ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl27f12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|M55604.1|WHTUBA1 T.aestivum ubiquitin activating enzyme E1 (U... 109 3e-21
2gb|M90663.1|WHTE1A Wheat ubiquitin activating enzyme (E1) mRNA, ... 109 3e-21
3gb|AE014075.1| Escherichia coli CFT073, complete genome 40 1.9
4gb|CP000243.1| Escherichia coli UTI89, complete genome 40 1.9
5emb|AM236324.1| Escherichia coli genome fragment containing the ... 40 1.9
6gb|AC118208.9| Mus musculus chromosome 18, clone RP24-559H7, com... 38 7.6
7gb|AC121094.8| Mus musculus chromosome 18, clone RP24-322I3, com... 38 7.6
8ref|XM_950949.1| Neurospora crassa OR74A related to 6-phosphofru... 38 7.6
9ref|XM_328166.1| Neurospora crassa OR74A related to 6-phosphofru... 38 7.6
10gb|AC146435.3| Pan troglodytes BAC clone RP43-15P23 from 7, comp... 38 7.6
11gb|AC147331.3| Pan troglodytes BAC clone RP43-10H17 from 7, comp... 38 7.6
12emb|CR788249.6| Zebrafish DNA sequence from clone DKEY-10F21 in ... 38 7.6
13emb|AL353696.8| Human DNA sequence from clone RP11-560G8 on chro... 38 7.6
14emb|AL356833.1|NCB24P11 Neurospora crassa DNA linkage group II B... 38 7.6
15emb|AL356815.1|NCB24H17 Neurospora crassa DNA linkage group II B... 38 7.6
16emb|BX908401.14| Zebrafish DNA sequence from clone DKEY-53F14 in... 38 7.6
17gb|AC134527.5| Mus musculus BAC clone RP24-502D8 from chromosome... 38 7.6
18emb|BX571831.7| Zebrafish DNA sequence from clone DKEY-266J11 in... 38 7.6
19gb|AC006017.2|AC006017 Homo sapiens PAC clone RP5-981O7 from 7q3... 38 7.6
20gb|AC104197.14| Mus musculus chromosome 8, clone RP24-319N16, co... 38 7.6
21emb|AL928909.7| Mouse DNA sequence from clone RP23-320I18 on chr... 38 7.6

>gb|M55604.1|WHTUBA1 T.aestivum ubiquitin activating enzyme E1 (UBA1) gene, complete cds
          Length = 3586

 Score =  109 bits (55), Expect = 3e-21
 Identities = 114/132 (86%), Gaps = 10/132 (7%)
 Strand = Plus / Minus

                                                                        
Query: 37   caattttagttgtaaacgcatcatgcaaca--------gatgatgttgtgcgt-gtcttg 87
            ||||||||| ||||||||||||||||||||        ||||||||||||| | |||| |
Sbjct: 3571 caattttagctgtaaacgcatcatgcaacaattatcaagatgatgttgtgcctagtctcg 3512

                                                                        
Query: 88   tgaatcgtgatgtctggtaacaactccagatcagcccccaatgatccaatcgacatc-ga 146
            |||||| ||||||||||||||||| | |||||||||||||||||||| |||||||||  |
Sbjct: 3511 tgaatcatgatgtctggtaacaacccgagatcagcccccaatgatccgatcgacatcaaa 3452

                        
Query: 147  gatggtagaaag 158
            ||||||||||||
Sbjct: 3451 gatggtagaaag 3440



to top

>gb|M90663.1|WHTE1A Wheat ubiquitin activating enzyme (E1) mRNA, complete cds
          Length = 3695

 Score =  109 bits (55), Expect = 3e-21
 Identities = 110/128 (85%), Gaps = 9/128 (7%)
 Strand = Plus / Minus

                                                                        
Query: 40   ttttagttgtaaacgcatcatgcaaca--------gatgatgttgtgcgt-gtcttgtga 90
            |||||||||| ||||||||||||||||        ||||||||||||| | |||| ||||
Sbjct: 3687 ttttagttgtgaacgcatcatgcaacaattatcaagatgatgttgtgcctagtctcgtga 3628

                                                                        
Query: 91   atcgtgatgtctggtaacaactccagatcagcccccaatgatccaatcgacatcgagatg 150
            || || ||||||||||||||| | |||||||||||||||||||| ||||||||| |||||
Sbjct: 3627 atagttatgtctggtaacaacccgagatcagcccccaatgatccgatcgacatcaagatg 3568

                    
Query: 151  gtagaaag 158
            ||||||||
Sbjct: 3567 gtagaaag 3560



to top

>gb|AE014075.1| Escherichia coli CFT073, complete genome
          Length = 5231428

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 84      cttgtgaatcgtgatgtctg 103
               ||||||||||||||||||||
Sbjct: 2258336 cttgtgaatcgtgatgtctg 2258355



to top

>gb|CP000243.1| Escherichia coli UTI89, complete genome
          Length = 5065741

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 84      cttgtgaatcgtgatgtctg 103
               ||||||||||||||||||||
Sbjct: 2109514 cttgtgaatcgtgatgtctg 2109533



to top

>emb|AM236324.1| Escherichia coli genome fragment containing the yersiniabactin, cob and
             pdu gene clusters, strain A0 34/86
          Length = 84189

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 84    cttgtgaatcgtgatgtctg 103
             ||||||||||||||||||||
Sbjct: 54791 cttgtgaatcgtgatgtctg 54810



to top

>gb|AC118208.9| Mus musculus chromosome 18, clone RP24-559H7, complete sequence
          Length = 164565

 Score = 38.2 bits (19), Expect = 7.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 53     cgcatcatgcaacagatga 71
              |||||||||||||||||||
Sbjct: 150258 cgcatcatgcaacagatga 150276



to top

>gb|AC121094.8| Mus musculus chromosome 18, clone RP24-322I3, complete sequence
          Length = 164629

 Score = 38.2 bits (19), Expect = 7.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 53    cgcatcatgcaacagatga 71
             |||||||||||||||||||
Sbjct: 56157 cgcatcatgcaacagatga 56175



to top

>ref|XM_950949.1| Neurospora crassa OR74A related to 6-phosphofructo-2-kinase [MIPS]
            (NCU01728.1) partial mRNA
          Length = 2415

 Score = 38.2 bits (19), Expect = 7.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 118  tcagcccccaatgatccaatcga 140
            ||||||||||| |||||||||||
Sbjct: 1135 tcagcccccaaggatccaatcga 1157



to top

>ref|XM_328166.1| Neurospora crassa OR74A related to 6-phosphofructo-2-kinase [MIPS]
            (NCU01728.1) partial mRNA
          Length = 2415

 Score = 38.2 bits (19), Expect = 7.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 118  tcagcccccaatgatccaatcga 140
            ||||||||||| |||||||||||
Sbjct: 1135 tcagcccccaaggatccaatcga 1157



to top

>gb|AC146435.3| Pan troglodytes BAC clone RP43-15P23 from 7, complete sequence
          Length = 192805

 Score = 38.2 bits (19), Expect = 7.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 6      acataaaacatgcattcaa 24
              |||||||||||||||||||
Sbjct: 145784 acataaaacatgcattcaa 145766



to top

>gb|AC147331.3| Pan troglodytes BAC clone RP43-10H17 from 7, complete sequence
          Length = 189220

 Score = 38.2 bits (19), Expect = 7.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 6      acataaaacatgcattcaa 24
              |||||||||||||||||||
Sbjct: 110263 acataaaacatgcattcaa 110245



to top

>emb|CR788249.6| Zebrafish DNA sequence from clone DKEY-10F21 in linkage group 2, complete
              sequence
          Length = 202982

 Score = 38.2 bits (19), Expect = 7.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 67     gatgatgttgtgcgtgtcttgtg 89
              ||||||||||| |||||||||||
Sbjct: 112020 gatgatgttgttcgtgtcttgtg 112042



to top

>emb|AL353696.8| Human DNA sequence from clone RP11-560G8 on chromosome 9, complete
             sequence
          Length = 181717

 Score = 38.2 bits (19), Expect = 7.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 6     acataaaacatgcattcaa 24
             |||||||||||||||||||
Sbjct: 26523 acataaaacatgcattcaa 26505



to top

>emb|AL356833.1|NCB24P11 Neurospora crassa DNA linkage group II BAC clone B24P11
          Length = 73184

 Score = 38.2 bits (19), Expect = 7.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 118   tcagcccccaatgatccaatcga 140
             ||||||||||| |||||||||||
Sbjct: 55035 tcagcccccaaggatccaatcga 55057



to top

>emb|AL356815.1|NCB24H17 Neurospora crassa DNA linkage group II BAC clone B24H17
          Length = 82972

 Score = 38.2 bits (19), Expect = 7.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 118   tcagcccccaatgatccaatcga 140
             ||||||||||| |||||||||||
Sbjct: 67245 tcagcccccaaggatccaatcga 67223



to top

>emb|BX908401.14| Zebrafish DNA sequence from clone DKEY-53F14 in linkage group 18,
             complete sequence
          Length = 172346

 Score = 38.2 bits (19), Expect = 7.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 59    atgcaacagatgatgttgt 77
             |||||||||||||||||||
Sbjct: 17226 atgcaacagatgatgttgt 17208



to top

>gb|AC134527.5| Mus musculus BAC clone RP24-502D8 from chromosome 8, complete
            sequence
          Length = 150065

 Score = 38.2 bits (19), Expect = 7.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 38   aattttagttgtaaacgca 56
            |||||||||||||||||||
Sbjct: 6018 aattttagttgtaaacgca 6036



to top

>emb|BX571831.7| Zebrafish DNA sequence from clone DKEY-266J11 in linkage group 18,
              complete sequence
          Length = 195572

 Score = 38.2 bits (19), Expect = 7.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 59     atgcaacagatgatgttgt 77
              |||||||||||||||||||
Sbjct: 173544 atgcaacagatgatgttgt 173526



to top

>gb|AC006017.2|AC006017 Homo sapiens PAC clone RP5-981O7 from 7q34-q36, complete sequence
          Length = 162556

 Score = 38.2 bits (19), Expect = 7.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 98    tgtctggtaacaactccag 116
             |||||||||||||||||||
Sbjct: 75652 tgtctggtaacaactccag 75670



to top

>gb|AC104197.14| Mus musculus chromosome 8, clone RP24-319N16, complete sequence
          Length = 195334

 Score = 38.2 bits (19), Expect = 7.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 38    aattttagttgtaaacgca 56
             |||||||||||||||||||
Sbjct: 45585 aattttagttgtaaacgca 45567



to top

>emb|AL928909.7| Mouse DNA sequence from clone RP23-320I18 on chromosome 2, complete
             sequence
          Length = 187340

 Score = 38.2 bits (19), Expect = 7.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 1     ggtaaacataaaacatgca 19
             |||||||||||||||||||
Sbjct: 60768 ggtaaacataaaacatgca 60750


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,190,172
Number of Sequences: 3902068
Number of extensions: 1190172
Number of successful extensions: 87398
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 87315
Number of HSP's gapped (non-prelim): 80
length of query: 158
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 136
effective length of database: 17,147,199,772
effective search space: 2332019168992
effective search space used: 2332019168992
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top