>gb|AC107085.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1764_D01,
             complete sequence
          Length = 164709

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 82/95 (86%)
 Strand = Plus / Minus

                                                                         
Query: 257   gcatggttcagatgatagttccagcctctcagaatgaccctgggcttggatccttcgggt 316
             ||||||| ||| ||||||||||||||| ||||||||||||||||  ||||||| | ||| 
Sbjct: 42054 gcatggtccaggtgatagttccagcctttcagaatgaccctgggggtggatccctggggg 41995

                                                
Query: 317   gcctcgaaggagatgtcagttgtcatcttctcccc 351
             |||||||| ||||||||  | | ||||||||||||
Sbjct: 41994 gcctcgaacgagatgtcgatggccatcttctcccc 41960

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 82/95 (86%)
 Strand = Plus / Minus

                                                                            
Query: 257      gcatggttcagatgatagttccagcctctcagaatgaccctgggcttggatccttcgggt 316
                ||||||| ||| ||||||||||||||| ||||||||||||||||  ||||||| | ||| 
Sbjct: 18874676 gcatggtccaggtgatagttccagcctttcagaatgaccctgggggtggatccctggggg 18874617

                                                   
Query: 317      gcctcgaaggagatgtcagttgtcatcttctcccc 351
                |||||||| ||||||||  | | ||||||||||||
Sbjct: 18874616 gcctcgaacgagatgtcgatggccatcttctcccc 18874582

>dbj|AK119412.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-132-F10, full
            insert sequence
          Length = 3621

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 82/95 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  gcatggttcagatgatagttccagcctctcagaatgaccctgggcttggatccttcgggt 316
            ||||||| ||| ||||||||||||||| ||||||||||||||||  ||||||| | ||| 
Sbjct: 3072 gcatggtccaggtgatagttccagcctttcagaatgaccctgggggtggatccctggggg 3013

                                               
Query: 317  gcctcgaaggagatgtcagttgtcatcttctcccc 351
            |||||||| ||||||||  | | ||||||||||||
Sbjct: 3012 gcctcgaacgagatgtcgatggccatcttctcccc 2978

>emb|CR854849.7| Human DNA sequence from clone RP13-79M23 on chromosome 1, complete
            sequence
          Length = 153012

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 285  tcagaatgaccctgggcttgg 305
            |||||||||||||||||||||
Sbjct: 6115 tcagaatgaccctgggcttgg 6095

>emb|AL603749.6| Human DNA sequence from clone RP11-133N1 on chromosome 1 Contains two
             novel proteins similar to preferentially expressed antigen
             in melanoma (PRAME) and the 3' end of a novel leucine rich
             repeat domain containing protein, complete sequence
          Length = 102313

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 285   tcagaatgaccctgggcttgg 305
             |||||||||||||||||||||
Sbjct: 37412 tcagaatgaccctgggcttgg 37432

>emb|AL365443.16| Human DNA sequence from clone RP11-219C24 on chromosome 1 Contains six
             novel genes similar to preferentially expressed antigen in
             melanoma (PRAME), two novel genes, two preferentially
             expressed antigen in melanoma (PRAME) pseudogenes and a
             CpG island, complete sequence
          Length = 184591

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 285   tcagaatgaccctgggcttgg 305
             |||||||||||||||||||||
Sbjct: 30970 tcagaatgaccctgggcttgg 30950

>gb|CP000282.1| Saccharophagus degradans 2-40, complete genome
          Length = 5057531

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 7       aattcaaccaatgtttcgtgctcat 31
               |||| ||||||||||||||||||||
Sbjct: 1901054 aatttaaccaatgtttcgtgctcat 1901030

>ref|NG_005161.1| Homo sapiens preferentially expressed antigen in melanoma (PRAME),
            pseudogene (LOC391001) on chromosome 1
          Length = 5181

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 285  tcagaatgaccctgggcttgg 305
            |||||||||||||||||||||
Sbjct: 4331 tcagaatgaccctgggcttgg 4351

>gb|AC026179.5|AC026179 Homo sapiens chromosome 3 clone RP11-264H3 map 3p, complete sequence
          Length = 166488

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 192    atgtacttactttacatggat 212
              |||||||||||||||||||||
Sbjct: 152625 atgtacttactttacatggat 152605

>gb|AC066584.6|AC066584 Homo sapiens chromosome 3 clone RP11-244G3 map 3p, complete sequence
          Length = 155825

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 192   atgtacttactttacatggat 212
             |||||||||||||||||||||
Sbjct: 76775 atgtacttactttacatggat 76755

>gb|AC018493.6|AC018493 Homo sapiens chromosome 3 clone RP11-163M22 map 3p, complete sequence
          Length = 180299

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 192    atgtacttactttacatggat 212
              |||||||||||||||||||||
Sbjct: 171146 atgtacttactttacatggat 171166

>gb|AC011327.17|AC011327 Homo sapiens 3 BAC RP11-77I5 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 168812

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 192    atgtacttactttacatggat 212
              |||||||||||||||||||||
Sbjct: 159653 atgtacttactttacatggat 159673

>emb|AL935264.12| Mouse DNA sequence from clone RP23-118A9 on chromosome 4, complete
             sequence
          Length = 230886

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 176   ctgcactttattggggatgta 196
             |||||||||||||||||||||
Sbjct: 26959 ctgcactttattggggatgta 26939

>gb|AC023485.6| Homo sapiens chromosome 3 clone RP11-489D19 map 3p, complete sequence
          Length = 179304

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 192    atgtacttactttacatggat 212
              |||||||||||||||||||||
Sbjct: 100248 atgtacttactttacatggat 100228

>gb|AC153508.2| Mus musculus 10 BAC RP23-233B6 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 190780

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 273    agttccagcctctcagaatg 292
              ||||||||||||||||||||
Sbjct: 140703 agttccagcctctcagaatg 140722

>ref|NM_001017061.2| Xenopus tropicalis hypothetical protein LOC549815 (LOC549815), mRNA
          Length = 1786

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 276 tccagcctctcagaatgacc 295
           ||||||||||||||||||||
Sbjct: 332 tccagcctctcagaatgacc 351

>gb|AY633104.1| Cicurina pallida haplotype TX365 cytochrome oxidase subunit I (COI)
           gene, partial cds; mitochondrial
          Length = 984

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 199 tactttacatggatcttatt 218
           ||||||||||||||||||||
Sbjct: 678 tactttacatggatcttatt 697

>gb|AY633103.1| Cicurina pallida haplotype TX363 cytochrome oxidase subunit I (COI)
           gene, partial cds; mitochondrial
          Length = 966

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 199 tactttacatggatcttatt 218
           ||||||||||||||||||||
Sbjct: 660 tactttacatggatcttatt 679

>gb|AC135239.3| Mus musculus BAC clone RP23-324D2 from chromosome 3, complete sequence
          Length = 190178

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 178   gcactttattggggatgtacttac 201
             |||||| |||||||||||||||||
Sbjct: 91501 gcacttaattggggatgtacttac 91524

>gb|AC110566.17| Mus musculus chromosome 5, clone RP23-300A10, complete sequence
          Length = 175471

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 324   aggagatgtcagttgtcatc 343
             ||||||||||||||||||||
Sbjct: 68168 aggagatgtcagttgtcatc 68149

>emb|AL353744.18| Human DNA sequence from clone RP13-100A9 on chromosome Xq11.2-13.1
             Contains a GrpE-like 2 mitochondrial (E. coli) pseudogene
             and a novel pseudogene, complete sequence
          Length = 131070

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 329   atgtcagttgtcatcttctc 348
             ||||||||||||||||||||
Sbjct: 45557 atgtcagttgtcatcttctc 45538

>gb|AC163212.3| Mus musculus chromosome 3, clone RP24-102O2, complete sequence
          Length = 199319

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 178   gcactttattggggatgtacttac 201
             |||||| |||||||||||||||||
Sbjct: 61943 gcacttaattggggatgtacttac 61966

>gb|DQ174430.1| Diaea sp. JEG-696 cytochrome oxidase subunit I (COI) gene, partial
           cds; mitochondrial
          Length = 820

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 199 tactttacatggatcttatt 218
           ||||||||||||||||||||
Sbjct: 774 tactttacatggatcttatt 793

>gb|DQ174429.1| Diaea sp. JEG-697 cytochrome oxidase subunit I (COI) gene, partial
           cds; mitochondrial
          Length = 820

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 199 tactttacatggatcttatt 218
           ||||||||||||||||||||
Sbjct: 774 tactttacatggatcttatt 793

>gb|DQ174399.1| Diaea sp. JEG-692 cytochrome oxidase subunit I (COI) gene, partial
           cds; mitochondrial
          Length = 820

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 199 tactttacatggatcttatt 218
           ||||||||||||||||||||
Sbjct: 774 tactttacatggatcttatt 793

>gb|DQ174374.1| Misumenops melloleitaio isolate 368 cytochrome oxidase subunit I
           (COI) gene, partial cds; mitochondrial
          Length = 820

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 199 tactttacatggatcttatt 218
           ||||||||||||||||||||
Sbjct: 774 tactttacatggatcttatt 793

>gb|DQ174373.1| Misumenops melloleitaio isolate 484 cytochrome oxidase subunit I
           (COI) gene, partial cds; mitochondrial
          Length = 819

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 199 tactttacatggatcttatt 218
           ||||||||||||||||||||
Sbjct: 773 tactttacatggatcttatt 792

>emb|CR761653.2| Xenopus tropicalis finished cDNA, clone TGas033k12
          Length = 1786

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 276 tccagcctctcagaatgacc 295
           ||||||||||||||||||||
Sbjct: 332 tccagcctctcagaatgacc 351


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,545,180
Number of Sequences: 3902068
Number of extensions: 2545180
Number of successful extensions: 46156
Number of sequences better than 10.0: 28
Number of HSP's better than 10.0 without gapping: 28
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 46075
Number of HSP's gapped (non-prelim): 81
length of query: 365
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 343
effective length of database: 17,147,199,772
effective search space: 5881489521796
effective search space used: 5881489521796
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)