>emb|AL079343.4|CNS00M8T Human chromosome 14 DNA sequence BAC R-483C6 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 173480

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 181   tctgcacattcctttctgatat 202
             ||||||||||||||||||||||
Sbjct: 50462 tctgcacattcctttctgatat 50483

>gb|AC107760.9| Mus musculus chromosome 15, clone RP23-189K4, complete sequence
          Length = 178900

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 389    aaatgtccttgctgtgctgagttca 413
              |||||| ||||||||||||||||||
Sbjct: 165700 aaatgtgcttgctgtgctgagttca 165724

>emb|BX538351.1| Cryptosporidium parvum chromosome 6, complete sequence; segment 2/4
          Length = 307050

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 8     aatgagtcaataatattatcc 28
             |||||||||||||||||||||
Sbjct: 80354 aatgagtcaataatattatcc 80334

>emb|CT573038.4| Wallaby DNA sequence from clone MEKBa-230O16, complete sequence
          Length = 142635

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1     catgaaaaatgagtcaataat 21
             |||||||||||||||||||||
Sbjct: 93322 catgaaaaatgagtcaataat 93342

>gb|AC154874.9| Mus musculus chromosome 15, clone RP23-227M7, complete sequence
          Length = 206926

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 389    aaatgtccttgctgtgctgagttca 413
              |||||| ||||||||||||||||||
Sbjct: 131728 aaatgtgcttgctgtgctgagttca 131704

>ref|XM_641132.1| Dictyostelium discoideum ABC transporter B family protein
           (DDB0220443), partial mRNA
          Length = 2475

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 29  tattttgattcaaatagaac 48
           ||||||||||||||||||||
Sbjct: 889 tattttgattcaaatagaac 908

>gb|AC156570.2| Mus musculus BAC clone RP23-242N11 from chromosome 3, complete sequence
          Length = 198738

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 201    atacaggagagctgggagtg 220
              ||||||||||||||||||||
Sbjct: 147061 atacaggagagctgggagtg 147080

>gb|AC132483.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0014C03, complete sequence
          Length = 143739

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 32    tttgattcaaatagaacaca 51
             ||||||||||||||||||||
Sbjct: 23612 tttgattcaaatagaacaca 23631

>gb|AC115722.12| Mus musculus chromosome 5, clone RP23-16N23, complete sequence
          Length = 194380

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 114   acagagctgaaggacacagc 133
             ||||||||||||||||||||
Sbjct: 43846 acagagctgaaggacacagc 43865

>ref|XM_865210.1| PREDICTED: Bos taurus similar to parvin, gamma, transcript variant
           3 (LOC505984), mRNA
          Length = 1354

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 204 caggagagctgggagtgaga 223
           ||||||||||||||||||||
Sbjct: 965 caggagagctgggagtgaga 946

>ref|XM_582360.2| PREDICTED: Bos taurus similar to parvin, gamma, transcript variant
           1 (LOC505984), mRNA
          Length = 1146

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 204 caggagagctgggagtgaga 223
           ||||||||||||||||||||
Sbjct: 758 caggagagctgggagtgaga 739

>ref|XM_875286.1| PREDICTED: Bos taurus similar to parvin, gamma, transcript variant
           4 (LOC505984), mRNA
          Length = 1124

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 204 caggagagctgggagtgaga 223
           ||||||||||||||||||||
Sbjct: 735 caggagagctgggagtgaga 716

>gb|AC146391.4| Pan troglodytes BAC clone RP43-56L16 from 7, complete sequence
          Length = 155929

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 403    tgctgagttcagtatatggg 422
              ||||||||||||||||||||
Sbjct: 103169 tgctgagttcagtatatggg 103150

>gb|AC124186.3| Mus musculus BAC clone RP23-232B20 from chromosome 3, complete sequence
          Length = 195957

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 201   atacaggagagctgggagtg 220
             ||||||||||||||||||||
Sbjct: 36288 atacaggagagctgggagtg 36307

>gb|AC117275.3| Mus musculus BAC clone RP23-383F11 from chromosome 18, complete
             sequence
          Length = 209162

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 370   gaacggatttcttggtggaaaatg 393
             ||||||||||| ||||||||||||
Sbjct: 85253 gaacggatttcctggtggaaaatg 85276

>gb|AC125344.2| Mus musculus BAC clone RP24-332H21 from 12, complete sequence
          Length = 179908

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 121    tgaaggacacagcagctttg 140
              ||||||||||||||||||||
Sbjct: 114626 tgaaggacacagcagctttg 114607

>gb|AC110238.10| Mus musculus chromosome 5, clone RP23-106D12, complete sequence
          Length = 197964

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 114  acagagctgaaggacacagc 133
            ||||||||||||||||||||
Sbjct: 9976 acagagctgaaggacacagc 9957

>emb|AL442127.7| Human DNA sequence from clone RP11-297I6 on chromosome 13 Contains two
             novel genes, the 5' end of the EFNB2 gene for ephrin-B2
             (HTKL EPLG5 LERK5), an ATP synthase H+ transporting
             mitochondrial F0 complex subunit c pseudogene and two CpG
             islands, complete sequence
          Length = 210115

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 127   acacagcagctttgcttcaggtga 150
             |||||||||||||||||| |||||
Sbjct: 45495 acacagcagctttgcttctggtga 45472

>emb|AL354836.13| Human DNA sequence from clone RP11-157P1 on chromosome 20 Contains the
             LAMA5 gene for laminin alpha 5 (KIAA0533), the GP110 gene
             for cell membrane glycoprotein (surface antigen),
             110000M(r), the KIAA0772 gene with similarity to the gene
             for oxysterol-binding protein and two putative novel
             genes, complete sequence
          Length = 141056

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 124   aggacacagcagctttgctt 143
             ||||||||||||||||||||
Sbjct: 23417 aggacacagcagctttgctt 23436

>emb|AL035411.28|HS592A1 Human DNA sequence from clone RP4-592A1 on chromosome 1p31.2-32.3
             Contains the 3' end of a novel gene (KIAA1915), an
             adenylate kinase 2 (AK2) pseudogene, the TACSTD2 gene for
             tumor-associated calcium signal transducer 2 and a CpG
             island, complete sequence
          Length = 146112

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 150   aaaagactccagcacaccag 169
             ||||||||||||||||||||
Sbjct: 18471 aaaagactccagcacaccag 18452

>gb|DQ360825.1| Bacillus cereus plasmid pBCE4810 hypothetical protein, CAAX amino
             terminal protease, and pXO-14-like conserved protein
             genes, complete cds; cereulide synthetase gene cluster,
             complete sequence; pXO-11-like hypothetical protein,
             reverse transcriptase, and pXO1-10-like hypothetical
             protein genes, complete cds; and pXO1-8-like hypothetical
             protein gene, partial cds
          Length = 35864

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 110   tacaacagagctgaaggaca 129
             ||||||||||||||||||||
Sbjct: 27130 tacaacagagctgaaggaca 27111

>gb|AC078993.20| Homo sapiens Xp BAC RP11-431J24 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 214001

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 75     aaactgtgcggagcaaaacc 94
              ||||||||||||||||||||
Sbjct: 182331 aaactgtgcggagcaaaacc 182312

>gb|AC174233.4| Pan troglodytes BAC clone CH251-560K10 from chromosome unknown,
             complete sequence
          Length = 179813

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 13    gtcaataatattatcctatt 32
             ||||||||||||||||||||
Sbjct: 19492 gtcaataatattatcctatt 19473

>emb|AJ272265.1|HSA272265 Homo sapiens SPP2 gene for secreted phosphoprotein 24 precursor, exons
             1-8
          Length = 30000

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 13    gtcaataatattatcctatt 32
             ||||||||||||||||||||
Sbjct: 13092 gtcaataatattatcctatt 13073

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 32       tttgattcaaatagaacaca 51
                ||||||||||||||||||||
Sbjct: 19010969 tttgattcaaatagaacaca 19010988

>gb|AC159031.1| Pan troglodytes BAC clone CH251-381B17 from chromosome unknown,
            complete sequence
          Length = 177940

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 13   gtcaataatattatcctatt 32
            ||||||||||||||||||||
Sbjct: 3593 gtcaataatattatcctatt 3612

>gb|AC009107.11| Homo sapiens chromosome 16 clone RP11-459F6, complete sequence
          Length = 208220

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 309   ggatcagcctcctcatctgt 328
             ||||||||||||||||||||
Sbjct: 98394 ggatcagcctcctcatctgt 98375

>gb|AC006037.2| Homo sapiens BAC clone RP11-263G22 from 2, complete sequence
          Length = 108711

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 13    gtcaataatattatcctatt 32
             ||||||||||||||||||||
Sbjct: 66909 gtcaataatattatcctatt 66928

>gb|AC174383.3| Mus musculus BAC clone RP23-244A20 from chromosome 18, complete sequence
          Length = 216950

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 370    gaacggatttcttggtggaaaatg 393
              ||||||||||| ||||||||||||
Sbjct: 194131 gaacggatttcctggtggaaaatg 194154

>gb|AC004103.1|AC004103 Homo sapiens Xp22 BAC GS-619J3 (Genome Systems Human BAC library)
             complete sequence
          Length = 144368

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 75    aaactgtgcggagcaaaacc 94
             ||||||||||||||||||||
Sbjct: 98831 aaactgtgcggagcaaaacc 98812

>gb|AE008692.1| Zymomonas mobilis subsp. mobilis ZM4, complete genome
          Length = 2056416

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 226     atggaatcgaagatatctac 245
               ||||||||||||||||||||
Sbjct: 1930259 atggaatcgaagatatctac 1930240


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,296,434
Number of Sequences: 3902068
Number of extensions: 4296434
Number of successful extensions: 82047
Number of sequences better than 10.0: 31
Number of HSP's better than 10.0 without gapping: 31
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 81982
Number of HSP's gapped (non-prelim): 65
length of query: 444
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 422
effective length of database: 17,147,199,772
effective search space: 7236118303784
effective search space used: 7236118303784
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)