Clone Name | rbastl27g07 |
---|---|
Clone Library Name | barley_pub |
>gb|AC113067.8| Mus musculus chromosome 16, clone RP23-264I14, complete sequence Length = 246802 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 aactacattcacatttcttttcaa 38 ||||| |||||||||||||||||| Sbjct: 160599 aactaaattcacatttcttttcaa 160576
>emb|BX067989.1|CNS09OMH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 815 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 237 cagcaatggccccgacggaa 256 |||||||||||||||||||| Sbjct: 85 cagcaatggccccgacggaa 104
>gb|AC093680.2| Homo sapiens BAC clone RP11-656C2 from 4, complete sequence Length = 150399 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 19 acattcacatttcttttcaa 38 |||||||||||||||||||| Sbjct: 116164 acattcacatttcttttcaa 116145
>gb|DQ355805.1| Trichoplax adhaerens ANTP homeobox protein (Hmx) gene, complete cds Length = 11728 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 22 ttcacatttcttttcaacac 41 |||||||||||||||||||| Sbjct: 1617 ttcacatttcttttcaacac 1598
>ref|NM_068167.2| Caenorhabditis elegans R08C7.10c (R08C7.10) mRNA, complete cds Length = 2219 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 153 tccgaattagcatccgacga 172 |||||||||||||||||||| Sbjct: 124 tccgaattagcatccgacga 105
>ref|NM_068165.2| Caenorhabditis elegans R08C7.10b (R08C7.10) mRNA, complete cds Length = 2328 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 153 tccgaattagcatccgacga 172 |||||||||||||||||||| Sbjct: 104 tccgaattagcatccgacga 85
>ref|NM_068166.2| Caenorhabditis elegans R08C7.10a (R08C7.10) mRNA, complete cds Length = 2463 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 153 tccgaattagcatccgacga 172 |||||||||||||||||||| Sbjct: 23 tccgaattagcatccgacga 4
>gb|U61953.2| Caenorhabditis elegans cosmid R08C7, complete sequence Length = 39012 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 153 tccgaattagcatccgacga 172 |||||||||||||||||||| Sbjct: 24656 tccgaattagcatccgacga 24675
>dbj|AP002453.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-801G16, complete sequence Length = 211345 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 22 ttcacatttcttttcaacac 41 |||||||||||||||||||| Sbjct: 207087 ttcacatttcttttcaacac 207106
>dbj|AP003384.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-35N19, complete sequence Length = 156712 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 22 ttcacatttcttttcaacac 41 |||||||||||||||||||| Sbjct: 75931 ttcacatttcttttcaacac 75950
>dbj|AP002076.3| Homo sapiens genomic DNA, chromosome 4q22-q24, clone:2230N19, complete sequence Length = 117217 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 19 acattcacatttcttttcaa 38 |||||||||||||||||||| Sbjct: 105282 acattcacatttcttttcaa 105263 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,467,207 Number of Sequences: 3902068 Number of extensions: 2467207 Number of successful extensions: 40479 Number of sequences better than 10.0: 11 Number of HSP's better than 10.0 without gapping: 11 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 40468 Number of HSP's gapped (non-prelim): 11 length of query: 347 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 325 effective length of database: 17,147,199,772 effective search space: 5572839925900 effective search space used: 5572839925900 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)