ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl28g08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF306827.1|AF306827 Triticum monococcum subsp. monococcum clo... 52 0.001
2gb|AF306829.1|AF306829 Triticum urartu clone 581 cytosolic acety... 46 0.092
3gb|AF306828.1|AF306828 Triticum turgidum subsp. dicoccoides clon... 46 0.092
4gb|AF306824.1|AF306824 Triticum timopheevii subsp. armeniacum cl... 46 0.092
5gb|DQ400416.1| Triticum aestivum starch synthase IV (SSIV) gene,... 44 0.37
6emb|AL359375.16| Human DNA sequence from clone RP11-93K18 on chr... 42 1.4
7emb|AL031431.8|HS462O23 Human DNA sequence from clone RP3-462O23... 42 1.4
8gb|AC158581.2| Mus musculus chromosome 3, clone RP24-264G1, comp... 42 1.4
9gb|AC079269.8| Homo sapiens chromosome 10 clone RP11-379L21, com... 42 1.4
10gb|AC102278.10| Mus musculus chromosome 3, clone RP24-298A6, com... 42 1.4
11gb|AC144948.3| Mus musculus BAC clone RP23-119D7 from chromosome... 40 5.7
12gb|BC092191.1| Rattus norvegicus cDNA clone IMAGE:7111416, **** ... 40 5.7
13gb|AC069113.9| Homo sapiens chromosome 8, clone RP11-597M17, com... 40 5.7
14gb|AF271405.5| Homo sapiens chromosome 8 clone SCb-554J4 map p21... 40 5.7
15gb|AF217759.5| Homo sapiens chromosome 8 clone GS1-45G16 map p21... 40 5.7
16gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome 40 5.7
17emb|BX927372.14| Zebrafish DNA sequence from clone CH211-241H14 ... 40 5.7
18gb|AC122142.1| Caenorhabditis briggsae cosmid CB019M24, complete... 40 5.7
19gb|AC104997.4| Homo sapiens chromosome 8, clone RP11-1149M3, com... 40 5.7
20gb|AC062039.3| Homo sapiens BAC clone RP11-814A15 from 2, comple... 40 5.7
21emb|AL954847.17| Zebrafish DNA sequence from clone DKEY-68G8 in ... 40 5.7
22gb|AC147839.2| Xenopus tropicalis clone CH216-9N23, complete seq... 40 5.7
23gb|BC087131.1| Rattus norvegicus glutamate-ammonia ligase (gluta... 40 5.7
24ref|NM_017073.2| Rattus norvegicus glutamate-ammonia ligase (glu... 40 5.7
25emb|X92074.1|RNGLUSYNI R.norvegicus glutamine synthetase intron 1 40 5.7

>gb|AF306827.1|AF306827 Triticum monococcum subsp. monococcum clone 437 cytosolic
           acetyl-CoA carboxylase gene, partial cds
          Length = 1812

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 29  ttgaactgcaaaaacatgttaaatttaggaacagatggtgta 70
           ||||||||||||||| | ||| ||||||||||||| ||||||
Sbjct: 729 ttgaactgcaaaaacgtcttatatttaggaacagagggtgta 770



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 28  tttgaactgcaaaaacatgttaaatttaggaacaga 63
           |||||||||||||||| | ||| |||||| ||||||
Sbjct: 728 tttgaactgcaaaaacgtcttatatttagaaacaga 693



to top

>gb|AF306829.1|AF306829 Triticum urartu clone 581 cytosolic acetyl-CoA carboxylase gene,
           partial cds
          Length = 1812

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 28  tttgaactgcaaaaacatgttaaatttaggaacagatggtgta 70
           |||||||| ||||||| | ||| ||||||||||||| ||||||
Sbjct: 728 tttgaactacaaaaacgtcttatatttaggaacagagggtgta 770



to top

>gb|AF306828.1|AF306828 Triticum turgidum subsp. dicoccoides clone 465 cytosolic acetyl-CoA
           carboxylase gene, partial cds
          Length = 1836

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 28  tttgaactgcaaaaacatgttaaatttaggaacagatggtgta 70
           |||||||| ||||||| | ||| ||||||||||||| ||||||
Sbjct: 728 tttgaactacaaaaacgtcttatatttaggaacagagggtgta 770



to top

>gb|AF306824.1|AF306824 Triticum timopheevii subsp. armeniacum clone 453 cytosolic
           acetyl-CoA carboxylase gene, partial cds
          Length = 1812

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 28  tttgaactgcaaaaacatgttaaatttaggaacagatggtgta 70
           |||||||| ||||||| | ||| ||||||||||||| ||||||
Sbjct: 728 tttgaactacaaaaacgtcttatatttaggaacagagggtgta 770



to top

>gb|DQ400416.1| Triticum aestivum starch synthase IV (SSIV) gene, complete cds
          Length = 7137

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                              
Query: 26   ggtttgaactgcaaaaacatgttaaatttaggaacagatggtgtacaaga 75
            ||||| |||||| ||||| | ||| ||||||||||||| |||||| ||||
Sbjct: 2850 ggtttaaactgccaaaacgtcttacatttaggaacagagggtgtagaaga 2801



to top

>emb|AL359375.16| Human DNA sequence from clone RP11-93K18 on chromosome 10, complete
              sequence
          Length = 126846

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 33     actgcaaaaacatgttaaatt 53
              |||||||||||||||||||||
Sbjct: 113496 actgcaaaaacatgttaaatt 113516



to top

>emb|AL031431.8|HS462O23 Human DNA sequence from clone RP3-462O23 on chromosome 1p35.1-36.12
             Contains the 3' end of the gene for sister-of-mammalian
             grainyhead (SOM), a novel gene (LOC90529) and a novel gene
             (DJ462O23.2), complete sequence
          Length = 154154

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 95    cttcagtcttttttaacctgc 115
             |||||||||||||||||||||
Sbjct: 30026 cttcagtcttttttaacctgc 30006



to top

>gb|AC158581.2| Mus musculus chromosome 3, clone RP24-264G1, complete sequence
          Length = 166808

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 307    tgctgagacatccatcatcca 327
              |||||||||||||||||||||
Sbjct: 107588 tgctgagacatccatcatcca 107608



to top

>gb|AC079269.8| Homo sapiens chromosome 10 clone RP11-379L21, complete sequence
          Length = 196004

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 33    actgcaaaaacatgttaaatt 53
             |||||||||||||||||||||
Sbjct: 92826 actgcaaaaacatgttaaatt 92846



to top

>gb|AC102278.10| Mus musculus chromosome 3, clone RP24-298A6, complete sequence
          Length = 184908

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 307   tgctgagacatccatcatcca 327
             |||||||||||||||||||||
Sbjct: 11976 tgctgagacatccatcatcca 11956



to top

>gb|AC144948.3| Mus musculus BAC clone RP23-119D7 from chromosome 6, complete sequence
          Length = 213811

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 31    gaactgcaaaaacatgttaaattt 54
             |||||||||| |||||||||||||
Sbjct: 84569 gaactgcaaagacatgttaaattt 84546



to top

>gb|BC092191.1| Rattus norvegicus cDNA clone IMAGE:7111416, **** WARNING: chimeric
            clone ****
          Length = 4570

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 131  ttcgttcctcacctccagctccat 154
            |||||||||| |||||||||||||
Sbjct: 3089 ttcgttcctctcctccagctccat 3112



to top

>gb|AC069113.9| Homo sapiens chromosome 8, clone RP11-597M17, complete sequence
          Length = 197616

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    acatcttacatttaggtttg 31
             ||||||||||||||||||||
Sbjct: 30141 acatcttacatttaggtttg 30160



to top

>gb|AF271405.5| Homo sapiens chromosome 8 clone SCb-554J4 map p21-p11, complete
             sequence
          Length = 109761

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    acatcttacatttaggtttg 31
             ||||||||||||||||||||
Sbjct: 82406 acatcttacatttaggtttg 82425



to top

>gb|AF217759.5| Homo sapiens chromosome 8 clone GS1-45G16 map p21-p11, complete
             sequence
          Length = 83359

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    acatcttacatttaggtttg 31
             ||||||||||||||||||||
Sbjct: 56748 acatcttacatttaggtttg 56767



to top

>gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome
          Length = 5373180

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 319     catcatccatgacacatttt 338
               ||||||||||||||||||||
Sbjct: 1431210 catcatccatgacacatttt 1431229



to top

>emb|BX927372.14| Zebrafish DNA sequence from clone CH211-241H14 in linkage group 13,
             complete sequence
          Length = 138336

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 236   accaaacacaatgaatcagatcac 259
             ||||||||||||||| ||||||||
Sbjct: 18801 accaaacacaatgaaccagatcac 18778



to top

>gb|AC122142.1| Caenorhabditis briggsae cosmid CB019M24, complete sequence
          Length = 111147

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 21    atttaggtttgaactgcaaaaaca 44
             |||| |||||||||||||||||||
Sbjct: 99839 attttggtttgaactgcaaaaaca 99816



to top

>gb|AC104997.4| Homo sapiens chromosome 8, clone RP11-1149M3, complete sequence
          Length = 144859

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 12    acatcttacatttaggtttg 31
             ||||||||||||||||||||
Sbjct: 35448 acatcttacatttaggtttg 35429



to top

>gb|AC062039.3| Homo sapiens BAC clone RP11-814A15 from 2, complete sequence
          Length = 141040

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 41    aacatgttaaatttaggaacagat 64
             ||||||||||||||||||| ||||
Sbjct: 55230 aacatgttaaatttaggaatagat 55207



to top

>emb|AL954847.17| Zebrafish DNA sequence from clone DKEY-68G8 in linkage group 13, complete
              sequence
          Length = 278040

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 236    accaaacacaatgaatcagatcac 259
              ||||||||||||||| ||||||||
Sbjct: 242072 accaaacacaatgaaccagatcac 242049



to top

>gb|AC147839.2| Xenopus tropicalis clone CH216-9N23, complete sequence
          Length = 184473

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 212    catggaaccatccaaaccca 231
              ||||||||||||||||||||
Sbjct: 152795 catggaaccatccaaaccca 152814



to top

>gb|BC087131.1| Rattus norvegicus glutamate-ammonia ligase (glutamine synthase), mRNA
            (cDNA clone MGC:94942 IMAGE:7112880), complete cds
          Length = 4157

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 131  ttcgttcctcacctccagctccat 154
            |||||||||| |||||||||||||
Sbjct: 2805 ttcgttcctctcctccagctccat 2782



to top

>ref|NM_017073.2| Rattus norvegicus glutamate-ammonia ligase (glutamine synthase)
            (Glul), mRNA
          Length = 4157

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 131  ttcgttcctcacctccagctccat 154
            |||||||||| |||||||||||||
Sbjct: 2805 ttcgttcctctcctccagctccat 2782



to top

>emb|X92074.1|RNGLUSYNI R.norvegicus glutamine synthetase intron 1
          Length = 1938

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 131  ttcgttcctcacctccagctccat 154
            |||||||||| |||||||||||||
Sbjct: 1013 ttcgttcctctcctccagctccat 990


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,398,640
Number of Sequences: 3902068
Number of extensions: 4398640
Number of successful extensions: 106400
Number of sequences better than 10.0: 25
Number of HSP's better than 10.0 without gapping: 25
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 106330
Number of HSP's gapped (non-prelim): 70
length of query: 425
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 403
effective length of database: 17,147,199,772
effective search space: 6910321508116
effective search space used: 6910321508116
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top