ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl27h05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|CT573098.3| RP43-076G03, complete sequence 44 0.33
2emb|CT573270.1| RP43-049F09, complete sequence 44 0.33
3gb|AC120003.6| Mus musculus chromosome 8, clone RP24-148H22, com... 42 1.3
4gb|AC115484.2| Drosophila melanogaster clone BACR06K01, complete... 42 1.3
5gb|AC124918.5| Rattus norvegicus 4 BAC CH230-4H1 (Children's Hos... 42 1.3
6gb|AC108104.2| Homo sapiens chromosome 5 clone RP11-198P15, comp... 42 1.3
7ref|NM_080191.2| Drosophila melanogaster weckle CG4148-RA (wek),... 42 1.3
8gb|AY051673.1| Drosophila melanogaster LD22579 full length cDNA 42 1.3
9gb|AE003648.2| Drosophila melanogaster chromosome 2L, section 57... 42 1.3
10gb|AY346378.1| Penaeus monodon crustacean hyperglycemic hormone ... 40 5.1
11gb|DQ452367.1| Liriomyza huidobrensis clone 3 heat shock protein... 40 5.1
12gb|DQ452366.1| Liriomyza huidobrensis clone 2 heat shock protein... 40 5.1
13emb|AL356605.20| Human DNA sequence from clone RP11-414G18 on ch... 40 5.1
14gb|AF233295.1| Penaeus monodon crustacean hyperglycemic hormone ... 40 5.1
15emb|AL160154.11| Human DNA sequence from clone RP11-447N10 on ch... 40 5.1
16emb|BX649410.18| Mouse DNA sequence from clone RP23-168C6 on chr... 40 5.1
17gb|AC093886.2| Homo sapiens BAC clone RP11-666L21 from 4, comple... 40 5.1
18gb|AC007467.4|AC007467 Drosophila melanogaster, chromosome 2L, r... 40 5.1
19gb|AC084797.5| Homo sapiens chromosome 16 clone RP11-62O3, compl... 40 5.1
20emb|AL929213.5| Zebrafish DNA sequence from clone CH211-144A19, ... 40 5.1
21emb|AL391703.9| Human DNA sequence from clone RP11-422P8 on chro... 40 5.1
22gb|AE003668.5| Drosophila melanogaster chromosome 2L, section 77... 40 5.1
23gb|AC004759.1|AC004759 Drosophila melanogaster DNA sequence (P1s... 40 5.1
24emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1... 40 5.1
25gb|AE017262.2| Listeria monocytogenes str. 4b F2365, complete ge... 40 5.1

>emb|CT573098.3| RP43-076G03, complete sequence
          Length = 175456

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 152    ttggaaatgaccaaagcccagattat 177
              ||||||||||| ||||||||||||||
Sbjct: 153912 ttggaaatgactaaagcccagattat 153887



to top

>emb|CT573270.1| RP43-049F09, complete sequence
          Length = 165723

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 152   ttggaaatgaccaaagcccagattat 177
             ||||||||||| ||||||||||||||
Sbjct: 65874 ttggaaatgactaaagcccagattat 65849



to top

>gb|AC120003.6| Mus musculus chromosome 8, clone RP24-148H22, complete sequence
          Length = 210466

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 104   aaagggggtaaaaaagacaag 124
             |||||||||||||||||||||
Sbjct: 21247 aaagggggtaaaaaagacaag 21267



to top

>gb|AC115484.2| Drosophila melanogaster clone BACR06K01, complete sequence
          Length = 168504

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 176   atttttgtcaacaaacatggtctaa 200
             |||||||||||| ||||||||||||
Sbjct: 13623 atttttgtcaaccaacatggtctaa 13647



to top

>gb|AC124918.5| Rattus norvegicus 4 BAC CH230-4H1 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 228052

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 259    ggtgttatgtagttcttcccc 279
              |||||||||||||||||||||
Sbjct: 173013 ggtgttatgtagttcttcccc 172993



to top

>gb|AC108104.2| Homo sapiens chromosome 5 clone RP11-198P15, complete sequence
          Length = 96678

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 275   tccccagaagcctctagggtt 295
             |||||||||||||||||||||
Sbjct: 13488 tccccagaagcctctagggtt 13508



to top

>ref|NM_080191.2| Drosophila melanogaster weckle CG4148-RA (wek), mRNA
          Length = 1659

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 176  atttttgtcaacaaacatggtctaa 200
            |||||||||||| ||||||||||||
Sbjct: 1520 atttttgtcaaccaacatggtctaa 1496



to top

>gb|AY051673.1| Drosophila melanogaster LD22579 full length cDNA
          Length = 1677

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 176  atttttgtcaacaaacatggtctaa 200
            |||||||||||| ||||||||||||
Sbjct: 1520 atttttgtcaaccaacatggtctaa 1496



to top

>gb|AE003648.2| Drosophila melanogaster chromosome 2L, section 57 of 83 of the complete
              sequence
          Length = 284900

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 176    atttttgtcaacaaacatggtctaa 200
              |||||||||||| ||||||||||||
Sbjct: 239157 atttttgtcaaccaacatggtctaa 239181



to top

>gb|AY346378.1| Penaeus monodon crustacean hyperglycemic hormone 1 precursor (CHH1)
           gene, complete cds
          Length = 907

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 270 gttcttccccagaagcctct 289
           ||||||||||||||||||||
Sbjct: 175 gttcttccccagaagcctct 194



to top

>gb|DQ452367.1| Liriomyza huidobrensis clone 3 heat shock protein Hsp40 (Hsp40) mRNA,
            partial cds
          Length = 1081

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 110  ggtaaaaaagacaaggaaac 129
            ||||||||||||||||||||
Sbjct: 992  ggtaaaaaagacaaggaaac 1011



to top

>gb|DQ452366.1| Liriomyza huidobrensis clone 2 heat shock protein Hsp40 (Hsp40) mRNA,
            partial cds
          Length = 1325

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 110  ggtaaaaaagacaaggaaac 129
            ||||||||||||||||||||
Sbjct: 993  ggtaaaaaagacaaggaaac 1012



to top

>emb|AL356605.20| Human DNA sequence from clone RP11-414G18 on chromosome 6 Contains part
             of the TCBA1 gene for T-cell lymphoma breakpoint
             associated target 1, complete sequence
          Length = 169493

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 173   attatttttgtcaacaaaca 192
             ||||||||||||||||||||
Sbjct: 68459 attatttttgtcaacaaaca 68478



to top

>gb|AF233295.1| Penaeus monodon crustacean hyperglycemic hormone 1 precursor (CHH1)
           mRNA, complete cds
          Length = 593

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 270 gttcttccccagaagcctct 289
           ||||||||||||||||||||
Sbjct: 175 gttcttccccagaagcctct 194



to top

>emb|AL160154.11| Human DNA sequence from clone RP11-447N10 on chromosome 13 Contains a CpG
              island, complete sequence
          Length = 157379

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 1      cataaatagcattgcatata 20
              ||||||||||||||||||||
Sbjct: 152858 cataaatagcattgcatata 152839



to top

>emb|BX649410.18| Mouse DNA sequence from clone RP23-168C6 on chromosome 4 Contains a
             ribosomal protein S6 (Rps6) pseudogene and a novel gene,
             complete sequence
          Length = 231582

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 298   gttccacactgggtaaaggt 317
             ||||||||||||||||||||
Sbjct: 81134 gttccacactgggtaaaggt 81153



to top

>gb|AC093886.2| Homo sapiens BAC clone RP11-666L21 from 4, complete sequence
          Length = 174332

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 112    taaaaaagacaaggaaacaa 131
              ||||||||||||||||||||
Sbjct: 148456 taaaaaagacaaggaaacaa 148437



to top

>gb|AC007467.4|AC007467 Drosophila melanogaster, chromosome 2L, region 38E-38F, BAC clone
             BACR07D17, complete sequence
          Length = 173422

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 81    ttgtcatcagatgtattcgctcaaaagg 108
             |||||||||||  |||||||||||||||
Sbjct: 77353 ttgtcatcagacctattcgctcaaaagg 77326



to top

>gb|AC084797.5| Homo sapiens chromosome 16 clone RP11-62O3, complete sequence
          Length = 163855

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 152    ttggaaatgaccaaagccca 171
              ||||||||||||||||||||
Sbjct: 103554 ttggaaatgaccaaagccca 103573



to top

>emb|AL929213.5| Zebrafish DNA sequence from clone CH211-144A19, complete sequence
          Length = 169897

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 175   tatttttgtcaacaaacatg 194
             ||||||||||||||||||||
Sbjct: 78890 tatttttgtcaacaaacatg 78909



to top

>emb|AL391703.9| Human DNA sequence from clone RP11-422P8 on chromosome 1 Contains the
             5' end of the GNG12 gene for guanine nucleotide binding
             protein (G protein), gamma 12, the 5' end of a novel gene
             (FLJ38762, FLJ42034) and a CpG island, complete sequence
          Length = 191741

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 121   caaggaaacaagcacgtttagcag 144
             ||||||||||||||||||| ||||
Sbjct: 98968 caaggaaacaagcacgttttgcag 98945



to top

>gb|AE003668.5| Drosophila melanogaster chromosome 2L, section 77 of 83 of the complete
             sequence
          Length = 270158

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 81    ttgtcatcagatgtattcgctcaaaagg 108
             |||||||||||  |||||||||||||||
Sbjct: 67167 ttgtcatcagacctattcgctcaaaagg 67140



to top

>gb|AC004759.1|AC004759 Drosophila melanogaster DNA sequence (P1s DS04217 (D56) and DS00582
             (D85)), complete sequence
          Length = 142799

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 81    ttgtcatcagatgtattcgctcaaaagg 108
             |||||||||||  |||||||||||||||
Sbjct: 12184 ttgtcatcagacctattcgctcaaaagg 12211



to top

>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 2       ataaatagcattgcatatag 21
               ||||||||||||||||||||
Sbjct: 2819035 ataaatagcattgcatatag 2819054



to top

>gb|AE017262.2| Listeria monocytogenes str. 4b F2365, complete genome
          Length = 2905187

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 266     tgtagttcttccccagaagc 285
               ||||||||||||||||||||
Sbjct: 1361884 tgtagttcttccccagaagc 1361865


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,352,199
Number of Sequences: 3902068
Number of extensions: 3352199
Number of successful extensions: 84772
Number of sequences better than 10.0: 25
Number of HSP's better than 10.0 without gapping: 25
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 84714
Number of HSP's gapped (non-prelim): 58
length of query: 383
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 361
effective length of database: 17,147,199,772
effective search space: 6190139117692
effective search space used: 6190139117692
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top