>emb|AL844885.4| Mouse DNA sequence from clone RP23-226E14 on chromosome 2, complete
             sequence
          Length = 129810

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 5     acatctctcaataattcataa 25
             |||||||||||||||||||||
Sbjct: 38561 acatctctcaataattcataa 38541

>gb|AC138260.7| Mus musculus chromosome 6, clone RP23-247I19, complete sequence
          Length = 197686

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 127   agactaaggatctcttggag 146
             ||||||||||||||||||||
Sbjct: 19118 agactaaggatctcttggag 19137

>gb|AC114643.9| Mus musculus chromosome 6, clone RP24-127D6, complete sequence
          Length = 215696

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 127   agactaaggatctcttggag 146
             ||||||||||||||||||||
Sbjct: 60099 agactaaggatctcttggag 60080

>emb|AL359292.12| Human DNA sequence from clone RP3-448K1 on chromosome 6 Contains the 5'
             end of the AIM1 gene for absent in melanoma 1 and two CpG
             islands, complete sequence
          Length = 53905

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 185   ccacacccagcctcaaactg 204
             ||||||||||||||||||||
Sbjct: 13691 ccacacccagcctcaaactg 13710

>dbj|AB088749.1| Aulopus japonicus DNA, 5S ribosomal RNA, nontranscribed spacer,
           partial sequence, clone:M_2_7_004
          Length = 766

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 14  aataattcataaattggtgt 33
           ||||||||||||||||||||
Sbjct: 112 aataattcataaattggtgt 93

>dbj|AB088748.1| Aulopus japonicus DNA, 5S ribosomal RNA, nontranscribed spacer,
           partial sequence, clone:M_2_4_010
          Length = 790

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 14  aataattcataaattggtgt 33
           ||||||||||||||||||||
Sbjct: 115 aataattcataaattggtgt 96

>dbj|AB088736.1| Aulopus japonicus DNA, nontranscribed spacer, partial sequence,
          clone:M_2_23_020
          Length = 669

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 14 aataattcataaattggtgt 33
          ||||||||||||||||||||
Sbjct: 74 aataattcataaattggtgt 55

>dbj|AB088735.1| Aulopus japonicus DNA, 5S ribosomal RNA, nontranscribed spacer,
           partial sequence, clone:M_2_1_001
          Length = 755

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 14  aataattcataaattggtgt 33
           ||||||||||||||||||||
Sbjct: 108 aataattcataaattggtgt 89

>gb|AC084165.1|AC084165 Arabidopsis thaliana chromosome 1 BAC F3C3 genomic sequence, complete
             sequence
          Length = 90132

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 160   cataatgtttcactacaaac 179
             ||||||||||||||||||||
Sbjct: 52753 cataatgtttcactacaaac 52734


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,007,375
Number of Sequences: 3902068
Number of extensions: 3007375
Number of successful extensions: 50437
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 50427
Number of HSP's gapped (non-prelim): 10
length of query: 365
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 343
effective length of database: 17,147,199,772
effective search space: 5881489521796
effective search space used: 5881489521796
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)