>emb|CR382292.9| Zebrafish DNA sequence from clone DKEY-96L17 in linkage group 5, complete
              sequence
          Length = 178208

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 176    catgacatttattgccatgtac 197
              ||||||||||||||||||||||
Sbjct: 130498 catgacatttattgccatgtac 130519

>emb|BX323038.3| Zebrafish DNA sequence from clone DKEYP-57D7 in linkage group 1,
             complete sequence
          Length = 87548

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 176   catgacatttattgccatgtac 197
             ||||||||||||||||||||||
Sbjct: 10888 catgacatttattgccatgtac 10867

>gb|AC147027.4| Pan troglodytes BAC clone RP43-92F2 from 7, complete sequence
          Length = 162023

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 333    ttttttaattttatgtacaga 353
              |||||||||||||||||||||
Sbjct: 147857 ttttttaattttatgtacaga 147877

>gb|AC161472.4| Pan troglodytes BAC clone CH251-584L3 from chromosome 7, complete
             sequence
          Length = 189756

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 333   ttttttaattttatgtacaga 353
             |||||||||||||||||||||
Sbjct: 53678 ttttttaattttatgtacaga 53698

>emb|BX936452.24| Zebrafish DNA sequence from clone CH211-282C13 in linkage group 13,
             complete sequence
          Length = 136110

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 176   catgacatttattgccatgta 196
             |||||||||||||||||||||
Sbjct: 16063 catgacatttattgccatgta 16043

>gb|AC000056.1| Homo sapiens BAC clone CTB-5F13 from 7, complete sequence
          Length = 84838

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 333   ttttttaattttatgtacaga 353
             |||||||||||||||||||||
Sbjct: 10252 ttttttaattttatgtacaga 10272

>gb|AC142291.1| Pan troglodytes BAC clone RP43-184P18 from 7, complete sequence
          Length = 152668

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 320   ttatgcacatgggttttttaa 340
             |||||||||||||||||||||
Sbjct: 40034 ttatgcacatgggttttttaa 40054

>gb|AC091485.8| Homo sapiens BAC clone RP11-434N4 from 2, complete sequence
          Length = 112063

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 333   ttttttaattttatgtacaga 353
             |||||||||||||||||||||
Sbjct: 22705 ttttttaattttatgtacaga 22725

>emb|CR388077.11| Zebrafish DNA sequence from clone CH211-286E11 in linkage group 8,
              complete sequence
          Length = 192705

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 170    atttaccatgacatttattgccat 193
              |||| |||||||||||||||||||
Sbjct: 181438 attttccatgacatttattgccat 181415

>emb|CR361543.9| Zebrafish DNA sequence from clone CH211-25E11 in linkage group 8,
            complete sequence
          Length = 66809

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 170  atttaccatgacatttattgccat 193
            ||||| ||||||||||||||||||
Sbjct: 7238 atttaacatgacatttattgccat 7215

>emb|AL845509.6| Human DNA sequence from clone DAQB-282H15 on chromosome 6 Contains the
             5' end of the Notch4 gene for Notch homolog 4
             (Drosophila), the 3' end of the C6orf10 gene for
             chromosome 6 open reading frame 10 and one CpG island,
             complete sequence
          Length = 126404

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 333   ttttttaattttatgtacagagaa 356
             |||| |||||||||||||||||||
Sbjct: 99413 ttttataattttatgtacagagaa 99390

>emb|BX284927.5| Human DNA sequence from clone DASS-105C4 on chromosome 6, complete
             sequence
          Length = 108760

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 333   ttttttaattttatgtacagagaa 356
             |||| |||||||||||||||||||
Sbjct: 85725 ttttataattttatgtacagagaa 85702

>emb|AL845557.1| Human DNA sequence from clone XXbac-556A18 on chromosome 6 contains the
             gene for chromosome 6 open reading frame 10 and a
             heterogeneous nuclear ribonucleoprotein A1 (HNRPA1)
             pseudogene, complete sequence
          Length = 49278

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 333   ttttttaattttatgtacagagaa 356
             |||| |||||||||||||||||||
Sbjct: 16614 ttttataattttatgtacagagaa 16591

>emb|AL671511.4| Human DNA sequence from clone XXbac-154L12 on chromosome 6 contains the
             3' end of the C6ORF10 gene for chromosome 6 open reading
             frame 10 and a heterogeneous nuclear ribonucleoprotein A1
             (HNRPA1) pseudogene, complete sequence
          Length = 87294

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 333   ttttttaattttatgtacagagaa 356
             |||| |||||||||||||||||||
Sbjct: 54867 ttttataattttatgtacagagaa 54844

>emb|AL161613.23| Human DNA sequence from clone RP11-22J15 on chromosome 13 Contains the
             5' end of the LATS2 gene for LATS, large tumor suppressor,
             homolog 2 (LATS (large tumor suppressor, Drosophila)
             homolog 2), a ribosomal protein S12 (40S ribosomal protein
             S12) (RPS12) pseudogene, a chromosome 9 open reading frame
             12 (C9orf12) (INSP5K2, FLJ13161)pseudogene and two CpG
             islands, complete sequence
          Length = 113372

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 326   acatgggttttttaatttta 345
             ||||||||||||||||||||
Sbjct: 38500 acatgggttttttaatttta 38481

>emb|AL137878.11| Human DNA sequence from clone RP11-145J3 on chromosome 13 Contains the
             3' end of the EPSTI1 gene for epithelial stromal
             interaction 1 (breast), a  novel gene and a pseudogene,
             complete sequence
          Length = 87358

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   catgacatttattgccatgt 195
             ||||||||||||||||||||
Sbjct: 16168 catgacatttattgccatgt 16149

>emb|AL109749.22|HSA213H19 Human DNA sequence from clone RP6-213H19 on chromosome Xq25-26.3 Contains
              the gene for Mst3 and SOK1-related kinase (MST4), LOC90167
              gene and a CpG island, complete sequence
          Length = 138902

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 30     catctgatctcagcttcagg 49
              ||||||||||||||||||||
Sbjct: 112476 catctgatctcagcttcagg 112457

>emb|AL035445.4|HS372B18 Human DNA sequence from clone RP3-372B18 on chromosome 6p21.2-22.1
             Contains an HNRPA1 (Heterogenous Nuclear Ribonucleoprotein
             A1 (Helix Destabilizing protein, HDP, HNRNP core protein
             A1)) pseudogene and the 3' end of the C6orf10 gene for
             TSBP (Testis Specific Basic Protein). Contains ESTs and
             GSSs, complete sequence
          Length = 38216

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 333   ttttttaattttatgtacagagaa 356
             |||| |||||||||||||||||||
Sbjct: 34218 ttttataattttatgtacagagaa 34241

>gb|AC091158.11| Mus musculus Strain C57BL6/J chromosome 6 BAC, RP23-109E8, Complete
              Sequence, complete sequence
          Length = 195048

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 111    catacaaacttccaaaggca 130
              ||||||||||||||||||||
Sbjct: 126621 catacaaacttccaaaggca 126602

>emb|BX927180.8| Human DNA sequence from clone DAMA-391O5 on chromosome 6, complete
             sequence
          Length = 69474

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 333   ttttttaattttatgtacagagaa 356
             |||| |||||||||||||||||||
Sbjct: 38680 ttttataattttatgtacagagaa 38703

>emb|BX548071.7| Zebrafish DNA sequence from clone DKEY-25L23 in linkage group 9, complete
              sequence
          Length = 223099

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 170    atttaccatgacatttattgccat 193
              ||||| ||||||||||||||||||
Sbjct: 125126 atttaacatgacatttattgccat 125149

>emb|CR847543.13| Zebrafish DNA sequence from clone DKEY-183P4 in linkage group 8, complete
              sequence
          Length = 207382

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 170    atttaccatgacatttattgccat 193
              ||||| ||||||||||||||||||
Sbjct: 192648 atttaacatgacatttattgccat 192671

>emb|CR759737.4| Human DNA sequence from clone DADB-285H20 on chromosome 6, complete
             sequence
          Length = 83525

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 333   ttttttaattttatgtacagagaa 356
             |||| |||||||||||||||||||
Sbjct: 59923 ttttataattttatgtacagagaa 59900

>gb|AC183273.3| Pan troglodytes BAC clone CH251-142H10 from chromosome 7, complete
             sequence
          Length = 180027

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 210   tgtgagagagatggtactac 229
             ||||||||||||||||||||
Sbjct: 66435 tgtgagagagatggtactac 66454

>emb|BX323602.7| Zebrafish DNA sequence from clone RP71-61H23, complete sequence
          Length = 156514

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 170   atttaccatgacatttattgccat 193
             ||||| ||||||||||||||||||
Sbjct: 10463 atttaacatgacatttattgccat 10440

>emb|BX004888.9| Zebrafish DNA sequence from clone DKEY-8F21 in linkage group 1, complete
              sequence
          Length = 219280

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 170    atttaccatgacatttattgccat 193
              ||||||| ||||||||||||||||
Sbjct: 141204 atttaccttgacatttattgccat 141181

>emb|BX470204.13| Zebrafish DNA sequence from clone CH211-63C23 in linkage group 10,
             complete sequence
          Length = 185190

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 170   atttaccatgacatttattgccat 193
             ||||||||| ||||||||||||||
Sbjct: 65279 atttaccataacatttattgccat 65302

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 322      atgcacatgggttttttaat 341
                ||||||||||||||||||||
Sbjct: 11161734 atgcacatgggttttttaat 11161753

>emb|AL954309.11| Zebrafish DNA sequence from clone CH211-213D2 in linkage group 8,
              complete sequence
          Length = 209195

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 170    atttaccatgacatttattgccat 193
              ||||| ||||||||||||||||||
Sbjct: 134576 atttaacatgacatttattgccat 134553

>emb|BX072550.6| Zebrafish DNA sequence from clone DKEY-24P1 in linkage group 15,
             complete sequence
          Length = 229061

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 170   atttaccatgacatttattgccat 193
             ||||| ||||||||||||||||||
Sbjct: 79692 atttaacatgacatttattgccat 79715

>emb|CT009591.8| Human DNA sequence from clone DAAP-263O12 on chromosome 6, complete
             sequence
          Length = 80114

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 333   ttttttaattttatgtacagagaa 356
             |||| |||||||||||||||||||
Sbjct: 60738 ttttataattttatgtacagagaa 60715

>emb|AL731637.2|OSJN00278 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0115I09,
             complete sequence
          Length = 141580

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 322   atgcacatgggttttttaat 341
             ||||||||||||||||||||
Sbjct: 30358 atgcacatgggttttttaat 30377


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,288,163
Number of Sequences: 3902068
Number of extensions: 4288163
Number of successful extensions: 84991
Number of sequences better than 10.0: 32
Number of HSP's better than 10.0 without gapping: 32
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 84906
Number of HSP's gapped (non-prelim): 85
length of query: 399
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 377
effective length of database: 17,147,199,772
effective search space: 6464494314044
effective search space used: 6464494314044
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)