>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score =  204 bits (103), Expect = 2e-49
 Identities = 223/263 (84%)
 Strand = Plus / Plus

                                                                           
Query: 131     tctaacctctgaaggaccagctgcttctttggagcaaagcctttggcaatcgacacagag 190
               ||||||||||| ||||| |||| ||||| |||||||| |||||| || |||| ||| |||
Sbjct: 4567873 tctaacctctggaggacaagcttcttctgtggagcaaggcctttcgcgatcgccacggag 4567932

                                                                           
Query: 191     tttacatccaccacaacggtatcatcctccttgaagttacccttgaggacagcaagagct 250
                | || || || |  ||||| || || || |||||||  ||||| ||||||   || || 
Sbjct: 4567933 ctcacgtcgacgaggacggtgtcgtcttctttgaagtcgcccttcaggacactgagggcg 4567992

                                                                           
Query: 251     atctcgttctccaccatctgctggatcaccctcttgacaggcctagcaccgtagttaggg 310
               ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 4567993 atctcgttctctaccatctgctggatcaccctcttcacaggcctagcaccgtagttaggg 4568052

                                                                           
Query: 311     tcaaagccaagagcgccgagatgctccacagcttccggtgtgtactgaaggtgaatcttc 370
               |||||||| |||| ||| ||||||||||||||||| ||||||||||| || |||||||||
Sbjct: 4568053 tcaaagccgagagagccaagatgctccacagcttctggtgtgtactgcagatgaatcttc 4568112

                                      
Query: 371     tgttgcagcaaccggtttttgac 393
               ||||||  || |||||| |||||
Sbjct: 4568113 tgttgcctcagccggttcttgac 4568135

>dbj|AP004087.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1297_C09
          Length = 163378

 Score =  204 bits (103), Expect = 2e-49
 Identities = 223/263 (84%)
 Strand = Plus / Plus

                                                                          
Query: 131    tctaacctctgaaggaccagctgcttctttggagcaaagcctttggcaatcgacacagag 190
              ||||||||||| ||||| |||| ||||| |||||||| |||||| || |||| ||| |||
Sbjct: 103252 tctaacctctggaggacaagcttcttctgtggagcaaggcctttcgcgatcgccacggag 103311

                                                                          
Query: 191    tttacatccaccacaacggtatcatcctccttgaagttacccttgaggacagcaagagct 250
               | || || || |  ||||| || || || |||||||  ||||| ||||||   || || 
Sbjct: 103312 ctcacgtcgacgaggacggtgtcgtcttctttgaagtcgcccttcaggacactgagggcg 103371

                                                                          
Query: 251    atctcgttctccaccatctgctggatcaccctcttgacaggcctagcaccgtagttaggg 310
              ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 103372 atctcgttctctaccatctgctggatcaccctcttcacaggcctagcaccgtagttaggg 103431

                                                                          
Query: 311    tcaaagccaagagcgccgagatgctccacagcttccggtgtgtactgaaggtgaatcttc 370
              |||||||| |||| ||| ||||||||||||||||| ||||||||||| || |||||||||
Sbjct: 103432 tcaaagccgagagagccaagatgctccacagcttctggtgtgtactgcagatgaatcttc 103491

                                     
Query: 371    tgttgcagcaaccggtttttgac 393
              ||||||  || |||||| |||||
Sbjct: 103492 tgttgcctcagccggttcttgac 103514

>ref|NM_128071.2| Arabidopsis thaliana ATP binding / ATPase/ nucleoside-triphosphatase/
            nucleotide binding / protein binding AT2G25140 mRNA,
            complete cds
          Length = 3223

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 251  atctcgttctccaccatctgctggatcaccctcttgacaggcctagcaccgtagttaggg 310
            ||||| |||||||||||||| || ||||| | ||| || ||||| || ||||||||||||
Sbjct: 2913 atctcattctccaccatctgttgaatcactcgcttcaccggccttgccccgtagttaggg 2854

                       
Query: 311  tcaaagccaag 321
            |||||||||||
Sbjct: 2853 tcaaagccaag 2843

>gb|AY070722.1| Arabidopsis thaliana At2g25140/F13D4.100 mRNA, complete cds
          Length = 3223

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 251  atctcgttctccaccatctgctggatcaccctcttgacaggcctagcaccgtagttaggg 310
            ||||| |||||||||||||| || ||||| | ||| || ||||| || ||||||||||||
Sbjct: 2913 atctcattctccaccatctgttgaatcactcgcttcaccggccttgccccgtagttaggg 2854

                       
Query: 311  tcaaagccaag 321
            |||||||||||
Sbjct: 2853 tcaaagccaag 2843

>gb|BT002223.1| Arabidopsis thaliana At2g25140/F13D4.100 mRNA, complete cds
          Length = 2895

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 251  atctcgttctccaccatctgctggatcaccctcttgacaggcctagcaccgtagttaggg 310
            ||||| |||||||||||||| || ||||| | ||| || ||||| || ||||||||||||
Sbjct: 2759 atctcattctccaccatctgttgaatcactcgcttcaccggccttgccccgtagttaggg 2700

                       
Query: 311  tcaaagccaag 321
            |||||||||||
Sbjct: 2699 tcaaagccaag 2689

>gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome
          Length = 4607203

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 361     gtgaatcttctgttgcagcaa 381
               |||||||||||||||||||||
Sbjct: 2599307 gtgaatcttctgttgcagcaa 2599287

>gb|U00096.2| Escherichia coli K-12 MG1655, complete genome
          Length = 4639675

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 361     gtgaatcttctgttgcagcaa 381
               |||||||||||||||||||||
Sbjct: 2609219 gtgaatcttctgttgcagcaa 2609199

>dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome
          Length = 4646332

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 361     gtgaatcttctgttgcagcaa 381
               |||||||||||||||||||||
Sbjct: 2609853 gtgaatcttctgttgcagcaa 2609833

>gb|AC105091.3| Homo sapiens chromosome 8, clone RP11-479P21, complete sequence
          Length = 173888

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 159    ttggagcaaagcctttggcaa 179
              |||||||||||||||||||||
Sbjct: 106545 ttggagcaaagcctttggcaa 106565

>gb|M63654.1|ECOORF123 Escherichia coli P177 (o177), bacterioferritin comigratory protein
             (bcp), putative hydrogenase-4 complex (hyfABCDEFGHIJR),
             and putative formate transporter (focB) gene, complete cds
             and putative permease P75 (perM) gene partial cds
          Length = 15115

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 361   gtgaatcttctgttgcagcaa 381
             |||||||||||||||||||||
Sbjct: 11264 gtgaatcttctgttgcagcaa 11244

>gb|AC022210.8| Homo sapiens BAC clone RP11-617F9 from 2, complete sequence
          Length = 164846

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 215   tcctccttgaagttacccttgagga 239
             ||||||||||||||| |||||||||
Sbjct: 20039 tcctccttgaagttaaccttgagga 20015

>gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome
          Length = 4599354

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 361     gtgaatcttctgttgcagcaa 381
               |||||||||||||||||||||
Sbjct: 2577440 gtgaatcttctgttgcagcaa 2577420

>gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome
          Length = 5528445

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 361     gtgaatcttctgttgcagcaa 381
               |||||||||||||||||||||
Sbjct: 3397174 gtgaatcttctgttgcagcaa 3397154

>dbj|AB209690.1| Homo sapiens mRNA for ADAM 32 precursor (A disintegrin and
            metalloprotease domain 32) variant protein
          Length = 6873

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 159  ttggagcaaagcctttggcaa 179
            |||||||||||||||||||||
Sbjct: 5288 ttggagcaaagcctttggcaa 5308

>dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome
          Length = 5498450

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 361     gtgaatcttctgttgcagcaa 381
               |||||||||||||||||||||
Sbjct: 3327340 gtgaatcttctgttgcagcaa 3327320

>gb|CP000034.1| Shigella dysenteriae Sd197, complete genome
          Length = 4369232

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 361     gtgaatcttctgttgcagcaa 381
               |||||||||||||||||||||
Sbjct: 2470834 gtgaatcttctgttgcagcaa 2470814

>gb|CP000036.1| Shigella boydii Sb227, complete genome
          Length = 4519823

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 361     gtgaatcttctgttgcagcaa 381
               |||||||||||||||||||||
Sbjct: 2504853 gtgaatcttctgttgcagcaa 2504833

>gb|CP000038.1| Shigella sonnei Ss046, complete genome
          Length = 4825265

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 361     gtgaatcttctgttgcagcaa 381
               |||||||||||||||||||||
Sbjct: 2713291 gtgaatcttctgttgcagcaa 2713271

>gb|AC100378.10| Mus musculus chromosome 10, clone RP23-130O4, complete sequence
          Length = 218363

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 170    cctttggcaatcgacacagagtttacat 197
              ||||||||||| | ||||||||||||||
Sbjct: 207233 cctttggcaatggccacagagtttacat 207260

>gb|AC124721.4| Mus musculus chromosome 10 clone RP23-387G19, complete sequence
          Length = 216612

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 170    cctttggcaatcgacacagagtttacat 197
              ||||||||||| | ||||||||||||||
Sbjct: 186258 cctttggcaatggccacagagtttacat 186231

>gb|AC008267.6| Homo sapiens BAC clone GS1-124K5 from 7, complete sequence
          Length = 196954

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 259   ctccaccatctgctggatca 278
             ||||||||||||||||||||
Sbjct: 24679 ctccaccatctgctggatca 24660

>emb|AL732437.12| Human DNA sequence from clone RP11-116G8 on chromosome 10 Contains the
             NET1 gene for neuroepithelial cell transforming gene 1,
             the gene for calmodulin-like skin protein (CLSP), the
             CALML3 gene for calmodulin-like 3 (CLP) and four CpG
             islands, complete sequence
          Length = 183441

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 9     caactcccattcatgcatttcctg 32
             |||||||||||| |||||||||||
Sbjct: 90008 caactcccattcctgcatttcctg 90031

>emb|AJ320262.1|AFE320262 Acidithiobacillus ferrooxidans partial petC2 gene for putative
            cytochrome c1 and hip gene for putative high-redox
            potential iron-sulfur protein (HiPIP)
          Length = 1615

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 385  gtttttgacccgatccagct 404
            ||||||||||||||||||||
Sbjct: 1600 gtttttgacccgatccagct 1581

>ref|XM_793553.1| PREDICTED: Strongylocentrotus purpuratus similar to protein
           tyrosine phosphatase, non-receptor type 4 (LOC594103),
           mRNA
          Length = 1803

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 317 ccaagagcgccgagatgctc 336
           ||||||||||||||||||||
Sbjct: 437 ccaagagcgccgagatgctc 456

>gb|AC092764.3| Pan troglodytes clone RP43-37J6, complete sequence
          Length = 172761

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 259    ctccaccatctgctggatca 278
              ||||||||||||||||||||
Sbjct: 113136 ctccaccatctgctggatca 113155

>emb|AJ251786.1|ATU251786 Agrobacterium tumefaciens strain C58 partial vppa gene for putative
           proton-translocating inorganic pyrophosphatase (isoform
           II)
          Length = 567

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 163 agcaaagcctttggcaatcg 182
           ||||||||||||||||||||
Sbjct: 108 agcaaagcctttggcaatcg 89

>emb|AJ251785.1|ATU251785 Agrobacterium tumefaciens strain D44 partial vppa gene for putative
           proton-translocating inorganic pyrophosphatase (isoform
           II)
          Length = 567

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 163 agcaaagcctttggcaatcg 182
           ||||||||||||||||||||
Sbjct: 108 agcaaagcctttggcaatcg 89


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,089,953
Number of Sequences: 3902068
Number of extensions: 3089953
Number of successful extensions: 55409
Number of sequences better than 10.0: 27
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 55159
Number of HSP's gapped (non-prelim): 250
length of query: 414
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 392
effective length of database: 17,147,199,772
effective search space: 6721702310624
effective search space used: 6721702310624
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)