>gb|AC115709.11| Mus musculus chromosome 12, clone RP23-76M3, complete sequence
          Length = 193170

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 33     aatccaacatggttccaacat 53
              |||||||||||||||||||||
Sbjct: 121031 aatccaacatggttccaacat 121011

>emb|BX830450.1|CNS0A25Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB82ZD12 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1733

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 332  gctcttctcaggcttgctctc 352
            |||||||||||||||||||||
Sbjct: 1402 gctcttctcaggcttgctctc 1422

>emb|CR974583.24| Mouse DNA sequence from clone RP23-118G7 on chromosome 12, complete
              sequence
          Length = 219072

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 33     aatccaacatggttccaacat 53
              |||||||||||||||||||||
Sbjct: 115812 aatccaacatggttccaacat 115792

>gb|AC156557.8| Mus musculus chromosome 7, clone RP23-321F8, complete sequence
          Length = 209053

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 88     tgcactccattcctggaagg 107
              ||||||||||||||||||||
Sbjct: 113931 tgcactccattcctggaagg 113912

>dbj|AB011482.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUA2
          Length = 83478

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 166   gatccgcaaaatatacatcttttc 189
             ||||||||||||||| ||||||||
Sbjct: 36461 gatccgcaaaatataaatcttttc 36438

>gb|AF163823.1|AF163823 Arabidopsis thaliana endoxyloglucan transferase (XTR3) gene, complete
            cds
          Length = 2703

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 166  gatccgcaaaatatacatcttttc 189
            ||||||||||||||| ||||||||
Sbjct: 1982 gatccgcaaaatataaatcttttc 2005


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,432,841
Number of Sequences: 3902068
Number of extensions: 3432841
Number of successful extensions: 55922
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 55911
Number of HSP's gapped (non-prelim): 11
length of query: 403
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 381
effective length of database: 17,147,199,772
effective search space: 6533083113132
effective search space used: 6533083113132
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)