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 83/96 (86%)
 Strand = Plus / Minus

                                                                        
Query: 288  ggcgagcttctcaaaaatgtcgttgatgaaggagttcatgatggacatggccttggagga 347
            ||||| ||||||||| |||||||||||||||  ||||||||||  ||| |||||||||  
Sbjct: 1121 ggcgaccttctcaaatatgtcgttgatgaagctgttcatgatgctcatcgccttggagct 1062

                                                
Query: 348  gatgccgatgtccggctgcacctgcttgagcacctt 383
            ||||||| |||| || ||||||||||| ||||||||
Sbjct: 1061 gatgccggtgtcagggtgcacctgcttcagcacctt 1026



to top

>ref|XM_513764.1| PREDICTED: Pan troglodytes LOC457261 (LOC457261), mRNA
          Length = 789

 Score =  107 bits (54), Expect = 3e-20
 Identities = 91/102 (89%), Gaps = 1/102 (0%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 208
           |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 186 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 127

                                                     
Query: 209 cgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
             ||||| ||||  |||||||||| |||||||||||||||||
Sbjct: 126 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 86



 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 89/102 (87%)
 Strand = Plus / Plus

                                                                       
Query: 149 acttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 208
           |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 293 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 352

                                                     
Query: 209 cgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
             ||||| ||||  |||||||||||| ||  |||||||||||
Sbjct: 353 gcaggcgcacggccgtctggatctccgggagcgtgatggtgg 394



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 304 atgtcgttgatgaaggagttcatgatg 330
           |||||||||| ||||||||||||||||
Sbjct: 32  atgtcgttgaggaaggagttcatgatg 6



to top

>gb|AY656810.1| Homo sapiens H2B/t variant gene, complete cds
          Length = 1874

 Score =  107 bits (54), Expect = 3e-20
 Identities = 91/102 (89%), Gaps = 1/102 (0%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 208
           |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 743 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 684

                                                     
Query: 209 cgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
             ||||| ||||  |||||||||| |||||||||||||||||
Sbjct: 683 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 643



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||| |  |||||||| |||| || 
Sbjct: 589 atgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggtgtcgggg 530

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || ||| |||| |||||||||
Sbjct: 529 tggacccgcttcagcaccttg 509



to top

>gb|AY648853.1| Homo sapiens histone H2B/s (HIST2H2BD) gene, complete cds
          Length = 1861

 Score =  107 bits (54), Expect = 3e-20
 Identities = 91/102 (89%), Gaps = 1/102 (0%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 208
           |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 743 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 684

                                                     
Query: 209 cgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
             ||||| ||||  |||||||||| |||||||||||||||||
Sbjct: 683 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 643



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||| |  |||||||| |||| || 
Sbjct: 589 atgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggtgtcgggg 530

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || ||| |||| |||||||||
Sbjct: 529 tggacccgcttcagcaccttg 509



to top

>gb|BC071638.1| Homo sapiens cDNA clone IMAGE:4390105, containing frame-shift
           errors
          Length = 618

 Score =  107 bits (54), Expect = 3e-20
 Identities = 91/102 (89%), Gaps = 1/102 (0%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 208
           |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 414 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 355

                                                     
Query: 209 cgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
             ||||| ||||  |||||||||| |||||||||||||||||
Sbjct: 354 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 314



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||| |  |||||||| |||| || 
Sbjct: 260 atgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggtgtcgggg 201

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || ||| |||| |||||||||
Sbjct: 200 tggacccgcttcagcaccttg 180



to top

>gb|BC068044.1| Homo sapiens cDNA clone IMAGE:6380649, containing frame-shift
           errors
          Length = 687

 Score =  107 bits (54), Expect = 3e-20
 Identities = 91/102 (89%), Gaps = 1/102 (0%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 208
           |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 428 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 369

                                                     
Query: 209 cgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
             ||||| ||||  |||||||||| |||||||||||||||||
Sbjct: 368 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 328



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||| |  |||||||| |||| || 
Sbjct: 274 atgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggtgtcgggg 215

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || ||| |||| |||||||||
Sbjct: 214 tggacccgcttcagcaccttg 194



to top

>emb|BX008531.1|CNS08EQV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 499

 Score =  107 bits (54), Expect = 3e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 208
           |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||||| |
Sbjct: 445 acttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggggagca 386

                                                     
Query: 209 cgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
             || || || |  ||||||||||| ||||||||||||||||
Sbjct: 385 acagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 344



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 76/88 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||||||| 
Sbjct: 290 atgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtccggg 231

                                       
Query: 364 tgcacctgcttgagcaccttgaagatgt 391
           ||||||||||| ||||||||| ||||||
Sbjct: 230 tgcacctgcttcagcaccttgtagatgt 203



to top

>ref|XM_936779.1| PREDICTED: Homo sapiens similar to H2B histone family, member F
           (LOC647719), mRNA
          Length = 703

 Score =  107 bits (54), Expect = 3e-20
 Identities = 91/102 (89%), Gaps = 1/102 (0%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 208
           |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 484 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 425

                                                     
Query: 209 cgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
             ||||| ||||  |||||||||| |||||||||||||||||
Sbjct: 424 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 384



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||| |  |||||||| |||| || 
Sbjct: 330 atgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggtgtcgggg 271

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || ||| |||| |||||||||
Sbjct: 270 tggacccgcttcagcaccttg 250



to top

>ref|NG_002619.1| Homo sapiens histone 2, H2bc (HIST2H2BC) pseudogene on chromosome 1
          Length = 1134

 Score =  107 bits (54), Expect = 3e-20
 Identities = 91/102 (89%), Gaps = 1/102 (0%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 208
           |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 742 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 683

                                                     
Query: 209 cgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
             ||||| ||||  |||||||||| |||||||||||||||||
Sbjct: 682 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 642



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||| |  |||||||| |||| || 
Sbjct: 588 atgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggtgtcgggg 529

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || ||| |||| |||||||||
Sbjct: 528 tggacccgcttcagcaccttg 508



to top

>ref|NG_002620.1| Homo sapiens histone 2, H2bd (HIST2H2BD) pseudogene on chromosome 1
          Length = 1134

 Score =  107 bits (54), Expect = 3e-20
 Identities = 91/102 (89%), Gaps = 1/102 (0%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 208
           |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 741 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 682

                                                     
Query: 209 cgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
             ||||| ||||  |||||||||| |||||||||||||||||
Sbjct: 681 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 641



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||| |  |||||||| |||| || 
Sbjct: 587 atgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggtgtcgggg 528

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || ||| |||| |||||||||
Sbjct: 527 tggacccgcttcagcaccttg 507



to top

>gb|AY131977.1| Homo sapiens histone H2B (HIST2H2BC) pseudogene, complete sequence
          Length = 1134

 Score =  107 bits (54), Expect = 3e-20
 Identities = 91/102 (89%), Gaps = 1/102 (0%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 208
           |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 742 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 683

                                                     
Query: 209 cgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
             ||||| ||||  |||||||||| |||||||||||||||||
Sbjct: 682 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 642



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||| |  |||||||| |||| || 
Sbjct: 588 atgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggtgtcgggg 529

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || ||| |||| |||||||||
Sbjct: 528 tggacccgcttcagcaccttg 508



to top

>gb|AY131978.1| Homo sapiens histone H2B (HIST2H2BD) pseudogene, complete sequence
          Length = 1134

 Score =  107 bits (54), Expect = 3e-20
 Identities = 91/102 (89%), Gaps = 1/102 (0%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 208
           |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 741 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 682

                                                     
Query: 209 cgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
             ||||| ||||  |||||||||| |||||||||||||||||
Sbjct: 681 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 641



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||| |  |||||||| |||| || 
Sbjct: 587 atgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggtgtcgggg 528

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || ||| |||| |||||||||
Sbjct: 527 tggacccgcttcagcaccttg 507



to top

>ref|XM_425468.1| PREDICTED: Gallus gallus similar to H2B histone family, member F
           (LOC427894), mRNA
          Length = 381

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 310

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  || || ||||  |||||||||||||| |||||||||||
Sbjct: 309 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggt 265



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 209 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 150

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 149 tgcacctgcttcagcaccttg 129



to top

>ref|XM_425462.1| PREDICTED: Gallus gallus similar to H2B histone family, member F
           (LOC427888), mRNA
          Length = 381

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 310

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  || || ||||  |||||||||||||| |||||||||||
Sbjct: 309 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggt 265



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 209 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 150

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 149 tgcacctgcttcagcaccttg 129



to top

>ref|XM_425457.1| PREDICTED: Gallus gallus similar to H2B histone family, member F
           (LOC427883), mRNA
          Length = 381

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 310

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  || || ||||  |||||||||||||| |||||||||||
Sbjct: 309 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggt 265



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 209 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 150

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 149 tgcacctgcttcagcaccttg 129



to top

>ref|XM_416196.1| PREDICTED: Gallus gallus similar to H2B histone family, member F
           (LOC417956), mRNA
          Length = 841

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 576 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 517

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  || || ||||  |||||||||||||| |||||||||||
Sbjct: 516 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggt 472



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           ||||||||||  || ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 416 atgtcgttgacaaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 357

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 356 tgcacctgcttcagcaccttg 336



to top

>ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC417955),
           mRNA
          Length = 1220

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 267 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 326

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  || || ||||  |||||||||||||| |||||||||||
Sbjct: 327 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggt 371



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Plus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 427 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 486

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 487 tgcacctgcttcagcaccttg 507



to top

>ref|XM_582734.2| PREDICTED: Bos taurus similar to Histone H2B 291B (LOC506306), mRNA
          Length = 485

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 400 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccagg 341

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  || || ||||  ||||||||||||||||||||||||||
Sbjct: 340 cagcagaagtcgcacggccgtctggatctcccgggacgtgatggt 296



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           ||||||||||  || ||||||||||||  |||||| ||||| ||||||||| ||||||| 
Sbjct: 240 atgtcgttgacaaatgagttcatgatgcccatggctttggacgagatgccggtgtccggg 181

                                
Query: 364 tgcacctgcttgagcaccttg 384
           |||||||| || | |||||||
Sbjct: 180 tgcacctgtttcaacaccttg 160



to top

>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence
          Length = 209720

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                         
Query: 144   ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
             |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 92394 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 92335

                                                          
Query: 204   gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
              || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 92334 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 92290



 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                         
Query: 144   ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
             |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 61556 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 61497

                                                          
Query: 204   gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
              || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 61496 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 61452



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Plus

                                                                         
Query: 144   ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
             |||| |||| ||||| |||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 63577 ggtgtacttagtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 63636

                                                          
Query: 204   gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
              || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 63637 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 63681



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 90/105 (85%)
 Strand = Plus / Minus

                                                                         
Query: 144   ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
             |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 49790 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 49731

                                                          
Query: 204   gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
              || |  ||||| ||||  ||||||||||||||||| ||||||||
Sbjct: 49730 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggt 49686



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Plus

                                                                         
Query: 304   atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
             |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 63737 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 63796

                                  
Query: 364   tgcacctgcttgagcaccttg 384
             ||||| ||||| |||||||||
Sbjct: 63797 tgcacttgcttcagcaccttg 63817



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                         
Query: 304   atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
             |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 49630 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 49571

                                  
Query: 364   tgcacctgcttgagcaccttg 384
             ||||| ||||| |||||||||
Sbjct: 49570 tgcacttgcttcagcaccttg 49550



 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                         
Query: 319   gagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagc 378
             ||||||||||||  |||||||||||||||||||||| |||| || ||||| ||||| |||
Sbjct: 61381 gagttcatgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagc 61322

                   
Query: 379   accttg 384
             ||||||
Sbjct: 61321 accttg 61316



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                         
Query: 304   atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
             |||||||| | ||| ||||||||||||  |||||| ||||||||||||||| |||| || 
Sbjct: 92234 atgtcgttcacgaacgagttcatgatgcccatggctttggaggagatgccggtgtcgggg 92175

                                  
Query: 364   tgcacctgcttgagcaccttg 384
             ||||| ||||| |||||||||
Sbjct: 92174 tgcacttgcttcagcaccttg 92154



to top

>ref|XM_535910.2| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript
           variant 1 (LOC478743), mRNA
          Length = 1047

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 393 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 334

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 333 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 289



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 233 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 174

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 173 tgcacctgcttcagcaccttg 153



to top

>ref|XM_843136.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript
           variant 2 (LOC478743), mRNA
          Length = 487

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 393 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 334

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 333 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 289



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 233 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 174

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 173 tgcacctgcttcagcaccttg 153



to top

>ref|XM_849151.1| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC611482), mRNA
          Length = 386

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 374 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 315

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 314 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 270



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 214 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 155

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 154 tgcacctgcttcagcaccttg 134



to top

>ref|XM_849134.1| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC611465), mRNA
          Length = 388

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 376 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 317

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 316 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 272



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 216 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 157

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 156 tgcacctgcttcagcaccttg 136



to top

>ref|XM_545412.2| PREDICTED: Canis familiaris similar to H2B histone family, member T
           (LOC488290), mRNA
          Length = 421

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 376 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 317

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 316 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 272



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 216 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 157

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 156 tgcacctgcttcagcaccttg 136



to top

>ref|XM_545410.2| PREDICTED: Canis familiaris similar to H2B histone family, member R
           (LOC488288), mRNA
          Length = 384

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 372 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 313

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 312 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 268



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 212 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 153

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 152 tgcacctgcttcagcaccttg 132



to top

>ref|XM_545401.2| PREDICTED: Canis familiaris similar to H2B histone family, member F
           (LOC488279), mRNA
          Length = 513

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 438 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 379

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 378 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 334



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 278 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 219

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 218 tgcacctgcttcagcaccttg 198



to top

>ref|XM_545398.2| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC488276), mRNA
          Length = 438

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 376 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 317

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 316 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 272



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 216 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 157

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 156 tgcacctgcttcagcaccttg 136



to top

>ref|XM_848802.1| PREDICTED: Canis familiaris similar to H2B histone family, member T
           (LOC611158), mRNA
          Length = 883

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 363 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 304

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 303 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 259



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 203 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 144

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 143 tgcacctgcttcagcaccttg 123



to top

>ref|XM_848767.1| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC611126), mRNA
          Length = 751

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 395 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctccccggg 336

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 335 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 291



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 235 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 176

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 175 tgcacctgcttcagcaccttg 155



to top

>ref|XM_545418.1| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC488296), mRNA
          Length = 381

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 310

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 265



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 209 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 150

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 149 tgcacctgcttcagcaccttg 129



to top

>ref|XM_848724.1| PREDICTED: Canis familiaris similar to H2B histone family, member F
           (LOC611089), mRNA
          Length = 381

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 310

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 265



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 209 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 150

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 149 tgcacctgcttcagcaccttg 129



to top

>ref|XM_545375.1| PREDICTED: Canis familiaris similar to testis-specific histone 2b
           (LOC488253), mRNA
          Length = 384

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 372 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 313

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 312 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 268



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 212 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 153

                               
Query: 364 tgcacctgcttgagcacctt 383
           ||||||||||| ||||||||
Sbjct: 152 tgcacctgcttcagcacctt 133



to top

>ref|XM_545374.2| PREDICTED: Canis familiaris similar to testis-specific histone 2b
           (LOC488252), mRNA
          Length = 384

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 372 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 313

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 312 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 268



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 212 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 153

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 152 tgcacctgcttcagcaccttg 132



to top

>ref|XM_844623.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript
           variant 1 (LOC608682), mRNA
          Length = 342

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 330 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 271

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 270 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 226



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 170 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 111

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 110 tgcacctgcttcagcaccttg 90



to top

>ref|XM_854475.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript
           variant 2 (LOC608682), mRNA
          Length = 383

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 371 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 312

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 311 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 267



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 211 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 152

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 151 tgcacctgcttcagcaccttg 131



to top

>ref|XM_854447.1| PREDICTED: Canis familiaris similar to H2B histone family, member
           T, transcript variant 3 (LOC488303), mRNA
          Length = 651

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 385 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 326

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 325 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 281



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 225 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 166

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 165 tgcacctgcttcagcaccttg 145



to top

>ref|XM_545425.2| PREDICTED: Canis familiaris similar to H2B histone family, member
           T, transcript variant 2 (LOC488303), mRNA
          Length = 442

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 310

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 265



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 209 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 150

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 149 tgcacctgcttcagcaccttg 129



to top

>ref|XM_854265.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript
           variant 2 (LOC488267), mRNA
          Length = 440

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 377 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 318

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 317 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 273



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 217 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 158

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 157 tgcacctgcttcagcaccttg 137



to top

>ref|XM_545389.2| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript
           variant 1 (LOC488267), mRNA
          Length = 1108

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 377 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 318

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 317 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 273



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 217 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 158

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 157 tgcacctgcttcagcaccttg 137



to top

>ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 3 (LOC480760), mRNA
          Length = 862

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 768 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 709

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 708 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 664



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 608 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 549

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 548 tgcacctgcttcagcaccttg 528



to top

>ref|XM_854116.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 2 (LOC480760), mRNA
          Length = 487

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 393 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 334

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 333 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 289



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 233 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 174

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 173 tgcacctgcttcagcaccttg 153



to top

>ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 1 (LOC480760), mRNA
          Length = 1422

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 768 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 709

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 708 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 664



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 608 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 549

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 548 tgcacctgcttcagcaccttg 528



to top

>ref|NM_022643.1| Rattus norvegicus histone 1, H2ba (Hist1h2ba), mRNA
          Length = 470

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| || ||||||||||| ||||| |||||
Sbjct: 413 ggtgtacttggtgaccgccttggtgccctcggacacagcgtgcttggccagctccccggg 354

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  |||||||| |  ||||||||||||||||||||||||||
Sbjct: 353 cagcagcaggcggacagccgtctggatctcccgggacgtgatggt 309



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 62/69 (89%)
 Strand = Plus / Minus

                                                                       
Query: 315 gaaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgctt 374
           ||||||||||||||||  |||||||||||| ||||||||| ||||||| ||||| |||||
Sbjct: 242 gaaggagttcatgatgctcatggccttggaagagatgccggtgtccgggtgcacttgctt 183

                    
Query: 375 gagcacctt 383
            ||||||||
Sbjct: 182 cagcacctt 174



to top

>ref|XM_781061.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B
           (LOC581037), mRNA
          Length = 468

 Score =  105 bits (53), Expect = 1e-19
 Identities = 104/121 (85%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| |||||||| |||||||| | ||| |||||
Sbjct: 456 ggtgtacttggtgacagccttggtgccctcagagacggcatgcttggccaactctccggg 397

                                                                       
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
           ||||| ||| ||||| | |||||||||||| |||    ||||||||| ||||||||||||
Sbjct: 396 gaggaggagacggacagcggtctggatctctcggctgctgatggtggacttcttgttgta 337

            
Query: 264 c 264
           |
Sbjct: 336 c 336



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 71/85 (83%)
 Strand = Plus / Minus

                                                                       
Query: 307 tcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggctgc 366
           ||||||| ||||  ||||||||||||||||||||||  |||||| ||  |||| || || 
Sbjct: 293 tcgttgacgaagctgttcatgatggacatggccttgctggagataccagtgtcggggtgg 234

                                    
Query: 367 acctgcttgagcaccttgaagatgt 391
           |||||||| || |||||| ||||||
Sbjct: 233 acctgcttcagaaccttgtagatgt 209



to top

>emb|X59962.1|RNTH2AB R.norvegicus genes for TH2A and TH2B histones
          Length = 1653

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| || ||||||||||| ||||| |||||
Sbjct: 461 ggtgtacttggtgaccgccttggtgccctcggacacagcgtgcttggccagctccccggg 520

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  |||||||| |  ||||||||||||||||||||||||||
Sbjct: 521 cagcagcaggcggacagccgtctggatctcccgggacgtgatggt 565



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 62/69 (89%)
 Strand = Plus / Plus

                                                                       
Query: 315 gaaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgctt 374
           ||||||||||||||||  |||||||||||| ||||||||| ||||||| ||||| |||||
Sbjct: 632 gaaggagttcatgatgctcatggccttggaagagatgccggtgtccgggtgcacttgctt 691

                    
Query: 375 gagcacctt 383
            ||||||||
Sbjct: 692 cagcacctt 700



to top

>emb|X07766.1|GGH2AB11 Chicken DNA for CH1-10 histone H2A/H2B sequence
          Length = 1113

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 990 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 931

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  || || ||||  |||||||||||||| |||||||||||
Sbjct: 930 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggt 886



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 830 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 771

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 770 tgcacctgcttcagcaccttg 750



to top

>emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A)
          Length = 1797

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 290 ggtgtacttggtgactgccttggtgccctccgacaccgcgtgcttggccagctccccggg 349

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 350 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 394



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Plus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 450 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 509

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 510 tgcacttgcttcagcaccttg 530



to top

>emb|X02621.1|MMHISH2B Mouse gene for histone H2b
          Length = 688

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 539 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 480

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 479 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 435



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 379 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 320

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 319 tgcacttgcttcagcaccttg 299



to top

>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a
             novel gene, the genes for three H1, four H2a, five H2b,
             four H3 and four H4 histone family members, the 3' end of
             a variant of the Hfe gene for hemochromatosis protein
             (Mr2) and ten CpG islands, complete sequence
          Length = 184730

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                         
Query: 144   ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
             |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 54428 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 54487

                                                          
Query: 204   gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
              || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 54488 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 54532



 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                         
Query: 144   ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
             |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 23586 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 23645

                                                          
Query: 204   gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
              || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 23646 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 23690



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                          
Query: 144    ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
              |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 165015 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 164956

                                                           
Query: 204    gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
               || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 164955 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 164911



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                         
Query: 144   ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
             |||| |||| ||||| |||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 52407 ggtgtacttagtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 52348

                                                          
Query: 204   gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
              || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 52347 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 52303



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 90/105 (85%)
 Strand = Plus / Plus

                                                                         
Query: 144   ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
             |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 66003 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 66062

                                                          
Query: 204   gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
              || |  ||||| ||||  ||||||||||||||||| ||||||||
Sbjct: 66063 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggt 66107



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                          
Query: 304    atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
              |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 164855 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 164796

                                   
Query: 364    tgcacctgcttgagcaccttg 384
              ||||| ||||| |||||||||
Sbjct: 164795 tgcacttgcttcagcaccttg 164775



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Plus

                                                                         
Query: 304   atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
             |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 66163 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 66222

                                  
Query: 364   tgcacctgcttgagcaccttg 384
             ||||| ||||| |||||||||
Sbjct: 66223 tgcacttgcttcagcaccttg 66243



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                         
Query: 304   atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
             |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 52247 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 52188

                                  
Query: 364   tgcacctgcttgagcaccttg 384
             ||||| ||||| |||||||||
Sbjct: 52187 tgcacttgcttcagcaccttg 52167



 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 59/66 (89%)
 Strand = Plus / Plus

                                                                         
Query: 319   gagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagc 378
             ||||||||||||  |||||||||||||||||||||| |||| || ||||| ||||| |||
Sbjct: 54603 gagttcatgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagc 54662

                   
Query: 379   accttg 384
             ||||||
Sbjct: 54663 accttg 54668



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Plus

                                                                         
Query: 304   atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
             |||||||| | ||| ||||||||||||  |||||| ||||||||||||||| |||| || 
Sbjct: 23746 atgtcgttcacgaacgagttcatgatgcccatggctttggaggagatgccggtgtcgggg 23805

                                  
Query: 364   tgcacctgcttgagcaccttg 384
             ||||| ||||| |||||||||
Sbjct: 23806 tgcacttgcttcagcaccttg 23826



to top

>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five
              genes for olfactory receptors, a novel gene, the H1f5 gene
              for H1 histone family member 5, three genes and one
              pseudogene for H2a histone family members, four genes for
              H2b, two genes for H4, and two genes for H3 histone family
              members and seven CpG islands, complete sequence
          Length = 222823

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                          
Query: 144    ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
              |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 136765 ggtgtacttggtgactgccttggtgccctccgacaccgcgtgcttggccagctccccggg 136824

                                                           
Query: 204    gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
               || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 136825 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 136869



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                          
Query: 144    ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
              |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 208873 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 208814

                                                           
Query: 204    gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
               || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 208813 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 208769



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                          
Query: 144    ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
              |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 175481 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 175422

                                                           
Query: 204    gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
               || |  ||||| ||||  ||||||||||||||||| ||||||||
Sbjct: 175421 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggt 175377



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                          
Query: 144    ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
              |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 143456 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgcttggccagctccccggg 143397

                                                           
Query: 204    gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
               || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 143396 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 143352



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                          
Query: 304    atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
              |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 208713 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 208654

                                   
Query: 364    tgcacctgcttgagcaccttg 384
              ||||| ||||| |||||||||
Sbjct: 208653 tgcacttgcttcagcaccttg 208633



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                          
Query: 304    atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
              |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 175321 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 175262

                                   
Query: 364    tgcacctgcttgagcaccttg 384
              ||||| ||||| |||||||||
Sbjct: 175261 tgcacttgcttcagcaccttg 175241



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                          
Query: 304    atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
              |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 143296 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 143237

                                   
Query: 364    tgcacctgcttgagcaccttg 384
              ||||| ||||| |||||||||
Sbjct: 143236 tgcacttgctttagcaccttg 143216



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Plus

                                                                          
Query: 304    atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
              |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 136925 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 136984

                                   
Query: 364    tgcacctgcttgagcaccttg 384
              ||||| ||||| |||||||||
Sbjct: 136985 tgcacttgcttcagcaccttg 137005



to top

>gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone H2a.1-F (H2a-F), histone
            H2b-F (H2b-F) genes, complete cds
          Length = 2822

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                        
Query: 144  ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
            |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 2477 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 2418

                                                         
Query: 204  gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
             || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 2417 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 2373



 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                        
Query: 319  gagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagc 378
            ||||||||||||  |||||||||||||||||||||| |||| || ||||| ||||| |||
Sbjct: 2302 gagttcatgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagc 2243

                  
Query: 379  accttg 384
            ||||||
Sbjct: 2242 accttg 2237



to top

>emb|CR353801.1| Gallus gallus finished cDNA, clone ChEST919h3
          Length = 596

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 185 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 126

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  || || ||||  |||||||||||||| |||||||||||
Sbjct: 125 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggt 81



to top

>gb|BC092138.1| Mus musculus histone 1, H2bh, mRNA (cDNA clone MGC:106612
           IMAGE:30613720), complete cds
          Length = 457

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 376 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 317

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 316 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 272



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||| ||||||||||||||| |||| || 
Sbjct: 216 atgtcgttcacgaacgagttcatgatgcccatggctttggaggagatgccggtgtcgggg 157

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 156 tgcacttgcttcagcaccttg 136



to top

>ref|NM_178195.1| Mus musculus histone 1, H2bf (Hist1h2bf), mRNA
          Length = 381

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 369 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 310

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 265



 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                       
Query: 319 gagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagc 378
           ||||||||||||  |||||||||||||||||||||| |||| || ||||| ||||| |||
Sbjct: 194 gagttcatgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagc 135

                 
Query: 379 accttg 384
           ||||||
Sbjct: 134 accttg 129



to top

>ref|NM_178199.1| Mus musculus histone 1, H2bl (Hist1h2bl), mRNA
          Length = 381

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 369 ggtgtacttggtgactgccttggtgccctccgacaccgcgtgcttggccagctccccggg 310

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 265



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 209 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 150

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 149 tgcacttgcttcagcaccttg 129



to top

>ref|XM_214483.3| PREDICTED: Rattus norvegicus histone 1, H2bn (predicted)
           (Hist1h2bn_predicted), mRNA
          Length = 499

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| || ||||||||||| ||||| |||||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacagcgtgcttggccagctccccggg 310

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 265



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  ||||||||| || ||||||||  ||||||| 
Sbjct: 209 atgtcgttcacgaacgagttcatgatgcccatggccttagaagagatgcccgtgtccggg 150

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 149 tgcacttgcttcagcaccttg 129



to top

>gb|AY158935.1| Mus musculus histone protein Hist1h2bf gene, complete cds
          Length = 1375

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 866 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 807

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 806 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 762



 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                       
Query: 319 gagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagc 378
           ||||||||||||  |||||||||||||||||||||| |||| || ||||| ||||| |||
Sbjct: 691 gagttcatgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagc 632

                 
Query: 379 accttg 384
           ||||||
Sbjct: 631 accttg 626



to top

>gb|AY158933.1| Mus musculus histone protein Hist1h2bh gene, complete cds
          Length = 1201

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 792 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 733

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 732 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 688



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||| ||||||||||||||| |||| || 
Sbjct: 632 atgtcgttcacgaacgagttcatgatgcccatggctttggaggagatgccggtgtcgggg 573

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 572 tgcacttgcttcagcaccttg 552



to top

>gb|AY158927.1| Mus musculus histone protein Hist1h2bl gene, complete cds
          Length = 1375

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 866 ggtgtacttggtgactgccttggtgccctccgacaccgcgtgcttggccagctccccggg 807

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 806 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 762



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 706 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 647

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 646 tgcacttgcttcagcaccttg 626



to top

>emb|X05099.1|GGH2B6 Chicken histone H2B gene (pBRA-5.4)
          Length = 705

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 594 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 535

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  || || ||||  |||||||||||||| |||||||||||
Sbjct: 534 cagcagcagccgcacggctgtctggatctcccgcgacgtgatggt 490



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||| || || ||||||||  |||| || 
Sbjct: 434 atgtcgttgacgaacgagttcatgatgctcatggctttagatgagatgcccgtgtcgggg 375

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 374 tgcacctgcttcagcaccttg 354



to top

>emb|X57263.1|GGH2B4G Chicken gene for histone H2B-IV
          Length = 1042

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 602 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 543

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  || || ||||  |||||||||||||| |||||||||||
Sbjct: 542 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggt 498



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           ||||||||||  || ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 442 atgtcgttgacaaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 383

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 382 tgcacctgcttcagcaccttg 362



to top

>gb|U37575.1|GGU37575 Gallus gallus histones H4-VI, H2B-VII and H4-VII genes, complete cds
          Length = 2297

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                        
Query: 144  ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
            |||| |||||||||| |||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 1435 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 1376

                                                         
Query: 204  gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
             || |  || || ||||  |||||||||||||| |||||||||||
Sbjct: 1375 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggt 1331



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                        
Query: 304  atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
            |||||||||| ||| ||||||||||||  |||||| || || ||||||||  |||| || 
Sbjct: 1275 atgtcgttgacgaacgagttcatgatgctcatggctttagatgagatgcccgtgtcgggg 1216

                                 
Query: 364  tgcacctgcttgagcaccttg 384
            ||||||||||| |||||||||
Sbjct: 1215 tgcacctgcttcagcaccttg 1195



to top

>gb|U93853.1|ECU93853 Euplotes crassus histone H2B (H2B(2)) gene, complete cds
          Length = 1522

 Score =  105 bits (53), Expect = 1e-19
 Identities = 155/189 (82%)
 Strand = Plus / Minus

                                                                        
Query: 142  gaggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccg 201
            |||||| |||||||||| |||||||| ||||| |||||||| ||||||||||| || || 
Sbjct: 1164 gaggtgtacttggtgacagccttggttccctcagagacggcatgcttggcgagttctcct 1105

                                                                        
Query: 202  gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 261
            ||||| | ||| | ||||| |||||||| ||| | ||| | ||  ||| |||||||||||
Sbjct: 1104 gggagtaagagtctgacggcggtctggacctctctggatgagagagtgtgcttcttgttg 1045

                                                                        
Query: 262  tacctcgcgagcttggcggattcgccggcgagcttctcaaaaatgtcgttgatgaaggag 321
            || ||  | |||||||  | |||    |||| ||||||||| ||||||||||||||||||
Sbjct: 1044 tatctgacaagcttggaagcttccaaagcgatcttctcaaagatgtcgttgatgaaggag 985

                     
Query: 322  ttcatgatg 330
            |||||||||
Sbjct: 984  ttcatgatg 976



to top

>ref|NM_178197.1| Mus musculus histone 1, H2bh (Hist1h2bh), mRNA
          Length = 381

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 369 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 310

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 265



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||| ||||||||||||||| |||| || 
Sbjct: 209 atgtcgttcacgaacgagttcatgatgcccatggctttggaggagatgccggtgtcgggg 150

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 149 tgcacttgcttcagcaccttg 129



to top

>gb|M18046.1|RATHISTSA Rat testis-specific histone H2B mRNA, complete cds
          Length = 470

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| || ||||||||||| ||||| |||||
Sbjct: 413 ggtgtacttggtgaccgccttggtgccctcggacacagcgtgcttggccagctccccggg 354

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  |||||||| |  ||||||||||||||||||||||||||
Sbjct: 353 cagcagcaggcggacagccgtctggatctcccgggacgtgatggt 309



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 62/69 (89%)
 Strand = Plus / Minus

                                                                       
Query: 315 gaaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgctt 374
           ||||||||||||||||  |||||||||||| ||||||||| ||||||| ||||| |||||
Sbjct: 242 gaaggagttcatgatgctcatggccttggaagagatgccggtgtccgggtgcacttgctt 183

                    
Query: 375 gagcacctt 383
            ||||||||
Sbjct: 182 cagcacctt 174



to top

>gb|M18045.1|RATHISTS Rat testis-specific histone TH2B mRNA, complete cds
          Length = 470

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| || ||||||||||| ||||| |||||
Sbjct: 413 ggtgtacttggtgaccgccttggtgccctcggacacagcgtgcttggccagctccccggg 354

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  |||||||| |  ||||||||||||||||||||||||||
Sbjct: 353 cagcagcaggcggacagccgtctggatctcccgggacgtgatggt 309



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 62/69 (89%)
 Strand = Plus / Minus

                                                                       
Query: 315 gaaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgctt 374
           ||||||||||||||||  |||||||||||| ||||||||| ||||||| ||||| |||||
Sbjct: 242 gaaggagttcatgatgctcatggccttggaagagatgccggtgtccgggtgcacttgctt 183

                    
Query: 375 gagcacctt 383
            ||||||||
Sbjct: 182 cagcacctt 174



to top

>gb|M57901.1|CHKH2BB Chicken histone H2B gene, complete cds
          Length = 1298

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 791 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 732

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  || || ||||  |||||||||||||| |||||||||||
Sbjct: 731 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggt 687



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 631 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 572

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 571 tgcacctgcttcagcaccttg 551



to top

>ref|XM_427116.1| PREDICTED: Gallus gallus similar to histone H2B.8 - chicken
           (LOC429558), mRNA
          Length = 381

 Score =  103 bits (52), Expect = 4e-19
 Identities = 79/88 (89%)
 Strand = Plus / Minus

                                                                       
Query: 297 ctcaaaaatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 356
           |||||| |||||||||| ||||||||||||||||  |||||||||||||||||||||| |
Sbjct: 216 ctcaaagatgtcgttgacgaaggagttcatgatgcccatggccttggaggagatgccggt 157

                                       
Query: 357 gtccggctgcacctgcttgagcaccttg 384
           ||| || || |||||||| |||||||||
Sbjct: 156 gtcggggtggacctgctttagcaccttg 129



 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| |||||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctcagagacggcgtgcttggccagctctccggg 310

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  |||||||||||||| || ||||||||||
Sbjct: 309 cagcagcaggcgcacggctgtctggatctcccgcgaggtgatggtgg 263



to top

>ref|XM_427013.1| PREDICTED: Gallus gallus similar to histone H2B.8 - chicken
           (LOC429457), partial mRNA
          Length = 628

 Score =  103 bits (52), Expect = 4e-19
 Identities = 79/88 (89%)
 Strand = Plus / Minus

                                                                       
Query: 297 ctcaaaaatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 356
           |||||| |||||||||| ||||||||||||||||  |||||||||||||||||||||| |
Sbjct: 463 ctcaaagatgtcgttgacgaaggagttcatgatgcccatggccttggaggagatgccggt 404

                                       
Query: 357 gtccggctgcacctgcttgagcaccttg 384
           ||| || || |||||||| |||||||||
Sbjct: 403 gtcggggtggacctgctttagcaccttg 376



 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| |||||
Sbjct: 616 ggtgtacttggtgacggccttggtgccctcagagacggcgtgcttggccagctctccggg 557

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  ||||| ||||  |||||||||||||| || ||||||||||
Sbjct: 556 cagcagcaggcgcacggctgtctggatctcccgcgaggtgatggtgg 510



to top

>ref|XM_786200.1| PREDICTED: Strongylocentrotus purpuratus similar to H2B histone
           family, member F (LOC586416), mRNA
          Length = 471

 Score =  103 bits (52), Expect = 4e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| |||||||||||||||||||| || |||||
Sbjct: 363 ggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggcgagttctccggg 304

                                                                       
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
           ||||| ||| | ||| | |||||||| ||| |||    ||||||||| ||||||||||||
Sbjct: 303 gaggaggagtctgacagcggtctggacctcacggctgctgatggtggacttcttgttgta 244



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 307 tcgttgatgaaggagttcatgatggacatggc 338
           ||||||| ||||  ||||||||||||||||||
Sbjct: 200 tcgttgacgaagctgttcatgatggacatggc 169



to top

>ref|XM_786178.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B
           291B (LOC586394), mRNA
          Length = 375

 Score =  103 bits (52), Expect = 4e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| |||||||||||||||||||| || |||||
Sbjct: 363 ggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggcgagttctccggg 304

                                                                       
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
           ||||| ||| | ||| | |||||||| ||| |||    ||||||||| ||||||||||||
Sbjct: 303 gaggaggagtctgacagcggtctggacctcacggctgctgatggtggacttcttgttgta 244



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 307 tcgttgatgaaggagttcatgatggacatggc 338
           ||||||| ||||  ||||||||||||||||||
Sbjct: 200 tcgttgacgaagctgttcatgatggacatggc 169



to top

>emb|X06643.1|SPH2BL4 Strongylocentrotus purpuratus late histone gene fragment L4 H2b
          Length = 627

 Score =  103 bits (52), Expect = 4e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| |||||||||||||||||||| || |||||
Sbjct: 314 ggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggcgagttctccggg 255

                                                                       
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
           ||||| ||| | ||| | |||||||| ||| |||    ||||||||| ||||||||||||
Sbjct: 254 gaggaggagcctgacagcggtctggacctcacggctgctgatggtggacttcttgttgta 195



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 307 tcgttgatgaaggagttcatgatggacatggc 338
           ||||||| ||||  ||||||||||||||||||
Sbjct: 151 tcgttgacgaagctgttcatgatggacatggc 120



to top

>emb|X06640.1|SPH2BL1 Strongylocentrotus purpuratus late histone gene L1 H2b
          Length = 1497

 Score =  103 bits (52), Expect = 4e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                        
Query: 144  ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
            |||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| |||||
Sbjct: 1352 ggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggccagctctccggg 1293

                                                                        
Query: 204  gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
            ||||| ||| | ||||  |||||||| ||| ||    |||||||||| ||||||||||||
Sbjct: 1292 gaggaggagtctgacgacggtctggacctcacgactggtgatggtggacttcttgttgta 1233



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                        
Query: 321  gttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcac 380
            ||||||||||||||||||   |  |||||||||  |||| || || |||||||| |||||
Sbjct: 1175 gttcatgatggacatggcacggctggagatgccagtgtcagggtgaacctgcttcagcac 1116

                       
Query: 381  cttgaagatgt 391
            |||| ||||||
Sbjct: 1115 cttgtagatgt 1105



to top

>emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chromosome 13 Contains the
             3' end of the gene for a novel protein similar to nuclear
             envelope pore membrane protein POM121, the Prss16 gene for
             thymus serine protease16, three novel genes, the genes for
             two H2a, two H2b and one H4 histone family members, a
             ribosomal protein L37A (Rpl37a) pseudogene, a novel
             pseudogene, three genes for novel vomeronasal 1 receptor H
             (V1rh) family members, the gene for a novel vomeronasal 1
             receptor I (V1ri) family member, six V1ri pseudogenes, a
             V1rh pseudogene and six CpG islands, complete sequence
          Length = 210845

 Score =  103 bits (52), Expect = 4e-19
 Identities = 88/100 (88%)
 Strand = Plus / Minus

                                                                         
Query: 149   acttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 208
             |||||||||| |||||||||||||| || |||||||||||||| ||||| ||||| || |
Sbjct: 53606 acttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccgggcagca 53547

                                                     
Query: 209   cgaggcggacggaggtctggatctcccgggacgtgatggt 248
               ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 53546 gcaggcgcacggccgtctggatctcccgggacgtgatggt 53507



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                         
Query: 144   ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
             |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 60954 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 60895

                                                          
Query: 204   gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
              || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 60894 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 60850



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                         
Query: 304   atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
             |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 53451 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 53392

                                  
Query: 364   tgcacctgcttgagcaccttg 384
             ||||| ||||| |||||||||
Sbjct: 53391 tgcacttgcttcagcaccttg 53371



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                         
Query: 304   atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
             |||||||| | ||| ||||||||||||  |||||||||||||||||| ||| |||| || 
Sbjct: 60794 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagataccggtgtcgggg 60735

                                  
Query: 364   tgcacctgcttgagcaccttg 384
             ||||| ||||| |||||||||
Sbjct: 60734 tgcacttgcttcagcaccttg 60714



to top

>gb|AY158931.1| Mus musculus histone protein Hist1h2bk gene, complete cds
          Length = 1201

 Score =  103 bits (52), Expect = 4e-19
 Identities = 88/100 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 208
           |||||||||| |||||||||||||| || |||||||||||||| ||||| ||||| || |
Sbjct: 847 acttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccgggcagca 788

                                                   
Query: 209 cgaggcggacggaggtctggatctcccgggacgtgatggt 248
             ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 787 gcaggcgcacggccgtctggatctcccgggacgtgatggt 748



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 692 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 633

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 632 tgcacttgcttcagcaccttg 612



to top

>ref|NM_214552.1| Strongylocentrotus purpuratus late histone L1 H2b (LOC373347), mRNA
          Length = 372

 Score =  103 bits (52), Expect = 4e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| |||||
Sbjct: 360 ggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggccagctctccggg 301

                                                                       
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
           ||||| ||| | ||||  |||||||| ||| ||    |||||||||| ||||||||||||
Sbjct: 300 gaggaggagtctgacgacggtctggacctcacgactggtgatggtggacttcttgttgta 241



 Score = 46.1 bits (23), Expect = 0.085
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 321 gttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcac 380
           ||||||||||||||||||   |  |||||||||  |||| || || |||||||| |||||
Sbjct: 183 gttcatgatggacatggcacggctggagatgccagtgtcagggtgaacctgcttcagcac 124

                      
Query: 381 cttgaagatgt 391
           |||| ||||||
Sbjct: 123 cttgtagatgt 113



to top

>emb|X05100.1|GGH2B7 Chicken histone H2B gene (pPP2d-4.0)
          Length = 374

 Score =  103 bits (52), Expect = 4e-19
 Identities = 88/100 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 208
           |||||||||| |||||||||||||||||||| ||||||||||| ||||||||||| || |
Sbjct: 258 acttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccgggcagca 199

                                                   
Query: 209 cgaggcggacggaggtctggatctcccgggacgtgatggt 248
             || || ||||  |||||||||||||| |||||||||||
Sbjct: 198 gcagccgcacggccgtctggatctcccgcgacgtgatggt 159



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 103 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 44

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 43  tgcacctgcttcagcaccttg 23



to top

>ref|NM_175665.1| Mus musculus histone 1, H2bk (Hist1h2bk), mRNA
          Length = 381

 Score =  103 bits (52), Expect = 4e-19
 Identities = 88/100 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 208
           |||||||||| |||||||||||||| || |||||||||||||| ||||| ||||| || |
Sbjct: 364 acttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccgggcagca 305

                                                   
Query: 209 cgaggcggacggaggtctggatctcccgggacgtgatggt 248
             ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 304 gcaggcgcacggccgtctggatctcccgggacgtgatggt 265



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 209 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 150

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 149 tgcacttgcttcagcaccttg 129



to top

>gb|BC077692.1| Xenopus tropicalis histone 1, H2bk, mRNA (cDNA clone MGC:89948
           IMAGE:7030528), complete cds
          Length = 540

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| ||||||| || ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 409 ggtgtacttggtaacagccttggtgccctcggacacggcgtgcttggccagctccccagg 350

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  |||||||| | |||||||||||||||||| ||||||||||
Sbjct: 349 cagcagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 303



 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 69/78 (88%)
 Strand = Plus / Minus

                                                                       
Query: 307 tcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggctgc 366
           |||||||  |||||||||||||||  |||||||||||||||||||||| | || || |||
Sbjct: 246 tcgttgacaaaggagttcatgatgctcatggccttggaggagatgccggtatcggggtgc 187

                             
Query: 367 acctgcttgagcaccttg 384
           |||||||| |||||||||
Sbjct: 186 acctgcttcagcaccttg 169



to top

>ref|XM_954347.1| Neurospora crassa OR74A hypothetical protein (NCU02435.1) partial
           mRNA
          Length = 414

 Score =  101 bits (51), Expect = 2e-18
 Identities = 99/115 (86%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 208
           ||||||| || ||||| ||||| || || || ||||||||||| ||||||||||||||||
Sbjct: 394 acttggtaacggccttagtgccttccgatacagcgtgcttggcaagctcgccggggagga 335

                                                                  
Query: 209 cgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
            |||||| || |||||||||||||| || || | |||||||| ||||||||||||
Sbjct: 334 tgaggcgaacagaggtctggatctcacgagaggagatggtggacttcttgttgta 280



to top

>ref|XM_331210.1| Neurospora crassa OR74A hypothetical protein (NCU02435.1) partial
           mRNA
          Length = 414

 Score =  101 bits (51), Expect = 2e-18
 Identities = 99/115 (86%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 208
           ||||||| || ||||| ||||| || || || ||||||||||| ||||||||||||||||
Sbjct: 394 acttggtaacggccttagtgccttccgatacagcgtgcttggcaagctcgccggggagga 335

                                                                  
Query: 209 cgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
            |||||| || |||||||||||||| || || | |||||||| ||||||||||||
Sbjct: 334 tgaggcgaacagaggtctggatctcacgagaggagatggtggacttcttgttgta 280



to top

>ref|XM_545431.2| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC488309), partial mRNA
          Length = 705

 Score =  101 bits (51), Expect = 2e-18
 Identities = 87/99 (87%)
 Strand = Plus / Minus

                                                                       
Query: 150 cttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggac 209
           ||||||||| ||||||||||||||||| |||||||||||||| ||||| ||||| || | 
Sbjct: 363 cttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcag 304

                                                  
Query: 210 gaggcggacggaggtctggatctcccgggacgtgatggt 248
            ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 303 caggcgcacggccgtctggatctccctggacgtgatggt 265



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 209 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 150

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 149 tgcacctgcttcagcaccttg 129



to top

>emb|BX068880.1|CNS09PB8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 780

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Plus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 270 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 329

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
           ||| |  ||  | || |  ||||||||||| ||||||||||||||||
Sbjct: 330 gagcaacagttgcaccgccgtctggatctcgcgggacgtgatggtgg 376



 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                       
Query: 321 gttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttgagcac 380
           ||||||||||  ||| ||||||||||| |||||| ||||||| ||||||||||| |||||
Sbjct: 447 gttcatgatgctcatcgccttggaggaaatgccggtgtccgggtgcacctgcttcagcac 506

                      
Query: 381 cttgaagatgt 391
           |||| ||||||
Sbjct: 507 cttgtagatgt 517



to top

>emb|BX053939.1|CNS09DS7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31DF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 722

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Plus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 235 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 294

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
           ||| |  ||  | || |  ||||||||||| ||||||||||||||||
Sbjct: 295 gagcaacagttgcaccgccgtctggatctcgcgggacgtgatggtgg 341



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 63/72 (87%), Gaps = 1/72 (1%)
 Strand = Plus / Plus

                                                                       
Query: 321 gttcatgatggacatggccttgg-aggagatgccgatgtccggctgcacctgcttgagca 379
           ||||||||||  ||| ||||||| |||| |||||| ||||||| ||||||||||| ||||
Sbjct: 412 gttcatgatgctcatcgccttgggaggaaatgccggtgtccgggtgcacctgcttcagca 471

                       
Query: 380 ccttgaagatgt 391
           ||||| ||||||
Sbjct: 472 ccttgtagatgt 483



to top

>emb|BX053938.1|CNS09DS6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31DF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| ||||||| || ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 693 ggtgtacttggtaacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 634

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
           ||| |  || || || |  ||||||||||| ||||||||||||||||
Sbjct: 633 gagcaaaagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 587



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 76/88 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||||||| 
Sbjct: 533 atgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtccggg 474

                                       
Query: 364 tgcacctgcttgagcaccttgaagatgt 391
           ||||||||||| ||||||||| ||||||
Sbjct: 473 tgcacctgcttcagcaccttgtagatgt 446



to top

>ref|NM_001006890.1| Xenopus tropicalis histone 1, H2bk (hist1h2bk), mRNA
          Length = 540

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| ||||||| || ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 409 ggtgtacttggtaacagccttggtgccctcggacacggcgtgcttggccagctccccagg 350

                                                          
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 250
            || |  |||||||| | |||||||||||||||||| ||||||||||
Sbjct: 349 cagcagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 303



 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 69/78 (88%)
 Strand = Plus / Minus

                                                                       
Query: 307 tcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggctgc 366
           |||||||  |||||||||||||||  |||||||||||||||||||||| | || || |||
Sbjct: 246 tcgttgacaaaggagttcatgatgctcatggccttggaggagatgccggtatcggggtgc 187

                             
Query: 367 acctgcttgagcaccttg 384
           |||||||| |||||||||
Sbjct: 186 acctgcttcagcaccttg 169



to top

>dbj|AK108119.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-139-C08, full
           insert sequence
          Length = 807

 Score =  101 bits (51), Expect = 2e-18
 Identities = 111/131 (84%)
 Strand = Plus / Minus

                                                                       
Query: 147 gaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggag 206
           |||||||||||| | ||||||||| ||||||| |||||||||||  ||||| ||||| ||
Sbjct: 486 gaacttggtgaccgacttggtgccttcggagatggcgtgcttggacagctcaccgggaag 427

                                                                       
Query: 207 gacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtacct 266
           || |||||| || | |||||||||||| || |||| |||||| | |||||||||||||  
Sbjct: 426 gatgaggcgaacagcggtctggatctctcgcgacgagatggtcgacttcttgttgtacga 367

                      
Query: 267 cgcgagcttgg 277
            ||||||||||
Sbjct: 366 agcgagcttgg 356



to top

>dbj|AB085854.1| Rosellinia necatrix hh2b gene for histone H2B, complete cds
          Length = 1819

 Score =  101 bits (51), Expect = 2e-18
 Identities = 99/115 (86%)
 Strand = Plus / Minus

                                                                        
Query: 149  acttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 208
            |||||||||| |||||||| || |||||||| || |||||||| || |||||||||||||
Sbjct: 1295 acttggtgacggccttggtaccttcggagacagcatgcttggcaagttcgccggggagga 1236

                                                                   
Query: 209  cgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
             ||||||||||||||||||||| || || || |  ||||||  ||||||||||||
Sbjct: 1235 tgaggcggacggaggtctggatttcacgcgaagaaatggtgctcttcttgttgta 1181



to top

>emb|BX034441.1|CNS08YQL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA50BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 773

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 89/102 (87%)
 Strand = Plus / Plus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 249 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 308

                                                     
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgat 245
           ||| |  || || || |  ||||||||||| |||||||||||
Sbjct: 309 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgat 350



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 76/88 (86%)
 Strand = Plus / Plus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| ||||||| 
Sbjct: 408 atgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtccggg 467

                                       
Query: 364 tgcacctgcttgagcaccttgaagatgt 391
           ||||||||||| ||||||||| ||||||
Sbjct: 468 tgcacctgcttcagcaccttgtagatgt 495



to top

>emb|BX014617.1|CNS08JFX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 409

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 170 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 111

                                                     
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgat 245
           ||| |  || || || |  ||||||||||| |||||||||||
Sbjct: 110 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgat 69



to top

>dbj|AK158416.1| Mus musculus adult inner ear cDNA, RIKEN full-length enriched
           library, clone:F930115B13 product:histone 1, H2bh, full
           insert sequence
          Length = 1680

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 410 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 351

                                                     
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgat 245
            || |  ||||| ||||  |||||||||||||||||||||||
Sbjct: 350 cagcagcaggcgcacggccgtctggatctcccgggacgtgat 309



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  ||||||  |||||||||||||| |||| || 
Sbjct: 250 atgtcgttcacgaacgagttcatgatgcccatggctctggaggagatgccggtgtcgggg 191

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 190 tgcacttgcttcagcaccttg 170



to top

>emb|X05094.1|GGH2B1 Chicken histone H2B gene (pKR1a-1.3)
          Length = 1467

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                        
Query: 144  ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
            |||| |||||||||| |||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 1188 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 1129

                                                         
Query: 204  gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
             || |  || || ||||   ||||||||||||| |||||||||||
Sbjct: 1128 cagcagcagccgcacggccntctggatctcccgcgacgtgatggt 1084



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                        
Query: 304  atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
            |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 1028 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 969

                                 
Query: 364  tgcacctgcttgagcaccttg 384
            ||||||||||| |||||||||
Sbjct: 968  tgcacctgcttcagcaccttg 948



to top

>gb|J00865.1|CHKH2B Chicken histone H2B gene and flanks
          Length = 766

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 490 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 431

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  || || ||||   ||||||||||||| |||||||||||
Sbjct: 430 cagcagcagccgcacggccntctggatctcccgcgacgtgatggt 386



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 330 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 271

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 270 tgcacctgcttcagcaccttg 250



to top

>ref|NM_023422.2| Mus musculus histone 1, H2bc (Hist1h2bc), mRNA
          Length = 730

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 404 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 345

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 344 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 300



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 244 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 185

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 184 tgcacttgcttcagcaccttg 164



to top

>ref|NM_175664.1| Mus musculus histone 1, H2bb (Hist1h2bb), mRNA
          Length = 430

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||| |||||||| || |||||||||||||| ||||| |||||
Sbjct: 369 ggtgtacttggtgacggccttagtgccctccgacacggcgtgcttggccagctccccggg 310

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 265



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 297 ctcaaaaatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 356
           |||||| |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |
Sbjct: 216 ctcaaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 157

                                       
Query: 357 gtccggctgcacctgcttgagcaccttg 384
           ||| || ||||| ||||| |||||||||
Sbjct: 156 gtcggggtgcacttgcttcagcaccttg 129



to top

>gb|BC082774.1| Mus musculus histone 1, H2bg, mRNA (cDNA clone IMAGE:6529537)
          Length = 727

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 385 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 326

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 325 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 281



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||||||||||||||||||  |||| || 
Sbjct: 225 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgcccgtgtcgggg 166

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| || || |||||||||
Sbjct: 165 tgcacttgtttcagcaccttg 145



to top

>ref|XM_416197.1| PREDICTED: Gallus gallus similar to H2B histone family, member F
           (LOC417957), mRNA
          Length = 833

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| ||||| ||||||||||| |||||||||||
Sbjct: 576 ggtgtacttggtgaccgccttggtgccctccgagaccgcgtgcttggccagctcgccggg 517

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  || || ||||  |||||||||||||| |||||||||||
Sbjct: 516 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggt 472



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 416 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 357

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 356 tgcacctgcttcagcaccttg 336



to top

>gb|BC060304.1| Mus musculus histone 1, H2bg, mRNA (cDNA clone MGC:70229
           IMAGE:4217587), complete cds
          Length = 661

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||| ||||| |||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 429 ggtgtacttagtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 370

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 369 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 325



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 269 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 210

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 209 tgcacttgcttcagcaccttg 189



to top

>ref|XM_607722.1| PREDICTED: Bos taurus similar to Histone H2B 291B (LOC529278), mRNA
          Length = 381

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 73/81 (90%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||||||| 
Sbjct: 209 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtccggg 150

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || |||||||| |||||||||
Sbjct: 149 tggacctgcttcagcaccttg 129



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 208
           |||||||||| |||||||||||||| || |||||||||||||| || || ||||| || |
Sbjct: 364 acttggtgacggccttggtgccctcagacacggcgtgcttggccagttctccgggaagca 305

                                                   
Query: 209 cgaggcggacggaggtctggatctcccgggacgtgatggt 248
             ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 304 gcaggcgcacggccgtctggatctccctggatgtgatggt 265



to top

>ref|XM_868885.1| PREDICTED: Bos taurus similar to Histone H2B 291B (LOC616776), mRNA
          Length = 399

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 382 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctccccggg 323

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            |  |  ||||| |||| |||||||||||||| ||| ||||||||
Sbjct: 322 caacagcaggcgaacggcggtctggatctccctggatgtgatggt 278



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||||||||||||||||  |||||||||||| ||||||||| ||||||| 
Sbjct: 222 atgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtccggg 163

                                
Query: 364 tgcacctgcttgagcaccttg 384
           || || ||||| |||||||||
Sbjct: 162 tggacttgcttcagcaccttg 142



to top

>ref|XM_988254.1| PREDICTED: Mus musculus similar to Histone H2B F (H2B 291A)
           (LOC671645), mRNA
          Length = 2266

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 450 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 391

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 390 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 346



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||  || 
Sbjct: 290 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtggggg 231

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 230 tgcacttgcttcagcaccttg 210



to top

>ref|XM_978232.1| PREDICTED: Mus musculus similar to Histone H2B F (H2B 291A)
           (LOC665622), mRNA
          Length = 2266

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 450 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 391

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 390 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 346



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 290 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 231

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 230 tgcacttgcttcagcaccttg 210



to top

>ref|XM_978035.1| PREDICTED: Mus musculus similar to Histone H2B F (H2B 291A)
           (LOC665596), mRNA
          Length = 2266

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 450 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 391

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 390 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 346



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 290 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 231

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 230 tgcacttgcttcagcaccttg 210



to top

>gb|BC061044.1| Mus musculus histone 1, H2bp, mRNA (cDNA clone MGC:74154
           IMAGE:6742370), complete cds
          Length = 624

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 396 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 337

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 336 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 292



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 236 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 177

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 176 tgcacttgcttcagcaccttg 156



to top

>gb|BC011440.1| Mus musculus histone 1, H2bc, mRNA (cDNA clone MGC:19269
           IMAGE:3989862), complete cds
          Length = 2236

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 382 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 323

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 322 cagcagcaggcgcacggcagtctggatctcccgggacgtgatggt 278



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 222 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 163

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 162 tgcacttgcttcagcaccttg 142



to top

>ref|XM_787146.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B
           (LOC587419), mRNA
          Length = 372

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 97/113 (85%)
 Strand = Plus / Minus

                                                                       
Query: 151 ttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 210
           |||||||| |||||||||||||| ||||||||||||||||| ||||| |||||||||| |
Sbjct: 353 ttggtgacggccttggtgccctcagagacggcgtgcttggccagctctccggggaggagg 294

                                                                
Query: 211 aggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 263
           || | ||| | |||||||| ||| |||   |||||||| | ||||||||||||
Sbjct: 293 agtctgacagcggtctggacctcacggctggtgatggtagacttcttgttgta 241



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 307 tcgttgatgaaggagttcatgatggacatggc 338
           ||||||| ||||  ||||||||||||||||||
Sbjct: 197 tcgttgacgaagctgttcatgatggacatggc 166



to top

>emb|X90778.1|MMTSHIS2B M.musculus H2B gene
          Length = 651

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 547 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 488

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 487 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 443



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 316 aaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttg 375
           |||||||||||||||  |||||||||||||||||||||| |||| || ||||| || || 
Sbjct: 375 aaggagttcatgatgctcatggccttggaggagatgccggtgtcggggtgcacttgtttc 316

                   
Query: 376 agcacctt 383
           ||||||||
Sbjct: 315 agcacctt 308



to top

>emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143
          Length = 3210

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Plus

                                                                        
Query: 144  ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
            |||| |||||||||| ||||| |||||||| || |||||||||||||| ||||| |||||
Sbjct: 968  ggtgtacttggtgacggccttagtgccctccgacacggcgtgcttggccagctccccggg 1027

                                                         
Query: 204  gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
             || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 1028 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 1072



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 77/88 (87%)
 Strand = Plus / Plus

                                                                        
Query: 297  ctcaaaaatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 356
            |||||| |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |
Sbjct: 1121 ctcaaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 1180

                                        
Query: 357  gtccggctgcacctgcttgagcaccttg 384
            ||| || ||||| ||||| |||||||||
Sbjct: 1181 gtcggggtgcacttgcttcagcaccttg 1208



to top

>ref|NM_001031481.1| Gallus gallus histone H2B (LOC427886), mRNA
          Length = 381

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| ||||| ||||||||||| |||||||||||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcagagaccgcgtgcttggccagctcgccggg 310

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  || || ||||  |||||||||||||| |||||||||||
Sbjct: 309 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggt 265



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 209 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 150

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 149 tgcacctgcttcagcaccttg 129



to top

>emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B)
          Length = 1826

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Plus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 301 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgcttggccagctccccggg 360

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 361 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 405



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Plus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 461 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 520

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 521 tgcacttgctttagcaccttg 541



to top

>emb|AL606464.11| Mouse DNA sequence from clone RP23-462P2 on chromosome 13 Contains the
             3' end of the Slc17a1 gene for solute carrier family 17
             vesicular glutamate transporter) member 1, the gene for a
             novel solute carrier family 17 (Slc17a) member, a U1 small
             nuclear ribonucleoprotein 1C (Snrp1c) pseudogene, a H2B
             histone family (H2b) pseudogene, the gene for a novel H2A
             histone family (H2a) member, a novel gene, the gene for
             the ortholog of human secretagogin, EF-hand calcium
             binding protein SCGN and the 3' end of a novel gene,
             complete sequence
          Length = 183698

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Plus

                                                                         
Query: 144   ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
             |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 52710 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 52769

                                                          
Query: 204   gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
              || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 52770 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 52814



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 60/68 (88%)
 Strand = Plus / Plus

                                                                         
Query: 316   aaggagttcatgatggacatggccttggaggagatgccgatgtccggctgcacctgcttg 375
             |||||||||||||||  |||||||||||||||||||||| |||| || ||||| || || 
Sbjct: 52882 aaggagttcatgatgctcatggccttggaggagatgccggtgtcggggtgcacttgtttc 52941

                     
Query: 376   agcacctt 383
             ||||||||
Sbjct: 52942 agcacctt 52949



to top

>emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chromosome 13 Contains the
             genes for H2b histone family member A, two H2a, two H4 and
             an H2b histone family member, a serine/threonine protein
             kinase pseudogene, a novel pseudogene, a novel gene
             (4930500C15Rik), the gene for a novel KRAB box and C2H2
             Zinc Finger containing protein, a ribosomal protein L21
             (RPL21) pseudogene, a TU mitochondrial translation
             elongation factor (tufa) pseudogene, the 5' end of the
             gene for a novel protein similar to nuclear envelope pore
             membrane protein POM121 and four CpG islands, complete
             sequence
          Length = 182817

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                         
Query: 144   ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
             |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 34306 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 34247

                                                          
Query: 204   gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
              || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 34246 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 34202



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Plus

                                                                         
Query: 144   ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
             |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 9970  ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 10029

                                                          
Query: 204   gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
              || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 10030 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 10074



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                         
Query: 304   atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
             |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 34146 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 34087

                                  
Query: 364   tgcacctgcttgagcaccttg 384
             ||||| ||||| |||||||||
Sbjct: 34086 tgcacttgcttcagcaccttg 34066



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Plus

                                                                         
Query: 304   atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
             |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 10130 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 10189

                                  
Query: 364   tgcacctgcttgagcaccttg 384
             ||||| ||||| |||||||||
Sbjct: 10190 tgcacttgcttcagcaccttg 10210



to top

>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the
              Slc17a1 gene for solute carrier family 17 (vesicular
              glutamate transporter) member 1, two genes for novel solute
              carrier family 17 (Slc17) members, two novel genes, the
              gene for a novel C3HC4 type zinc finger (ring finger)
              protein, the gene for an H2a, an H2b, two genes for H3 and
              two genes for H4 histone family members, a H2a histone
              family pseudogene, the H1f1 and  H1f2 genes for H1 histone
              family members 1 and 2, the H3f2 gene for H3 histone
              family, member 2 (H3.2), a novel pseudogene, the Hfe gene
              for hemochromatosis protein (Mr2) and two CpG islands,
              complete sequence
          Length = 186062

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Plus

                                                                          
Query: 144    ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
              |||| |||||||||| ||||| |||||||| || |||||||||||||| ||||| |||||
Sbjct: 141215 ggtgtacttggtgacggccttagtgccctccgacacggcgtgcttggccagctccccggg 141274

                                                           
Query: 204    gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
               || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 141275 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 141319



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Plus

                                                                          
Query: 304    atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
              |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 141375 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 141434

                                   
Query: 364    tgcacctgcttgagcaccttg 384
              ||||| ||||| |||||||||
Sbjct: 141435 tgcacttgcttcagcaccttg 141455



to top

>emb|V00415.1|GGHI02 Gallus gallus gene coding for histone H2b
          Length = 842

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||| ||||||||||| ||||||||||| |||||||||||
Sbjct: 563 ggtgtacttggtgaccgccttggtaccctcggagaccgcgtgcttggccagctcgccggg 504

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  || || ||||  |||||||||||||| |||||||||||
Sbjct: 503 cagcagcagccgcacggctgtctggatctcccgcgacgtgatggt 459



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 403 atgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgtgtcgggg 344

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||||||||| |||||||||
Sbjct: 343 tgcacctgcttcagcaccttg 323



to top

>gb|BC019673.1| Mus musculus histone 1, H2bc, mRNA (cDNA clone MGC:30336
           IMAGE:3993954), complete cds
          Length = 740

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 385 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgcttggccagctccccggg 326

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 325 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 281



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 225 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 166

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 165 tgcacttgcttcagcaccttg 145



to top

>dbj|AK036389.1| Mus musculus adult male bone cDNA, RIKEN full-length enriched
           library, clone:9830004G03 product:H2B histone family,
           member S, full insert sequence
          Length = 1257

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 398 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 339

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 338 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 294



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 238 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 179

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 178 tgcacttgcttcagcaccttg 158



to top

>dbj|AK005191.1| Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched
           library, clone:1500010J12 product:histone 1, H2bc, full
           insert sequence
          Length = 724

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 398 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 339

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 338 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 294



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 238 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 179

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 178 tgcacttgcttcagcaccttg 158



to top

>dbj|AK005407.1| Mus musculus adult female placenta cDNA, RIKEN full-length enriched
           library, clone:1600009N02 product:H2B histone family,
           member S, full insert sequence
          Length = 723

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 397 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 338

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 337 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 293



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 237 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 178

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 177 tgcacttgcttcagcaccttg 157



to top

>dbj|AK011516.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610022J01 product:H2B histone
           family, member S, full insert sequence
          Length = 730

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 404 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 345

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 344 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 300



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 244 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 185

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 184 tgcacttgcttcagcaccttg 164



to top

>ref|NM_178196.2| Mus musculus histone 1, H2bg (Hist1h2bg), mRNA
          Length = 661

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggtgaacttggtgactgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 203
           |||| |||| ||||| |||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 429 ggtgtacttagtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 370

                                                        
Query: 204 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 248
            || |  ||||| ||||  ||||||||||||||||||||||||||
Sbjct: 369 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 325



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggc 363
           |||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||| || 
Sbjct: 269 atgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcgggg 210

                                
Query: 364 tgcacctgcttgagcaccttg 384
           ||||| ||||| |||||||||
Sbjct: 209 tgcacttgcttcagcaccttg 189


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,833,189
Number of Sequences: 3902068
Number of extensions: 2833189
Number of successful extensions: 64211
Number of sequences better than 10.0: 901
Number of HSP's better than 10.0 without gapping: 910
Number of HSP's successfully gapped in prelim test: 7
Number of HSP's that attempted gapping in prelim test: 61083
Number of HSP's gapped (non-prelim): 2917
length of query: 391
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 369
effective length of database: 17,147,199,772
effective search space: 6327316715868
effective search space used: 6327316715868
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top