>emb|AL606458.5| Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084A10,
             complete sequence
          Length = 144811

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 57/61 (93%), Gaps = 1/61 (1%)
 Strand = Plus / Plus

                                                                         
Query: 406   ttcatgcttgttgggccttttcttcttc-cacagcaaatgaatgatggatctgaccactt 464
             ||||||||||||||||||||||||||||  |||| |||||||| ||||||||||||||||
Sbjct: 87785 ttcatgcttgttgggccttttcttcttctaacagtaaatgaataatggatctgaccactt 87844

              
Query: 465   c 465
             |
Sbjct: 87845 c 87845

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 57/61 (93%), Gaps = 1/61 (1%)
 Strand = Plus / Plus

                                                                            
Query: 406      ttcatgcttgttgggccttttcttcttc-cacagcaaatgaatgatggatctgaccactt 464
                ||||||||||||||||||||||||||||  |||| |||||||| ||||||||||||||||
Sbjct: 21438035 ttcatgcttgttgggccttttcttcttctaacagtaaatgaataatggatctgaccactt 21438094

                 
Query: 465      c 465
                |
Sbjct: 21438095 c 21438095

>ref|XM_472552.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 4320

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 56/60 (93%), Gaps = 1/60 (1%)
 Strand = Plus / Minus

                                                                        
Query: 407  tcatgcttgttgggccttttcttcttc-cacagcaaatgaatgatggatctgaccacttc 465
            |||||||||||||||||||||||||||  |||| |||||||| |||||||||||||||||
Sbjct: 4320 tcatgcttgttgggccttttcttcttctaacagtaaatgaataatggatctgaccacttc 4261

>emb|BX931575.1| Gallus gallus finished cDNA, clone ChEST396i5
          Length = 1250

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 425 ttcttcttccacagcaaatgaatgat 450
           |||||||||||||||||||| |||||
Sbjct: 353 ttcttcttccacagcaaatgcatgat 378

>gb|AC157992.7| Mus musculus chromosome 8, clone RP23-302J17, complete sequence
          Length = 196519

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 5     gttgctagagtatttcatttc 25
             |||||||||||||||||||||
Sbjct: 79513 gttgctagagtatttcatttc 79533

>gb|AC158551.5| Mus musculus chromosome 8, clone RP23-466C10, complete sequence
          Length = 177561

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 5     gttgctagagtatttcatttc 25
             |||||||||||||||||||||
Sbjct: 42556 gttgctagagtatttcatttc 42536

>emb|AL354944.22| Human DNA sequence from clone RP11-106H5 on chromosome 9 Contains the
             3'end of the ZNF297B gene for zinc finger protein 297B
             (ZNF-X, FLJ22470, KIAA0414), the gene for a novel protein
             (KIAA1993) and a CpG island, complete sequence
          Length = 49144

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 420   gccttttcttcttccacagca 440
             |||||||||||||||||||||
Sbjct: 21480 gccttttcttcttccacagca 21460

>ref|XM_613447.2| PREDICTED: Bos taurus similar to androgen-induced prostate
            proliferative shutoff associated protein isoform 1
            (LOC533890), mRNA
          Length = 4251

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 243  tacttgatagcattcatcat 262
            ||||||||||||||||||||
Sbjct: 2754 tacttgatagcattcatcat 2735

>ref|XM_543139.2| PREDICTED: Canis familiaris similar to androgen-induced prostate
            proliferative shutoff associated protein isoform 1
            (LOC486014), mRNA
          Length = 4872

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 243  tacttgatagcattcatcat 262
            ||||||||||||||||||||
Sbjct: 3279 tacttgatagcattcatcat 3260

>emb|AL359977.16| Human DNA sequence from clone RP11-116M11 on chromosome 1 Contains the
             5' end of the FAF1 gene for Fas (TNFRSF6) associated
             factor 1, the 5' end of the CDKN2C gene for
             cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)
             and a CpG island, complete sequence
          Length = 75013

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 256   tcatcatgtagcatgaaggc 275
             ||||||||||||||||||||
Sbjct: 64558 tcatcatgtagcatgaaggc 64577

>emb|AL358215.16| Human DNA sequence from clone RP11-470L19 on chromosome 1 Contains the
             3' end of the PROK1 gene for Prokineticin 1, a putatative
             novel transcript, an unprocessed pseudogene, a novel
             transcript and the LOC395116 gene for the shaker subfamily
             potassium channel KCNA10, complete sequence
          Length = 101529

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 290   aaggccagcagcatgtcatttgca 313
             |||||||||||||||||| |||||
Sbjct: 94149 aaggccagcagcatgtcacttgca 94126

>emb|AL358075.10| Human DNA sequence from clone RP4-533D7 on chromosome 1p34.1-35.1
             Contains the 3' end of the gene for microtubule associated
             testis specific serine/threonine protein kinase (MAST205),
             the PIK3R3 gene for phosphoinositide-3-kinase regulatory
             subunit polypeptide 3 (p55, gamma), a cytochrome c oxidase
             subunit VIIb (COX7B) pseudogene, two novel genes and a CpG
             island, complete sequence
          Length = 132912

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 384   tacagtaattcattgaccacaatt 407
             |||||||||||||||| |||||||
Sbjct: 69698 tacagtaattcattgaacacaatt 69721

>gb|AC123784.2| Homo sapiens chromosome 15, clone RP11-354M13, complete sequence
          Length = 175493

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 60    cattgtgatatgagtaataa 79
             ||||||||||||||||||||
Sbjct: 53000 cattgtgatatgagtaataa 52981

>gb|AC117430.3| Homo sapiens 3 BAC RP11-119D18 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 154941

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 24     tccaatgcacttatcatctt 43
              ||||||||||||||||||||
Sbjct: 133415 tccaatgcacttatcatctt 133434

>gb|AC119737.3| Homo sapiens 3 BAC RP11-179A18 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 95650

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 24    tccaatgcacttatcatctt 43
             ||||||||||||||||||||
Sbjct: 21299 tccaatgcacttatcatctt 21318

>gb|AC099307.1| Drosophila melanogaster, chromosome 2R, region 57C-57D, BAC clone
             BACR13H23, complete sequence
          Length = 179139

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 6     ttgctagagtatttcatttc 25
             ||||||||||||||||||||
Sbjct: 86364 ttgctagagtatttcatttc 86345

>gb|AC158596.7| Mus musculus 10 BAC RP23-188F7 (Roswell Park Cancer Institute
            (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 207673

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 354  ttaattccaccacagttcca 373
            ||||||||||||||||||||
Sbjct: 9143 ttaattccaccacagttcca 9162

>gb|AC130683.4| Homo sapiens chromosome 15, clone RP11-1149K22, complete sequence
          Length = 68835

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 60 cattgtgatatgagtaataa 79
          ||||||||||||||||||||
Sbjct: 55 cattgtgatatgagtaataa 74

>gb|AE003454.3| Drosophila melanogaster chromosome 2R, section 62 of 73 of the complete
             sequence
          Length = 313634

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 6     ttgctagagtatttcatttc 25
             ||||||||||||||||||||
Sbjct: 76199 ttgctagagtatttcatttc 76180

>gb|AC003024.1|AC003024 Human Chromosome 15q26.1 PAC clone pDJ416i6, complete sequence
          Length = 116917

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 60    cattgtgatatgagtaataa 79
             ||||||||||||||||||||
Sbjct: 89848 cattgtgatatgagtaataa 89829

>gb|AC004564.1|AC004564 Drosophila melanogaster DNA sequence (P1 DS08012 (D224)), complete
             sequence
          Length = 67833

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 6     ttgctagagtatttcatttc 25
             ||||||||||||||||||||
Sbjct: 41149 ttgctagagtatttcatttc 41168

>dbj|AP004505.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT10E18, TM0035,
             complete sequence
          Length = 106041

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 424   tttcttcttccacagcaaat 443
             ||||||||||||||||||||
Sbjct: 80999 tttcttcttccacagcaaat 80980

>gb|AC153955.3| Mus musculus 10 BAC RP24-167A12 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 154271

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 354   ttaattccaccacagttcca 373
             ||||||||||||||||||||
Sbjct: 92556 ttaattccaccacagttcca 92537

>emb|AL844162.9| Mouse DNA sequence from clone RP23-160O12 on chromosome 2, complete
             sequence
          Length = 80190

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 111   gccaatgcaatgtggtcact 130
             ||||||||||||||||||||
Sbjct: 34029 gccaatgcaatgtggtcact 34048


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,838,518
Number of Sequences: 3902068
Number of extensions: 4838518
Number of successful extensions: 94643
Number of sequences better than 10.0: 24
Number of HSP's better than 10.0 without gapping: 24
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 94577
Number of HSP's gapped (non-prelim): 63
length of query: 469
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 447
effective length of database: 17,147,199,772
effective search space: 7664798298084
effective search space used: 7664798298084
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)