ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl28h11
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|L37359.1|BLYLOXB Hordeum vulgare lipoxygenase (LoxB) mRNA, co... 722 0.0
2ref|XM_469412.1| Oryza sativa (japonica cultivar-group), mRNA 159 8e-36
3ref|XM_469411.1| Oryza sativa (japonica cultivar-group), mRNA 159 8e-36
4gb|AC093017.10| Oryza sativa (japonica cultivar-group) chromosom... 159 8e-36
5gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 159 8e-36
6gb|DQ389164.1| Oryza sativa (japonica cultivar-group) dual posit... 159 8e-36
7dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 159 8e-36
8dbj|AK105792.1| Oryza sativa (japonica cultivar-group) cDNA clon... 159 8e-36
9dbj|AK072869.1| Oryza sativa (japonica cultivar-group) cDNA clon... 159 8e-36
10dbj|AK072689.1| Oryza sativa (japonica cultivar-group) cDNA clon... 159 8e-36
11dbj|AK071121.1| Oryza sativa (japonica cultivar-group) cDNA clon... 159 8e-36
12gb|AY111869.1| Zea mays CL452_-8 mRNA sequence 113 4e-22
13gb|AY103567.1| Zea mays PCO116252 mRNA sequence 113 4e-22
14gb|U56406.1|HVU56406 Hordeum vulgare methyljasmonate-inducible l... 60 5e-06
15gb|AY220737.1| Hordeum vulgare lipoxygenase 1 protein (LOXA) mRN... 58 2e-05
16dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 58 2e-05
17gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 58 2e-05
18emb|AL935072.4|CNS08CCO Oryza sativa chromosome 12, . BAC OSJNBa... 58 2e-05
19gb|L35931.1|BLYLOXA Barley lipoxygenase 1 (LoxA) gene, complete cds 58 2e-05
20gb|BT009097.1| Triticum aestivum clone wkm2c.pk005.n2:fis, full ... 56 8e-05
21gb|BT008992.1| Triticum aestivum clone wdk2c.pk011.j13:fis, full... 56 8e-05
22gb|AF465643.1| Zea mays B73 lipoxygenase gene, complete cds 56 8e-05
23gb|AF149803.1|AF149803 Zea mays lipoxygenase mRNA, lipoxygenase-... 56 8e-05
24gb|L37358.1|BLYLOXC Hordeum vulgare lipoxygenase 2 (LoxC) mRNA, ... 54 3e-04
25gb|AF329371.1|AF329371 Zea mays lipoxygenase mRNA, complete cds 52 0.001
26gb|AY098520.1| Ananas comosus lipoxygenase I mRNA, partial cds 52 0.001
27gb|AY098518.1| Ananas comosus lipoxygenase III mRNA, partial cds 52 0.001
28gb|DQ428248.1| Sorghum propinquum locus PRC0271 genomic sequence 48 0.020
29gb|DQ428247.1| Sorghum bicolor voucher PI585454 locus PRC0271 ge... 48 0.020
30gb|DQ428246.1| Sorghum bicolor voucher PI267539 locus PRC0271 ge... 48 0.020
31gb|DQ428245.1| Sorghum bicolor voucher PI267408 locus PRC0271 ge... 48 0.020
32gb|DQ428244.1| Sorghum bicolor voucher PI221607 locus PRC0271 ge... 48 0.020
33gb|DQ428243.1| Sorghum bicolor voucher PI152702 locus PRC0271 ge... 48 0.020
34gb|DQ428242.1| Sorghum bicolor voucher NSL92371 locus PRC0271 ge... 48 0.020
35gb|DQ428241.1| Sorghum bicolor voucher NSL87902 locus PRC0271 ge... 48 0.020
36gb|DQ428240.1| Sorghum bicolor voucher NSL87666 locus PRC0271 ge... 48 0.020
37gb|DQ428239.1| Sorghum bicolor voucher NSL77217 locus PRC0271 ge... 48 0.020
38gb|DQ428238.1| Sorghum bicolor voucher NSL77034 locus PRC0271 ge... 48 0.020
39gb|DQ428237.1| Sorghum bicolor voucher NSL55243 locus PRC0271 ge... 48 0.020
40gb|DQ428236.1| Sorghum bicolor voucher NSL51365 locus PRC0271 ge... 48 0.020
41gb|DQ428235.1| Sorghum bicolor voucher NSL51030 locus PRC0271 ge... 48 0.020
42gb|DQ428234.1| Sorghum bicolor voucher BTx623 locus PRC0271 geno... 48 0.020
43gb|AY720897.2| Triticum aestivum lipoxygenase gene, partial sequ... 46 0.081
44ref|XM_469655.1| Oryza sativa (japonica cultivar-group), mRNA 46 0.081
45ref|XM_469409.1| Oryza sativa (japonica cultivar-group), mRNA 46 0.081
46emb|X64396.1|OSLRNA O.sativa mRNA for lipoxygenase L-2 46 0.081
47gb|AC117988.3| Oryza sativa chromosome 3 BAC OSJNBa0057G07 genom... 46 0.081
48emb|AJ507213.1|HVU507213 Hordeum vulgare mRNA for lipoxygenase 2... 46 0.081
49gb|AC097368.3| Oryza sativa chromosome 3 BAC OSJNBb0017F17 genom... 46 0.081
50gb|AF271894.1|AF271894 Zea mays lipoxygenase (LOX) mRNA, complet... 46 0.081
51dbj|AK073529.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.081
52ref|XM_483279.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.32
53ref|XM_483276.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.32
54dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.32
55dbj|AP005816.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.32
56dbj|AP006049.2| Oryza sativa (japonica cultivar-group) genomic D... 44 0.32
57dbj|AK066825.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.32
58gb|AF095896.1|AF095896 Oryza sativa lipoxygenase (CM-LOX2) mRNA,... 44 0.32
59gb|AF095895.1|AF095895 Oryza sativa lipoxygenase (CM-LOX1) mRNA,... 44 0.32
60dbj|D14000.1|RICL2OP Oryza sativa (japonica cultivar-group) lox2... 44 0.32
61gb|U32428.1|TAU32428 Triticum aestivum lipoxygenase mRNA, partia... 44 0.32
62gb|AC152958.1| Mus musculus 6 BAC RP23-301K21 (Roswell Park Canc... 42 1.3
63gb|AC107868.9| Mus musculus chromosome 17, clone RP23-405A17, co... 42 1.3
64gb|AC124174.4| Mus musculus BAC clone RP23-181O22 from chromosom... 42 1.3
65gb|AF514331.1| Scyllarus arctus 28S ribosomal RNA gene, partial ... 42 1.3
66gb|AC082644.10| Oryza sativa chromosome 3 BAC OSJNBa0013M12 geno... 42 1.3
67gb|AC144427.1| Oryza sativa (japonica cultivar-group) chromosome... 42 1.3
68gb|AC154544.2| Mus musculus BAC clone RP23-228G19 from chromosom... 42 1.3
69emb|AL445074.4|CNS07ECX Human chromosome 14 DNA sequence BAC R-3... 42 1.3
70gb|AC159317.3| Mus musculus BAC clone RP23-76I20 from chromosome... 40 5.0
71gb|CP000144.1| Rhodobacter sphaeroides 2.4.1 chromosome 2, compl... 40 5.0
72ref|XM_657908.1| Aspergillus nidulans FGSC A4 hypothetical prote... 40 5.0
73gb|U00096.2| Escherichia coli K-12 MG1655, complete genome 40 5.0
74emb|AL160154.11| Human DNA sequence from clone RP11-447N10 on ch... 40 5.0
75dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome 40 5.0
76gb|AC154359.2| Mus musculus BAC clone RP23-178L8 from chromosome... 40 5.0
77gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome 40 5.0
78dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome 40 5.0
79dbj|AP004943.1| Lotus japonicus genomic DNA, chromosome 3, clone... 40 5.0
80gb|CP000036.1| Shigella boydii Sb227, complete genome 40 5.0
81gb|CP000038.1| Shigella sonnei Ss046, complete genome 40 5.0 
>gb|L37359.1|BLYLOXB Hordeum vulgare lipoxygenase (LoxB) mRNA, complete cds
          Length = 3003

 Score =  722 bits (364), Expect = 0.0
 Identities = 367/368 (99%)
 Strand = Plus / Minus

                                                                        
Query: 8    tgaaaagaatgcgcacacgagtgcttattcatgcctcattgtcctcaccctatcaacatc 67
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2994 tgaaaagaatgcgcacacgagtgcttattcatgcctcattgtcctcaccctatcaacatc 2935

                                                                        
Query: 68   atctacgacacaatcatcattttccatcatccactaatccctggcaactaattaccgcaa 127
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2934 atctacgacacaatcatcattttccatcatccactaatccctggcaactaattaccgcaa 2875

                                                                        
Query: 128  ccacccagaagccaatgaaaagtaacacaatacaccttgcgagacacgaaccgatccatg 187
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2874 ccacccagaagccaatgaaaagtaacacaatacaccttgcgagacacgaaccgatccatg 2815

                                                                        
Query: 188  accagcggacggacgactaccgaaagaaggaaacaaagaccatgctcagctcaaatggag 247
            ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 2814 accagcggacggacgactaccgaaagaaggaaacaaagaccatgctcagctcagatggag 2755

                                                                        
Query: 248  acgctgttggggatgcccatggcggtgagccccagcgccttctccccgttggcgtccgac 307
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2754 acgctgttggggatgcccatggcggtgagccccagcgccttctccccgttggcgtccgac 2695

                                                                        
Query: 308  gtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggttcttgagcgcc 367
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2694 gtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggttcttgagcgcc 2635

                    
Query: 368  gggtcctt 375
            ||||||||
Sbjct: 2634 gggtcctt 2627
to top
>ref|XM_469412.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2686

 Score =  159 bits (80), Expect = 8e-36
 Identities = 119/132 (90%)
 Strand = Plus / Minus

                                                                        
Query: 237  ctcaaatggagacgctgttggggatgcccatggcggtgagccccagcgccttctccccgt 296
            |||| ||||||| ||||||||||||||||||||||||||||||  |  ||||||||  | 
Sbjct: 2447 ctcagatggagatgctgttggggatgcccatggcggtgagcccttggcccttctccttgg 2388

                                                                        
Query: 297  tggcgtccgacgtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggt 356
            || | ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||
Sbjct: 2387 tgacatccgacgtgttggggtacagcagcatgtacggcatcttcaccggcccgttccggt 2328

                        
Query: 357  tcttgagcgccg 368
            ||||||||||||
Sbjct: 2327 tcttgagcgccg 2316
to top
>ref|XM_469411.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 3165

 Score =  159 bits (80), Expect = 8e-36
 Identities = 119/132 (90%)
 Strand = Plus / Minus

                                                                        
Query: 237  ctcaaatggagacgctgttggggatgcccatggcggtgagccccagcgccttctccccgt 296
            |||| ||||||| ||||||||||||||||||||||||||||||  |  ||||||||  | 
Sbjct: 2926 ctcagatggagatgctgttggggatgcccatggcggtgagcccttggcccttctccttgg 2867

                                                                        
Query: 297  tggcgtccgacgtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggt 356
            || | ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||
Sbjct: 2866 tgacatccgacgtgttggggtacagcagcatgtacggcatcttcaccggcccgttccggt 2807

                        
Query: 357  tcttgagcgccg 368
            ||||||||||||
Sbjct: 2806 tcttgagcgccg 2795
to top
>gb|AC093017.10| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0024B16
             map S2606, complete sequence
          Length = 124140

 Score =  159 bits (80), Expect = 8e-36
 Identities = 119/132 (90%)
 Strand = Plus / Minus

                                                                         
Query: 237   ctcaaatggagacgctgttggggatgcccatggcggtgagccccagcgccttctccccgt 296
             |||| ||||||| ||||||||||||||||||||||||||||||  |  ||||||||  | 
Sbjct: 65817 ctcagatggagatgctgttggggatgcccatggcggtgagcccttggcccttctccttgg 65758

                                                                         
Query: 297   tggcgtccgacgtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggt 356
             || | ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||
Sbjct: 65757 tgacatccgacgtgttggggtacagcagcatgtacggcatcttcaccggcccgttccggt 65698

                         
Query: 357   tcttgagcgccg 368
             ||||||||||||
Sbjct: 65697 tcttgagcgccg 65686



 Score = 46.1 bits (23), Expect = 0.081
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 245   gagacgctgttggggatgcccatggcggtga 275
             |||| |||||||||||||||| |||||||||
Sbjct: 47230 gagatgctgttggggatgcccttggcggtga 47200
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  159 bits (80), Expect = 8e-36
 Identities = 119/132 (90%)
 Strand = Plus / Minus

                                                                            
Query: 237      ctcaaatggagacgctgttggggatgcccatggcggtgagccccagcgccttctccccgt 296
                |||| ||||||| ||||||||||||||||||||||||||||||  |  ||||||||  | 
Sbjct: 27821687 ctcagatggagatgctgttggggatgcccatggcggtgagcccttggcccttctccttgg 27821628

                                                                            
Query: 297      tggcgtccgacgtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggt 356
                || | ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||
Sbjct: 27821627 tgacatccgacgtgttggggtacagcagcatgtacggcatcttcaccggcccgttccggt 27821568

                            
Query: 357      tcttgagcgccg 368
                ||||||||||||
Sbjct: 27821567 tcttgagcgccg 27821556



 Score = 46.1 bits (23), Expect = 0.081
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                               
Query: 242      atggagacgctgttggggatgcccatggcgg 272
                ||||||| |||||||||||||||| ||||||
Sbjct: 30026445 atggagatgctgttggggatgcccctggcgg 30026415



 Score = 46.1 bits (23), Expect = 0.081
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                               
Query: 245      gagacgctgttggggatgcccatggcggtga 275
                |||| |||||||||||||||| |||||||||
Sbjct: 27803100 gagatgctgttggggatgcccttggcggtga 27803070



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                             
Query: 237      ctcaaatggagacgctgttggggatgccc 265
                ||||||||| || ||||||||||||||||
Sbjct: 14300017 ctcaaatggtgatgctgttggggatgccc 14300045
to top
>gb|DQ389164.1| Oryza sativa (japonica cultivar-group) dual positional specificity
            lipoxygenase mRNA, complete cds
          Length = 3154

 Score =  159 bits (80), Expect = 8e-36
 Identities = 119/132 (90%)
 Strand = Plus / Minus

                                                                        
Query: 237  ctcaaatggagacgctgttggggatgcccatggcggtgagccccagcgccttctccccgt 296
            |||| ||||||| ||||||||||||||||||||||||||||||  |  ||||||||  | 
Sbjct: 2920 ctcagatggagatgctgttggggatgcccatggcggtgagcccttggcccttctccttgg 2861

                                                                        
Query: 297  tggcgtccgacgtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggt 356
            || | ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||
Sbjct: 2860 tgacatccgacgtgttggggtacagcagcatgtacggcatcttcaccggcccgttccggt 2801

                        
Query: 357  tcttgagcgccg 368
            ||||||||||||
Sbjct: 2800 tcttgagcgccg 2789
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  159 bits (80), Expect = 8e-36
 Identities = 119/132 (90%)
 Strand = Plus / Minus

                                                                            
Query: 237      ctcaaatggagacgctgttggggatgcccatggcggtgagccccagcgccttctccccgt 296
                |||| ||||||| ||||||||||||||||||||||||||||||  |  ||||||||  | 
Sbjct: 27913011 ctcagatggagatgctgttggggatgcccatggcggtgagcccttggcccttctccttgg 27912952

                                                                            
Query: 297      tggcgtccgacgtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggt 356
                || | ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||
Sbjct: 27912951 tgacatccgacgtgttggggtacagcagcatgtacggcatcttcaccggcccgttccggt 27912892

                            
Query: 357      tcttgagcgccg 368
                ||||||||||||
Sbjct: 27912891 tcttgagcgccg 27912880



 Score = 46.1 bits (23), Expect = 0.081
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                               
Query: 242      atggagacgctgttggggatgcccatggcgg 272
                ||||||| |||||||||||||||| ||||||
Sbjct: 30117867 atggagatgctgttggggatgcccctggcgg 30117837



 Score = 46.1 bits (23), Expect = 0.081
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                               
Query: 245      gagacgctgttggggatgcccatggcggtga 275
                |||| |||||||||||||||| |||||||||
Sbjct: 27894424 gagatgctgttggggatgcccttggcggtga 27894394



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                             
Query: 237      ctcaaatggagacgctgttggggatgccc 265
                ||||||||| || ||||||||||||||||
Sbjct: 14294992 ctcaaatggtgatgctgttggggatgccc 14295020
to top
>dbj|AK105792.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-202-H08, full
            insert sequence
          Length = 1560

 Score =  159 bits (80), Expect = 8e-36
 Identities = 119/132 (90%)
 Strand = Plus / Minus

                                                                        
Query: 237  ctcaaatggagacgctgttggggatgcccatggcggtgagccccagcgccttctccccgt 296
            |||| ||||||| ||||||||||||||||||||||||||||||  |  ||||||||  | 
Sbjct: 1333 ctcagatggagatgctgttggggatgcccatggcggtgagcccttggcccttctccttgg 1274

                                                                        
Query: 297  tggcgtccgacgtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggt 356
            || | ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||
Sbjct: 1273 tgacatccgacgtgttggggtacagcagcatgtacggcatcttcaccggcccgttccggt 1214

                        
Query: 357  tcttgagcgccg 368
            ||||||||||||
Sbjct: 1213 tcttgagcgccg 1202
to top
>dbj|AK072869.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023143O17, full
            insert sequence
          Length = 2851

 Score =  159 bits (80), Expect = 8e-36
 Identities = 119/132 (90%)
 Strand = Plus / Minus

                                                                        
Query: 237  ctcaaatggagacgctgttggggatgcccatggcggtgagccccagcgccttctccccgt 296
            |||| ||||||| ||||||||||||||||||||||||||||||  |  ||||||||  | 
Sbjct: 2598 ctcagatggagatgctgttggggatgcccatggcggtgagcccttggcccttctccttgg 2539

                                                                        
Query: 297  tggcgtccgacgtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggt 356
            || | ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||
Sbjct: 2538 tgacatccgacgtgttggggtacagcagcatgtacggcatcttcaccggcccgttccggt 2479

                        
Query: 357  tcttgagcgccg 368
            ||||||||||||
Sbjct: 2478 tcttgagcgccg 2467
to top
>dbj|AK072689.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023143H13, full
            insert sequence
          Length = 3167

 Score =  159 bits (80), Expect = 8e-36
 Identities = 119/132 (90%)
 Strand = Plus / Minus

                                                                        
Query: 237  ctcaaatggagacgctgttggggatgcccatggcggtgagccccagcgccttctccccgt 296
            |||| ||||||| ||||||||||||||||||||||||||||||  |  ||||||||  | 
Sbjct: 2928 ctcagatggagatgctgttggggatgcccatggcggtgagcccttggcccttctccttgg 2869

                                                                        
Query: 297  tggcgtccgacgtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggt 356
            || | ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||
Sbjct: 2868 tgacatccgacgtgttggggtacagcagcatgtacggcatcttcaccggcccgttccggt 2809

                        
Query: 357  tcttgagcgccg 368
            ||||||||||||
Sbjct: 2808 tcttgagcgccg 2797
to top
>dbj|AK071121.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023079P11, full
            insert sequence
          Length = 1726

 Score =  159 bits (80), Expect = 8e-36
 Identities = 119/132 (90%)
 Strand = Plus / Minus

                                                                        
Query: 237  ctcaaatggagacgctgttggggatgcccatggcggtgagccccagcgccttctccccgt 296
            |||| ||||||| ||||||||||||||||||||||||||||||  |  ||||||||  | 
Sbjct: 1498 ctcagatggagatgctgttggggatgcccatggcggtgagcccttggcccttctccttgg 1439

                                                                        
Query: 297  tggcgtccgacgtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggt 356
            || | ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||
Sbjct: 1438 tgacatccgacgtgttggggtacagcagcatgtacggcatcttcaccggcccgttccggt 1379

                        
Query: 357  tcttgagcgccg 368
            ||||||||||||
Sbjct: 1378 tcttgagcgccg 1367
to top
>gb|AY111869.1| Zea mays CL452_-8 mRNA sequence
          Length = 568

 Score =  113 bits (57), Expect = 4e-22
 Identities = 108/125 (86%)
 Strand = Plus / Minus

                                                                       
Query: 236 gctcaaatggagacgctgttggggatgcccatggcggtgagccccagcgccttctccccg 295
           ||||| ||||||| ||||||||| ||||||||||| |||||||||    ||||||| |||
Sbjct: 369 gctcatatggagatgctgttgggaatgcccatggcagtgagcccctcgcccttctcgccg 310

                                                                       
Query: 296 ttggcgtccgacgtgttggggtacagcagcatgtagggcatcttcacgggcccgttccgg 355
            || | |||||||||||||| |||||||||||||| ||||||| ||| ||||| ||||||
Sbjct: 309 gtgacatccgacgtgttgggatacagcagcatgtacggcatctccaccggccccttccgg 250

                
Query: 356 ttctt 360
           |||||
Sbjct: 249 ttctt 245
to top
>gb|AY103567.1| Zea mays PCO116252 mRNA sequence
          Length = 3135

 Score =  113 bits (57), Expect = 4e-22
 Identities = 108/125 (86%)
 Strand = Plus / Minus

                                                                        
Query: 236  gctcaaatggagacgctgttggggatgcccatggcggtgagccccagcgccttctccccg 295
            ||||| ||||||| ||||||||| ||||||||||| || ||||||   |||||||| |||
Sbjct: 2902 gctcatatggagatgctgttgggaatgcccatggcagtaagcccctcggccttctcgccg 2843

                                                                        
Query: 296  ttggcgtccgacgtgttggggtacagcagcatgtagggcatcttcacgggcccgttccgg 355
             |  ||||||||||||||||||||||||||||||| ||||| | ||| ||||| ||||||
Sbjct: 2842 gtaacgtccgacgtgttggggtacagcagcatgtacggcatttccacaggccccttccgg 2783

                 
Query: 356  ttctt 360
            |||||
Sbjct: 2782 ttctt 2778
to top
>gb|U56406.1|HVU56406 Hordeum vulgare methyljasmonate-inducible lipoxygenase 2 mRNA,
            complete cds
          Length = 3054

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                              
Query: 234  cagctcaaatggagacgctgttggggatgcccat 267
            ||||||||||||||| ||||||||||||||||||
Sbjct: 2920 cagctcaaatggagatgctgttggggatgcccat 2887
to top
>gb|AY220737.1| Hordeum vulgare lipoxygenase 1 protein (LOXA) mRNA, partial cds
          Length = 1331

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 308  gtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggttcttgagcgcc 367
            ||||||||||| |||||||||||||| | |||  | || ||||| |||||||||||| ||
Sbjct: 1019 gtgttggggtagagcagcatgtagggaaacttagccgggccgttgcggttcttgagctcc 960

                 
Query: 368  gggtc 372
            |||||
Sbjct: 959  gggtc 955



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 242  atggagacgctgttggggatgcccatggcggtgagccc 279
            ||||||| |||||||||||||||| ||||||| |||||
Sbjct: 1082 atggagatgctgttggggatgcccttggcggtaagccc 1045
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                                 
Query: 235      agctcaaatggagacgctgttggggatgcccat 267
                |||||||||||||| ||||||||||||||||||
Sbjct: 22970463 agctcaaatggagatgctgttggggatgcccat 22970431
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                                 
Query: 235      agctcaaatggagacgctgttggggatgcccat 267
                |||||||||||||| ||||||||||||||||||
Sbjct: 22898654 agctcaaatggagatgctgttggggatgcccat 22898622
to top
>emb|AL935072.4|CNS08CCO Oryza sativa chromosome 12, . BAC OSJNBa0028L05 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 155568

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                              
Query: 235   agctcaaatggagacgctgttggggatgcccat 267
             |||||||||||||| ||||||||||||||||||
Sbjct: 79740 agctcaaatggagatgctgttggggatgcccat 79708
to top
>gb|L35931.1|BLYLOXA Barley lipoxygenase 1 (LoxA) gene, complete cds
          Length = 2818

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 308  gtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggttcttgagcgcc 367
            ||||||||||| |||||||||||||| | |||  | || ||||| |||||||||||| ||
Sbjct: 2590 gtgttggggtagagcagcatgtagggaaacttagccgggccgttgcggttcttgagctcc 2531

                 
Query: 368  gggtc 372
            |||||
Sbjct: 2530 gggtc 2526



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 242  atggagacgctgttggggatgcccatggcggtgagccc 279
            ||||||| |||||||||||||||| ||||||| |||||
Sbjct: 2653 atggagatgctgttggggatgcccttggcggtaagccc 2616
to top
>gb|BT009097.1| Triticum aestivum clone wkm2c.pk005.n2:fis, full insert mRNA
           sequence
          Length = 1129

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 237 ctcaaatggagacgctgttggggatgcccatggcggtgagcccc 280
           |||| ||||||| |||||||||||||||| |||| |||||||||
Sbjct: 907 ctcagatggagatgctgttggggatgcccctggccgtgagcccc 864



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 308 gtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggttcttgagcgcc 367
           ||||||||||| |||||||||||||| | |||  | |||||| | ||||||||||||  |
Sbjct: 839 gtgttggggtagagcagcatgtaggggaacttggccggcccggtgcggttcttgagccgc 780

                 
Query: 368 gggtcc 373
           ||||||
Sbjct: 779 gggtcc 774
to top
>gb|BT008992.1| Triticum aestivum clone wdk2c.pk011.j13:fis, full insert mRNA
           sequence
          Length = 1020

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 236 gctcaaatggagacgctgttggggatgcccatggcggtgagccc 279
           ||||| ||||||| |||||||||||||||| | |||||||||||
Sbjct: 755 gctcagatggagatgctgttggggatgcccttagcggtgagccc 712
to top
>gb|AF465643.1| Zea mays B73 lipoxygenase gene, complete cds
          Length = 5013

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 236  gctcaaatggagacgctgttggggatgcccatggcggtgagccc 279
            ||||| ||||||| |||||||||||||||| |||| ||||||||
Sbjct: 4664 gctcagatggagatgctgttggggatgcccttggcagtgagccc 4621
to top
>gb|AF149803.1|AF149803 Zea mays lipoxygenase mRNA, lipoxygenase-L2 allele, partial cds
          Length = 2267

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 236  gctcaaatggagacgctgttggggatgcccatggcggtgagccc 279
            ||||| ||||||| |||||||||||||||| |||| ||||||||
Sbjct: 2066 gctcagatggagatgctgttggggatgcccttggcagtgagccc 2023



 Score = 44.1 bits (22), Expect = 0.32
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 308  gtgttggggtacagcagcatgtaggg 333
            ||||||||||| ||||||||||||||
Sbjct: 1997 gtgttggggtagagcagcatgtaggg 1972
to top
>gb|L37358.1|BLYLOXC Hordeum vulgare lipoxygenase 2 (LoxC) mRNA, complete cds
          Length = 2910

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 230  tgctcagctcaaatggagacgctgttggggatgcccatggcggtgagcccc 280
            ||||||| ||| ||||| | |||||| ||||||||| ||||||||||||||
Sbjct: 2666 tgctcagatcagatggatatgctgttcgggatgcccctggcggtgagcccc 2616
to top
>gb|AF329371.1|AF329371 Zea mays lipoxygenase mRNA, complete cds
          Length = 2595

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 242  atggagacgctgttggggatgcccatggcggtgagccc 279
            ||||||| |||||||||||||||| |||| ||||||||
Sbjct: 2591 atggagatgctgttggggatgcccttggcagtgagccc 2554
to top
>gb|AY098520.1| Ananas comosus lipoxygenase I mRNA, partial cds
          Length = 1143

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 327 tgtagggcatcttcacgggcccgttccggttctt 360
           |||||||||||||||| || ||||||||||||||
Sbjct: 930 tgtagggcatcttcaccgggccgttccggttctt 897
to top
>gb|AY098518.1| Ananas comosus lipoxygenase III mRNA, partial cds
          Length = 524

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 314 gggtacagcagcatgtagggcatcttcacgggcccgttccggttcttgag 363
           ||||| |||||  |||| ||||||||||| |||||||||| |||||||||
Sbjct: 451 gggtaaagcagtgtgtacggcatcttcaccggcccgttcctgttcttgag 402
to top
>gb|DQ428248.1| Sorghum propinquum locus PRC0271 genomic sequence
          Length = 810

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 308 gtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggttcttgag 363
           ||||||||||| |||||| ||||||| | |||  | |||||||| |||||||||||
Sbjct: 729 gtgttggggtagagcagcgtgtaggggaacttggccggcccgttgcggttcttgag 674
to top
>gb|DQ428247.1| Sorghum bicolor voucher PI585454 locus PRC0271 genomic sequence
          Length = 805

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 308 gtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggttcttgag 363
           ||||||||||| |||||| ||||||| | |||  | |||||||| |||||||||||
Sbjct: 724 gtgttggggtagagcagcgtgtaggggaacttggccggcccgttgcggttcttgag 669
to top
>gb|DQ428246.1| Sorghum bicolor voucher PI267539 locus PRC0271 genomic sequence
          Length = 805

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 308 gtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggttcttgag 363
           ||||||||||| |||||| ||||||| | |||  | |||||||| |||||||||||
Sbjct: 724 gtgttggggtagagcagcgtgtaggggaacttggccggcccgttgcggttcttgag 669
to top
>gb|DQ428245.1| Sorghum bicolor voucher PI267408 locus PRC0271 genomic sequence
          Length = 805

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 308 gtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggttcttgag 363
           ||||||||||| |||||| ||||||| | |||  | |||||||| |||||||||||
Sbjct: 724 gtgttggggtagagcagcgtgtaggggaacttggccggcccgttgcggttcttgag 669
to top
>gb|DQ428244.1| Sorghum bicolor voucher PI221607 locus PRC0271 genomic sequence
          Length = 805

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 308 gtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggttcttgag 363
           ||||||||||| |||||| ||||||| | |||  | |||||||| |||||||||||
Sbjct: 724 gtgttggggtagagcagcgtgtaggggaacttggccggcccgttgcggttcttgag 669
to top
>gb|DQ428243.1| Sorghum bicolor voucher PI152702 locus PRC0271 genomic sequence
          Length = 805

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 308 gtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggttcttgag 363
           ||||||||||| |||||| ||||||| | |||  | |||||||| |||||||||||
Sbjct: 724 gtgttggggtagagcagcgtgtaggggaacttggccggcccgttgcggttcttgag 669
to top
>gb|DQ428242.1| Sorghum bicolor voucher NSL92371 locus PRC0271 genomic sequence
          Length = 805

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 308 gtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggttcttgag 363
           ||||||||||| |||||| ||||||| | |||  | |||||||| |||||||||||
Sbjct: 724 gtgttggggtagagcagcgtgtaggggaacttggccggcccgttgcggttcttgag 669
to top
>gb|DQ428241.1| Sorghum bicolor voucher NSL87902 locus PRC0271 genomic sequence
          Length = 805

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 308 gtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggttcttgag 363
           ||||||||||| |||||| ||||||| | |||  | |||||||| |||||||||||
Sbjct: 724 gtgttggggtagagcagcgtgtaggggaacttggccggcccgttgcggttcttgag 669
to top
>gb|DQ428240.1| Sorghum bicolor voucher NSL87666 locus PRC0271 genomic sequence
          Length = 805

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 308 gtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggttcttgag 363
           ||||||||||| |||||| ||||||| | |||  | |||||||| |||||||||||
Sbjct: 724 gtgttggggtagagcagcgtgtaggggaacttggccggcccgttgcggttcttgag 669
to top
>gb|DQ428239.1| Sorghum bicolor voucher NSL77217 locus PRC0271 genomic sequence
          Length = 805

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 308 gtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggttcttgag 363
           ||||||||||| |||||| ||||||| | |||  | |||||||| |||||||||||
Sbjct: 724 gtgttggggtagagcagcgtgtaggggaacttggccggcccgttgcggttcttgag 669
to top
>gb|DQ428238.1| Sorghum bicolor voucher NSL77034 locus PRC0271 genomic sequence
          Length = 805

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 308 gtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggttcttgag 363
           ||||||||||| |||||| ||||||| | |||  | |||||||| |||||||||||
Sbjct: 724 gtgttggggtagagcagcgtgtaggggaacttggccggcccgttgcggttcttgag 669
to top
>gb|DQ428237.1| Sorghum bicolor voucher NSL55243 locus PRC0271 genomic sequence
          Length = 805

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 308 gtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggttcttgag 363
           ||||||||||| |||||| ||||||| | |||  | |||||||| |||||||||||
Sbjct: 724 gtgttggggtagagcagcgtgtaggggaacttggccggcccgttgcggttcttgag 669
to top
>gb|DQ428236.1| Sorghum bicolor voucher NSL51365 locus PRC0271 genomic sequence
          Length = 805

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 308 gtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggttcttgag 363
           ||||||||||| |||||| ||||||| | |||  | |||||||| |||||||||||
Sbjct: 724 gtgttggggtagagcagcgtgtaggggaacttggccggcccgttgcggttcttgag 669
to top
>gb|DQ428235.1| Sorghum bicolor voucher NSL51030 locus PRC0271 genomic sequence
          Length = 805

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 308 gtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggttcttgag 363
           ||||||||||| |||||| ||||||| | |||  | |||||||| |||||||||||
Sbjct: 724 gtgttggggtagagcagcgtgtaggggaacttggccggcccgttgcggttcttgag 669
to top
>gb|DQ428234.1| Sorghum bicolor voucher BTx623 locus PRC0271 genomic sequence
          Length = 805

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 308 gtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggttcttgag 363
           ||||||||||| |||||| ||||||| | |||  | |||||||| |||||||||||
Sbjct: 724 gtgttggggtagagcagcgtgtaggggaacttggccggcccgttgcggttcttgag 669
to top
>gb|AY720897.2| Triticum aestivum lipoxygenase gene, partial sequence
          Length = 934

 Score = 46.1 bits (23), Expect = 0.081
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 250 gctgttggggatgcccatggcggtgag 276
           |||||||||||||||| ||||||||||
Sbjct: 3   gctgttggggatgcccttggcggtgag 29
to top
>ref|XM_469655.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2613

 Score = 46.1 bits (23), Expect = 0.081
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 242  atggagacgctgttggggatgcccatggcgg 272
            ||||||| |||||||||||||||| ||||||
Sbjct: 2609 atggagatgctgttggggatgcccctggcgg 2579
to top
>ref|XM_469409.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2601

 Score = 46.1 bits (23), Expect = 0.081
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 245  gagacgctgttggggatgcccatggcggtga 275
            |||| |||||||||||||||| |||||||||
Sbjct: 2594 gagatgctgttggggatgcccttggcggtga 2564
to top
>emb|X64396.1|OSLRNA O.sativa mRNA for lipoxygenase L-2
          Length = 2830

 Score = 46.1 bits (23), Expect = 0.081
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 242  atggagacgctgttggggatgcccatggcgg 272
            ||||||| |||||||||||||||| ||||||
Sbjct: 2691 atggagatgctgttggggatgcccctggcgg 2661
to top
>gb|AC117988.3| Oryza sativa chromosome 3 BAC OSJNBa0057G07 genomic sequence, complete
             sequence
          Length = 155106

 Score = 46.1 bits (23), Expect = 0.081
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 242   atggagacgctgttggggatgcccatggcgg 272
             ||||||| |||||||||||||||| ||||||
Sbjct: 81306 atggagatgctgttggggatgcccctggcgg 81336
to top
>emb|AJ507213.1|HVU507213 Hordeum vulgare mRNA for lipoxygenase 2 (lox2:Hv:3 gene)
          Length = 2967

 Score = 46.1 bits (23), Expect = 0.081
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 238  tcaaatggagacgctgttggggatgcc 264
            ||||||||||| |||||||||||||||
Sbjct: 2774 tcaaatggagatgctgttggggatgcc 2748
to top
>gb|AC097368.3| Oryza sativa chromosome 3 BAC OSJNBb0017F17 genomic sequence, complete
             sequence
          Length = 119329

 Score = 46.1 bits (23), Expect = 0.081
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 245   gagacgctgttggggatgcccatggcggtga 275
             |||| |||||||||||||||| |||||||||
Sbjct: 10793 gagatgctgttggggatgcccttggcggtga 10823
to top
>gb|AF271894.1|AF271894 Zea mays lipoxygenase (LOX) mRNA, complete cds
          Length = 2845

 Score = 46.1 bits (23), Expect = 0.081
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 237  ctcaaatggagacgctgttggggatgcccatggcggtga 275
            |||||||||||| |||||| || |||||| |||||||||
Sbjct: 2623 ctcaaatggagatgctgtttggaatgcccttggcggtga 2585
to top
>dbj|AK073529.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033046E17, full
            insert sequence
          Length = 2928

 Score = 46.1 bits (23), Expect = 0.081
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 242  atggagacgctgttggggatgcccatggcgg 272
            ||||||| |||||||||||||||| ||||||
Sbjct: 2724 atggagatgctgttggggatgcccctggcgg 2694
to top
>ref|XM_483279.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 3198

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 250  gctgttggggatgcccatggcggtga 275
            ||||||||||||||||||| ||||||
Sbjct: 2965 gctgttggggatgcccatgccggtga 2940
to top
>ref|XM_483276.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2775

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 250  gctgttggggatgcccatggcggtga 275
            ||||||||||||||||||| ||||||
Sbjct: 2763 gctgttggggatgcccatgccggtga 2738
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 250      gctgttggggatgcccatggcggtga 275
                ||||||||||||||||||| ||||||
Sbjct: 25242563 gctgttggggatgcccatgccggtga 25242538



 Score = 44.1 bits (22), Expect = 0.32
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 250      gctgttggggatgcccatggcggtga 275
                ||||||||||||||||||| ||||||
Sbjct: 25209466 gctgttggggatgcccatgccggtga 25209491
to top
>dbj|AP005816.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:B1168A08
          Length = 138135

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 250    gctgttggggatgcccatggcggtga 275
              ||||||||||||||||||| ||||||
Sbjct: 107686 gctgttggggatgcccatgccggtga 107661



 Score = 44.1 bits (22), Expect = 0.32
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 250   gctgttggggatgcccatggcggtga 275
             ||||||||||||||||||| ||||||
Sbjct: 74589 gctgttggggatgcccatgccggtga 74614
to top
>dbj|AP006049.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OSJNBa0016N23
          Length = 147336

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 250   gctgttggggatgcccatggcggtga 275
             ||||||||||||||||||| ||||||
Sbjct: 17748 gctgttggggatgcccatgccggtga 17723
to top
>dbj|AK066825.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075A10, full
            insert sequence
          Length = 3196

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 250  gctgttggggatgcccatggcggtga 275
            ||||||||||||||||||| ||||||
Sbjct: 2963 gctgttggggatgcccatgccggtga 2938
to top
>gb|AF095896.1|AF095896 Oryza sativa lipoxygenase (CM-LOX2) mRNA, partial cds
          Length = 2232

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 250  gctgttggggatgcccatggcggtga 275
            ||||||||||||||||||| ||||||
Sbjct: 2040 gctgttggggatgcccatgccggtga 2015
to top
>gb|AF095895.1|AF095895 Oryza sativa lipoxygenase (CM-LOX1) mRNA, partial cds
          Length = 2664

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 250  gctgttggggatgcccatggcggtga 275
            ||||||||||||||||||| ||||||
Sbjct: 2448 gctgttggggatgcccatgccggtga 2423
to top
>dbj|D14000.1|RICL2OP Oryza sativa (japonica cultivar-group) lox2osPil mRNA for
            lipoxygenase, complete cds
          Length = 3007

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 250  gctgttggggatgcccatggcggtga 275
            ||||||||||||||||||| ||||||
Sbjct: 2878 gctgttggggatgcccatgccggtga 2853
to top
>gb|U32428.1|TAU32428 Triticum aestivum lipoxygenase mRNA, partial cds
          Length = 1814

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 242  atggagacgctgttggggatgcccatggcggtga 275
            ||||||| |||||||||||||||| |||| ||||
Sbjct: 1552 atggagatgctgttggggatgcccttggctgtga 1519



 Score = 40.1 bits (20), Expect = 5.0
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 308  gtgttggggtacagcagcatgtagggcatcttcacgggcccgttccggttcttgag 363
            ||||||||||| || ||||||||||| |  ||  | ||||| ||||||||||||||
Sbjct: 1486 gtgttggggtagagtagcatgtaggggaattttgctggcccattccggttcttgag 1431
to top
>gb|AC152958.1| Mus musculus 6 BAC RP23-301K21 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 182995

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 128    ccacccagaagccaatgaaaa 148
              |||||||||||||||||||||
Sbjct: 111481 ccacccagaagccaatgaaaa 111461
to top
>gb|AC107868.9| Mus musculus chromosome 17, clone RP23-405A17, complete sequence
          Length = 193624

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 126  aaccacccagaagccaatgaaaagt 150
            |||||||||| ||||||||||||||
Sbjct: 6038 aaccacccagcagccaatgaaaagt 6014
to top
>gb|AC124174.4| Mus musculus BAC clone RP23-181O22 from chromosome 3, complete sequence
          Length = 197553

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 128    ccacccagaagccaatgaaaa 148
              |||||||||||||||||||||
Sbjct: 163213 ccacccagaagccaatgaaaa 163193
to top
>gb|AF514331.1| Scyllarus arctus 28S ribosomal RNA gene, partial sequence
          Length = 475

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 98  ccactaatccctggcaactaattac 122
           ||||||||||||||||||| |||||
Sbjct: 431 ccactaatccctggcaactgattac 455
to top
>gb|AC082644.10| Oryza sativa chromosome 3 BAC OSJNBa0013M12 genomic sequence, complete
             sequence
          Length = 158714

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 237   ctcaaatggagacgctgttggggatgccc 265
             ||||||||| || ||||||||||||||||
Sbjct: 49246 ctcaaatggtgatgctgttggggatgccc 49274
to top
>gb|AC144427.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNAb0012F18,
              complete sequence
          Length = 122159

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 237    ctcaaatggagacgctgttggggatgccc 265
              ||||||||| || ||||||||||||||||
Sbjct: 111405 ctcaaatggtgatgctgttggggatgccc 111433
to top
>gb|AC154544.2| Mus musculus BAC clone RP23-228G19 from chromosome 17, complete sequence
          Length = 183626

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 126    aaccacccagaagccaatgaaaagt 150
              |||||||||| ||||||||||||||
Sbjct: 147032 aaccacccagcagccaatgaaaagt 147008
to top
>emb|AL445074.4|CNS07ECX Human chromosome 14 DNA sequence BAC R-313C4 of library RPCI-11 from
            chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 144538

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 89   ttccatcatccactaatccctggcaacta 117
            |||||||  ||||||||||||||||||||
Sbjct: 2646 ttccatctcccactaatccctggcaacta 2674
to top
>gb|AC159317.3| Mus musculus BAC clone RP23-76I20 from chromosome 16, complete sequence
          Length = 224160

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 230    tgctcagctcaaatggagac 249
              ||||||||||||||||||||
Sbjct: 181210 tgctcagctcaaatggagac 181229
to top
>gb|CP000144.1| Rhodobacter sphaeroides 2.4.1 chromosome 2, complete genome
          Length = 943016

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 182    tccatgaccagcggacggac 201
              ||||||||||||||||||||
Sbjct: 181139 tccatgaccagcggacggac 181120
to top
>ref|XM_657908.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN5396.2), mRNA
          Length = 555

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 298 ggcgtccgacgtgttggggt 317
           ||||||||||||||||||||
Sbjct: 102 ggcgtccgacgtgttggggt 83
to top
>gb|U00096.2| Escherichia coli K-12 MG1655, complete genome
          Length = 4639675

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 59      atcaacatcatctacgacac 78
               ||||||||||||||||||||
Sbjct: 1401984 atcaacatcatctacgacac 1402003
to top
>emb|AL160154.11| Human DNA sequence from clone RP11-447N10 on chromosome 13 Contains a
             CpG island, complete sequence
          Length = 157379

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 104   atccctggcaactaattacc 123
             ||||||||||||||||||||
Sbjct: 53547 atccctggcaactaattacc 53528
to top
>dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome
          Length = 4646332

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 59      atcaacatcatctacgacac 78
               ||||||||||||||||||||
Sbjct: 1405674 atcaacatcatctacgacac 1405693
to top
>gb|AC154359.2| Mus musculus BAC clone RP23-178L8 from chromosome 16, complete sequence
          Length = 212696

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 230   tgctcagctcaaatggagac 249
             ||||||||||||||||||||
Sbjct: 11944 tgctcagctcaaatggagac 11963
to top
>gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome
          Length = 5528445

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 59      atcaacatcatctacgacac 78
               ||||||||||||||||||||
Sbjct: 2173734 atcaacatcatctacgacac 2173715
to top
>dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome
          Length = 5498450

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 59      atcaacatcatctacgacac 78
               ||||||||||||||||||||
Sbjct: 1913432 atcaacatcatctacgacac 1913451
to top
>dbj|AP004943.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT38E13, TM0115,
             complete sequence
          Length = 95582

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 327   tgtagggcatcttcacgggcccgttccggttc 358
             |||||||||||||||| ||||| | |||||||
Sbjct: 73247 tgtagggcatcttcaccggcccataccggttc 73216
to top
>gb|CP000036.1| Shigella boydii Sb227, complete genome
          Length = 4519823

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 59      atcaacatcatctacgacac 78
               ||||||||||||||||||||
Sbjct: 1705633 atcaacatcatctacgacac 1705614
to top
>gb|CP000038.1| Shigella sonnei Ss046, complete genome
          Length = 4825265

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 59      atcaacatcatctacgacac 78
               ||||||||||||||||||||
Sbjct: 1891170 atcaacatcatctacgacac 1891151


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,877,090
Number of Sequences: 3902068
Number of extensions: 2877090
Number of successful extensions: 63343
Number of sequences better than 10.0: 81
Number of HSP's better than 10.0 without gapping: 85
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62947
Number of HSP's gapped (non-prelim): 384
length of query: 375
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 353
effective length of database: 17,147,199,772
effective search space: 6052961519516
effective search space used: 6052961519516
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top