ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl27d05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_468756.1| Oryza sativa (japonica cultivar-group), mRNA 204 1e-49
2gb|BT016991.1| Zea mays clone EK07D2305A08.c mRNA sequence 186 3e-44
3gb|AY110589.1| Zea mays CL4331_3 mRNA sequence 186 3e-44
4ref|XM_468752.1| Oryza sativa (japonica cultivar-group), mRNA 180 2e-42
5dbj|AK104954.1| Oryza sativa (japonica cultivar-group) cDNA clon... 180 2e-42
6dbj|AK099047.1| Oryza sativa (japonica cultivar-group) cDNA clon... 180 2e-42
7dbj|AK067470.1| Oryza sativa (japonica cultivar-group) cDNA clon... 180 2e-42
8gb|AY109388.1| Zea mays CL4331_2 mRNA sequence 155 1e-34
9gb|AC114983.6| Oryza sativa (japonica cultivar-group) chromosome... 137 2e-29
10gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 137 2e-29
11dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 137 2e-29
12gb|AY496117.1| Capsicum annuum 40S ribosomal protein S19 mRNA, c... 52 0.001
13gb|AY496133.1| Capsicum annuum 40S ribosomal protein S19 mRNA, c... 52 0.001
14gb|DQ241845.1| Solanum tuberosum clone 186F02 40S ribosomal prot... 48 0.016
15gb|DQ104695.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.063
16gb|DQ104694.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.063
17gb|DQ104693.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.063
18gb|DQ104692.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.063
19gb|DQ104691.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.063
20gb|DQ104690.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.063
21gb|DQ104689.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.063
22gb|DQ104688.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.063
23gb|DQ104687.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.063
24gb|DQ104686.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.063
25gb|DQ104675.1| Lycopersicon hirsutum 40S ribosomal protein S19 (... 46 0.063
26gb|DQ104674.1| Lycopersicon hirsutum 40S ribosomal protein S19 (... 46 0.063
27gb|DQ104673.1| Lycopersicon hirsutum 40S ribosomal protein S19 (... 46 0.063
28gb|DQ104672.1| Lycopersicon hirsutum 40S ribosomal protein S19 (... 46 0.063
29gb|DQ104671.1| Lycopersicon hirsutum 40S ribosomal protein S19 (... 46 0.063
30gb|DQ104670.1| Lycopersicon hirsutum 40S ribosomal protein S19 (... 46 0.063
31gb|DQ104669.1| Lycopersicon hirsutum 40S ribosomal protein S19 (... 46 0.063
32gb|DQ104668.1| Lycopersicon hirsutum 40S ribosomal protein S19 (... 46 0.063
33gb|DQ104667.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.063
34gb|DQ104666.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.063
35gb|DQ104665.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.063
36gb|DQ104664.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.063
37gb|DQ104663.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.063
38gb|DQ104662.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.063
39gb|DQ104661.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.063
40gb|DQ104660.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.063
41gb|DQ104659.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.063
42gb|DQ104658.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.063
43gb|DQ104657.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.063
44gb|DQ104656.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.063
45gb|DQ104655.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.063
46gb|DQ104654.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.063
47gb|DQ104653.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.063
48gb|DQ104652.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.063
49gb|DQ104651.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.063
50gb|DQ104650.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.063
51gb|DQ104649.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.063
52gb|DQ104648.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.063
53gb|DQ104647.1| Solanum ochranthum 40S ribosomal protein S19 (CT1... 46 0.063
54gb|AC149197.13| Medicago truncatula clone mth2-33p18, complete s... 42 0.99
55emb|AL161941.18| Human DNA sequence from clone RP11-494B22 on ch... 42 0.99
56gb|AC148395.12| Medicago truncatula clone mth2-28d22, complete s... 42 0.99
57gb|AC013272.5| Homo sapiens BAC clone RP11-401C13 from 2, comple... 42 0.99
58ref|NM_125510.3| Arabidopsis thaliana structural constituent of ... 40 3.9
59ref|XM_535846.2| PREDICTED: Canis familiaris similar to HRAS-lik... 40 3.9
60gb|BT010524.1| Arabidopsis thaliana At5g61170 gene, complete cds 40 3.9
61gb|BC054381.1| Mus musculus cDNA clone IMAGE:6468809, partial cds 40 3.9
62dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 3.9
63dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 3.9
64emb|BX832341.1|CNS09ZKD Arabidopsis thaliana Full-length cDNA Co... 40 3.9
65emb|BX664619.13| Mouse DNA sequence from clone RP23-349B9 on chr... 40 3.9
66dbj|AP002536.2| Oryza sativa (japonica cultivar-group) genomic D... 40 3.9
67dbj|AK175989.1| Arabidopsis thaliana mRNA for 40S ribosomal prot... 40 3.9
68dbj|AP005411.3| Oryza sativa (japonica cultivar-group) genomic D... 40 3.9
69dbj|AP006848.1| Oryza sativa (japonica cultivar-group) genomic D... 40 3.9
70dbj|AB006696.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 3.9
71gb|AC117684.10| Mus musculus chromosome 9, clone RP23-438A6, com... 40 3.9
72gb|AC168063.3| Mus musculus BAC clone RP23-197G3 from chromosome... 40 3.9
73emb|CT009627.9| Mouse DNA sequence from clone RP23-71E4 on chrom... 40 3.9
74gb|DQ104685.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 3.9
75gb|DQ104684.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 3.9
76gb|DQ104683.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 3.9
77gb|DQ104682.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 3.9
78gb|DQ104681.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 3.9
79gb|DQ104680.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 3.9
80gb|DQ104679.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 3.9
81gb|DQ104678.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 3.9
82gb|DQ104677.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 3.9
83gb|DQ104676.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 3.9 
>ref|XM_468756.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 635

 Score =  204 bits (103), Expect = 1e-49
 Identities = 139/151 (92%)
 Strand = Plus / Minus

                                                                       
Query: 148 tggtcaagatcacgccttccctgggaggtgatgagccttccacccttggggtcgacatca 207
           ||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 460 tggtccagatcacgccttccctgggaggtgatgagtcttccacccttcgggtcgacatca 401

                                                                       
Query: 208 atgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttg 267
           ||||||||||||||||||| || ||||||||||||||| || | ||| || |||||||||
Sbjct: 400 atgatgcccatcttctgcagctgctgaaggatgttgcgtgagatagcgccgctgctcttg 341

                                          
Query: 268 cagaagtgtggggggcgtgaaccgttcctct 298
           |||||||| ||||||||||| ||||||||||
Sbjct: 340 cagaagtgcggggggcgtgagccgttcctct 310
to top
>gb|BT016991.1| Zea mays clone EK07D2305A08.c mRNA sequence
          Length = 737

 Score =  186 bits (94), Expect = 3e-44
 Identities = 145/162 (89%)
 Strand = Plus / Minus

                                                                       
Query: 137 ttccagcaacctggtcaagatcacgccttccctgggaggtgatgagccttccacccttgg 196
           ||||||| |||||||| ||||||||||||||||||||||||| | ||| |||||||||||
Sbjct: 488 ttccagccacctggtccagatcacgccttccctgggaggtgaggcgccgtccacccttgg 429

                                                                       
Query: 197 ggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcac 256
           | |||||||||||||||||||||| ||||| || ||| ||||||||||| ||||  ||||
Sbjct: 428 gatcgacatcaatgatgcccatctcctgcagctgctggaggatgttgcgtgaaatggcac 369

                                                     
Query: 257 cactgctcttgcagaagtgtggggggcgtgaaccgttcctct 298
           ||||||||||||||||||| || |||||||| || |||||||
Sbjct: 368 cactgctcttgcagaagtgaggtgggcgtgagccattcctct 327
to top
>gb|AY110589.1| Zea mays CL4331_3 mRNA sequence
          Length = 860

 Score =  186 bits (94), Expect = 3e-44
 Identities = 145/162 (89%)
 Strand = Plus / Plus

                                                                       
Query: 137 ttccagcaacctggtcaagatcacgccttccctgggaggtgatgagccttccacccttgg 196
           ||||||| |||||||| ||||||||||||||||||||||||||| ||| |||||||||||
Sbjct: 387 ttccagccacctggtccagatcacgccttccctgggaggtgatgcgccgtccacccttgg 446

                                                                       
Query: 197 ggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcac 256
           | |||||||||||||||||||||| ||||| || ||| ||||||||||| ||||  ||||
Sbjct: 447 gatcgacatcaatgatgcccatctcctgcagctgctggaggatgttgcgtgaaatggcac 506

                                                     
Query: 257 cactgctcttgcagaagtgtggggggcgtgaaccgttcctct 298
           ||||||||||||||||||| || ||||| || || |||||||
Sbjct: 507 cactgctcttgcagaagtgaggtgggcgggagccattcctct 548
to top
>ref|XM_468752.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 829

 Score =  180 bits (91), Expect = 2e-42
 Identities = 136/151 (90%)
 Strand = Plus / Minus

                                                                       
Query: 148 tggtcaagatcacgccttccctgggaggtgatgagccttccacccttggggtcgacatca 207
           ||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 483 tggtccagatcacgccttccctgggaggtgatgagtcttccgcccttggggtcgacatcg 424

                                                                       
Query: 208 atgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttg 267
           ||||||||||||||||||| || ||||||||||||||| || | ||| || |||||||||
Sbjct: 423 atgatgcccatcttctgcagctgctgaaggatgttgcgtgagatagcgccgctgctcttg 364

                                          
Query: 268 cagaagtgtggggggcgtgaaccgttcctct 298
           |||||||| ||||| ||||| || |||||||
Sbjct: 363 cagaagtgcgggggacgtgagccattcctct 333
to top
>dbj|AK104954.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-045-G11, full
           insert sequence
          Length = 786

 Score =  180 bits (91), Expect = 2e-42
 Identities = 136/151 (90%)
 Strand = Plus / Minus

                                                                       
Query: 148 tggtcaagatcacgccttccctgggaggtgatgagccttccacccttggggtcgacatca 207
           ||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 491 tggtccagatcacgccttccctgggaggtgatgagtcttccgcccttggggtcgacatcg 432

                                                                       
Query: 208 atgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttg 267
           ||||||||||||||||||| || ||||||||||||||| || | ||| || |||||||||
Sbjct: 431 atgatgcccatcttctgcagctgctgaaggatgttgcgtgagatagcgccgctgctcttg 372

                                          
Query: 268 cagaagtgtggggggcgtgaaccgttcctct 298
           |||||||| ||||| ||||| || |||||||
Sbjct: 371 cagaagtgcgggggacgtgagccattcctct 341
to top
>dbj|AK099047.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013147E16, full
           insert sequence
          Length = 937

 Score =  180 bits (91), Expect = 2e-42
 Identities = 136/151 (90%)
 Strand = Plus / Minus

                                                                       
Query: 148 tggtcaagatcacgccttccctgggaggtgatgagccttccacccttggggtcgacatca 207
           ||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 492 tggtccagatcacgccttccctgggaggtgatgagtcttccgcccttggggtcgacatcg 433

                                                                       
Query: 208 atgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttg 267
           ||||||||||||||||||| || ||||||||||||||| || | ||| || |||||||||
Sbjct: 432 atgatgcccatcttctgcagctgctgaaggatgttgcgtgagatagcgccgctgctcttg 373

                                          
Query: 268 cagaagtgtggggggcgtgaaccgttcctct 298
           |||||||| ||||| ||||| || |||||||
Sbjct: 372 cagaagtgcgggggacgtgagccattcctct 342
to top
>dbj|AK067470.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013106H18, full
           insert sequence
          Length = 862

 Score =  180 bits (91), Expect = 2e-42
 Identities = 136/151 (90%)
 Strand = Plus / Minus

                                                                       
Query: 148 tggtcaagatcacgccttccctgggaggtgatgagccttccacccttggggtcgacatca 207
           ||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 494 tggtccagatcacgccttccctgggaggtgatgagtcttccgcccttggggtcgacatcg 435

                                                                       
Query: 208 atgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttg 267
           ||||||||||||||||||| || ||||||||||||||| || | ||| || |||||||||
Sbjct: 434 atgatgcccatcttctgcagctgctgaaggatgttgcgtgagatagcgccgctgctcttg 375

                                          
Query: 268 cagaagtgtggggggcgtgaaccgttcctct 298
           |||||||| ||||| ||||| || |||||||
Sbjct: 374 cagaagtgcgggggacgtgagccattcctct 344
to top
>gb|AY109388.1| Zea mays CL4331_2 mRNA sequence
          Length = 1008

 Score =  155 bits (78), Expect = 1e-34
 Identities = 141/162 (87%)
 Strand = Plus / Plus

                                                                       
Query: 137 ttccagcaacctggtcaagatcacgccttccctgggaggtgatgagccttccacccttgg 196
           ||||||| || ||||| ||||||||||||||||||  ||||||||| | |||||||||||
Sbjct: 223 ttccagccacttggtccagatcacgccttccctggttggtgatgaggcgtccacccttgg 282

                                                                       
Query: 197 ggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcac 256
           | |||||||| |||||||||||  |||||| || ||| ||||||||||| ||||  ||||
Sbjct: 283 gatcgacatcgatgatgcccataatctgcagctgctgcaggatgttgcgtgaaatggcac 342

                                                     
Query: 257 cactgctcttgcagaagtgtggggggcgtgaaccgttcctct 298
           |||||||||||||||||||||| ||||| || || |||||||
Sbjct: 343 cactgctcttgcagaagtgtggtgggcgggagccattcctct 384
to top
>gb|AC114983.6| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0032H19
             map E30331S, complete sequence
          Length = 164820

 Score =  137 bits (69), Expect = 2e-29
 Identities = 99/109 (90%)
 Strand = Plus / Plus

                                                                         
Query: 190   cccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaa 249
             ||||| ||||||||||||||||||||||||||||||| || ||||||||||||||| || 
Sbjct: 23077 cccttcgggtcgacatcaatgatgcccatcttctgcagctgctgaaggatgttgcgtgag 23136

                                                              
Query: 250   acagcaccactgctcttgcagaagtgtggggggcgtgaaccgttcctct 298
             | ||| || ||||||||||||||||| ||||||||||| ||||||||||
Sbjct: 23137 atagcgccgctgctcttgcagaagtgcggggggcgtgagccgttcctct 23185



 Score =  121 bits (61), Expect = 1e-24
 Identities = 97/109 (88%)
 Strand = Plus / Plus

                                                                         
Query: 190   cccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaa 249
             ||||||||||||||||| ||||||||||||||||||| || ||||||||||||||| || 
Sbjct: 35214 cccttggggtcgacatcgatgatgcccatcttctgcagctgctgaaggatgttgcgtgag 35273

                                                              
Query: 250   acagcaccactgctcttgcagaagtgtggggggcgtgaaccgttcctct 298
             | ||| || ||||||||||||||||| ||||| ||||| || |||||||
Sbjct: 35274 atagcgccgctgctcttgcagaagtgcgggggacgtgagccattcctct 35322



 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 41/43 (95%)
 Strand = Plus / Plus

                                                        
Query: 148   tggtcaagatcacgccttccctgggaggtgatgagccttccac 190
             ||||| ||||||||||||||||||||||||||||| |||||||
Sbjct: 22951 tggtccagatcacgccttccctgggaggtgatgagtcttccac 22993



 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                      
Query: 148   tggtcaagatcacgccttccctgggaggtgatgagccttcc 188
             ||||| ||||||||||||||||||||||||||||| |||||
Sbjct: 35094 tggtccagatcacgccttccctgggaggtgatgagtcttcc 35134
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  137 bits (69), Expect = 2e-29
 Identities = 99/109 (90%)
 Strand = Plus / Minus

                                                                            
Query: 190      cccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaa 249
                ||||| ||||||||||||||||||||||||||||||| || ||||||||||||||| || 
Sbjct: 17540666 cccttcgggtcgacatcaatgatgcccatcttctgcagctgctgaaggatgttgcgtgag 17540607

                                                                 
Query: 250      acagcaccactgctcttgcagaagtgtggggggcgtgaaccgttcctct 298
                | ||| || ||||||||||||||||| ||||||||||| ||||||||||
Sbjct: 17540606 atagcgccgctgctcttgcagaagtgcggggggcgtgagccgttcctct 17540558



 Score =  121 bits (61), Expect = 1e-24
 Identities = 97/109 (88%)
 Strand = Plus / Minus

                                                                            
Query: 190      cccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaa 249
                ||||||||||||||||| ||||||||||||||||||| || ||||||||||||||| || 
Sbjct: 17528529 cccttggggtcgacatcgatgatgcccatcttctgcagctgctgaaggatgttgcgtgag 17528470

                                                                 
Query: 250      acagcaccactgctcttgcagaagtgtggggggcgtgaaccgttcctct 298
                | ||| || ||||||||||||||||| ||||| ||||| || |||||||
Sbjct: 17528469 atagcgccgctgctcttgcagaagtgcgggggacgtgagccattcctct 17528421



 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                           
Query: 148      tggtcaagatcacgccttccctgggaggtgatgagccttccac 190
                ||||| ||||||||||||||||||||||||||||| |||||||
Sbjct: 17540792 tggtccagatcacgccttccctgggaggtgatgagtcttccac 17540750



 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                         
Query: 148      tggtcaagatcacgccttccctgggaggtgatgagccttcc 188
                ||||| ||||||||||||||||||||||||||||| |||||
Sbjct: 17528649 tggtccagatcacgccttccctgggaggtgatgagtcttcc 17528609
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  137 bits (69), Expect = 2e-29
 Identities = 99/109 (90%)
 Strand = Plus / Minus

                                                                            
Query: 190      cccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaa 249
                ||||| ||||||||||||||||||||||||||||||| || ||||||||||||||| || 
Sbjct: 17534207 cccttcgggtcgacatcaatgatgcccatcttctgcagctgctgaaggatgttgcgtgag 17534148

                                                                 
Query: 250      acagcaccactgctcttgcagaagtgtggggggcgtgaaccgttcctct 298
                | ||| || ||||||||||||||||| ||||||||||| ||||||||||
Sbjct: 17534147 atagcgccgctgctcttgcagaagtgcggggggcgtgagccgttcctct 17534099



 Score =  121 bits (61), Expect = 1e-24
 Identities = 97/109 (88%)
 Strand = Plus / Minus

                                                                            
Query: 190      cccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaa 249
                ||||||||||||||||| ||||||||||||||||||| || ||||||||||||||| || 
Sbjct: 17522070 cccttggggtcgacatcgatgatgcccatcttctgcagctgctgaaggatgttgcgtgag 17522011

                                                                 
Query: 250      acagcaccactgctcttgcagaagtgtggggggcgtgaaccgttcctct 298
                | ||| || ||||||||||||||||| ||||| ||||| || |||||||
Sbjct: 17522010 atagcgccgctgctcttgcagaagtgcgggggacgtgagccattcctct 17521962



 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                           
Query: 148      tggtcaagatcacgccttccctgggaggtgatgagccttccac 190
                ||||| ||||||||||||||||||||||||||||| |||||||
Sbjct: 17534333 tggtccagatcacgccttccctgggaggtgatgagtcttccac 17534291



 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                         
Query: 148      tggtcaagatcacgccttccctgggaggtgatgagccttcc 188
                ||||| ||||||||||||||||||||||||||||| |||||
Sbjct: 17522190 tggtccagatcacgccttccctgggaggtgatgagtcttcc 17522150
to top
>gb|AY496117.1| Capsicum annuum 40S ribosomal protein S19 mRNA, complete sequence
          Length = 672

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 74/90 (82%)
 Strand = Plus / Minus

                                                                       
Query: 183 ccttccacccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgtt 242
           ||||||||||||||| || |  || ||||||  |||  |||||| || ||||||||||| 
Sbjct: 417 ccttccacccttgggttcaaagtcgatgatgttcatggtctgcagctgctgaaggatgtg 358

                                         
Query: 243 gcgggaaacagcaccactgctcttgcagaa 272
           ||| | ||| | ||||||||||||||||||
Sbjct: 357 gcgtgcaactgaaccactgctcttgcagaa 328
to top
>gb|AY496133.1| Capsicum annuum 40S ribosomal protein S19 mRNA, complete cds
          Length = 398

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 74/90 (82%)
 Strand = Plus / Minus

                                                                       
Query: 183 ccttccacccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgtt 242
           ||||||||||||||| || |  || ||||||  |||  |||||| || ||||||||||| 
Sbjct: 119 ccttccacccttgggttcaaagtcgatgatgttcatggtctgcagctgctgaaggatgtg 60

                                         
Query: 243 gcgggaaacagcaccactgctcttgcagaa 272
           ||| | ||| | ||||||||||||||||||
Sbjct: 59  gcgtgcaactgaaccactgctcttgcagaa 30
to top
>gb|DQ241845.1| Solanum tuberosum clone 186F02 40S ribosomal protein S19-like mRNA,
           complete cds
          Length = 759

 Score = 48.1 bits (24), Expect = 0.016
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 221 tctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaa 272
           ||||||| | ||||||||||| ||| | ||| | ||||||||||||||||||
Sbjct: 380 tctgcaattgctgaaggatgtggcgtgcaactgaaccactgctcttgcagaa 329
to top
>gb|DQ104695.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7277b allele, partial cds
          Length = 1409

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104694.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7277a allele, partial cds
          Length = 1410

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 776 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 717

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 716 ttgcaaaagtg 706
to top
>gb|DQ104693.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7276b allele, partial cds
          Length = 1411

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 777 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 718

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 717 ttgcaaaagtg 707
to top
>gb|DQ104692.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7276a allele, partial cds
          Length = 1412

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104691.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7275b allele, partial cds
          Length = 1412

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104690.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7275a allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104689.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7274b allele, partial cds
          Length = 1412

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104688.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7274a allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104687.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7272b allele, partial cds
          Length = 1412

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104686.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7272a allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104675.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene,
           CT189-7223b allele, partial cds
          Length = 1398

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104674.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene,
           CT189-7223a allele, partial cds
          Length = 1398

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104673.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene,
           CT189-7219b allele, partial cds
          Length = 1398

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104672.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene,
           CT189-7219a allele, partial cds
          Length = 1398

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104671.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene,
           CT189-7216b allele, partial cds
          Length = 1398

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104670.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene,
           CT189-7216a allele, partial cds
          Length = 1398

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104669.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene,
           CT189-7215b allele, partial cds
          Length = 1398

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104668.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene,
           CT189-7215a allele, partial cds
          Length = 1398

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104667.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7184b allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104666.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7184a allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104665.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7183b allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104664.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7183a allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104663.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7180b allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104662.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7180a allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104661.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7179b allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104660.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7179a allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104659.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7177b allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104658.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7177a allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104657.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7236b allele, partial cds
          Length = 1408

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104656.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7236a allele, partial cds
          Length = 1408

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104655.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7235b allele, partial cds
          Length = 1408

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104654.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7235a allele, partial cds
          Length = 1411

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 781 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 722

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 721 ttgcaaaagtg 711
to top
>gb|DQ104653.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7234b allele, partial cds
          Length = 1408

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104652.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7234a allele, partial cds
          Length = 1402

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104651.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7233b allele, partial cds
          Length = 1410

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104650.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7233a allele, partial cds
          Length = 1408

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104649.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7232b allele, partial cds
          Length = 1408

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104648.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7232a allele, partial cds
          Length = 1408

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104647.1| Solanum ochranthum 40S ribosomal protein S19 (CT189) gene, partial
           cds
          Length = 1543

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 264
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 776 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 717

                      
Query: 265 ttgcagaagtg 275
           ||||| |||||
Sbjct: 716 ttgcaaaagtg 706
to top
>gb|AC149197.13| Medicago truncatula clone mth2-33p18, complete sequence
          Length = 115362

 Score = 42.1 bits (21), Expect = 0.99
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 252   agcaccactgctcttgcagaa 272
             |||||||||||||||||||||
Sbjct: 53651 agcaccactgctcttgcagaa 53671
to top
>emb|AL161941.18| Human DNA sequence from clone RP11-494B22 on chromosome 20 Contains the
             PPIP11 gene for peptidylprolyl isomerase (cyclophilin)
             pseudogene 11 and a CpG island, complete sequence
          Length = 81304

 Score = 42.1 bits (21), Expect = 0.99
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 53    ataattcaaaactgtagccaa 73
             |||||||||||||||||||||
Sbjct: 34162 ataattcaaaactgtagccaa 34142
to top
>gb|AC148395.12| Medicago truncatula clone mth2-28d22, complete sequence
          Length = 116174

 Score = 42.1 bits (21), Expect = 0.99
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 252   agcaccactgctcttgcagaa 272
             |||||||||||||||||||||
Sbjct: 62524 agcaccactgctcttgcagaa 62504
to top
>gb|AC013272.5| Homo sapiens BAC clone RP11-401C13 from 2, complete sequence
          Length = 172705

 Score = 42.1 bits (21), Expect = 0.99
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 258  actgctcttgcagaagtgtgg 278
            |||||||||||||||||||||
Sbjct: 2468 actgctcttgcagaagtgtgg 2488
to top
>ref|NM_125510.3| Arabidopsis thaliana structural constituent of ribosome AT5G61170
           mRNA, complete cds
          Length = 645

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 249 aacagcaccactgctcttgcagaa 272
           |||| |||||||||||||||||||
Sbjct: 359 aacaccaccactgctcttgcagaa 336
to top
>ref|XM_535846.2| PREDICTED: Canis familiaris similar to HRAS-like suppressor
           (LOC478677), mRNA
          Length = 694

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 223 tgcaactcctgaaggatgttgcgggaaa 250
           ||||||| ||||||||||||| ||||||
Sbjct: 244 tgcaactgctgaaggatgttgtgggaaa 271
to top
>gb|BT010524.1| Arabidopsis thaliana At5g61170 gene, complete cds
          Length = 432

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 249 aacagcaccactgctcttgcagaa 272
           |||| |||||||||||||||||||
Sbjct: 300 aacaccaccactgctcttgcagaa 277
to top
>gb|BC054381.1| Mus musculus cDNA clone IMAGE:6468809, partial cds
          Length = 7392

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 252  agcaccactgctcttgcaga 271
            ||||||||||||||||||||
Sbjct: 2817 agcaccactgctcttgcaga 2798
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 29       cataacaaacacagggaggg 48
                ||||||||||||||||||||
Sbjct: 28400536 cataacaaacacagggaggg 28400555
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 254     caccactgctcttgcagaag 273
               ||||||||||||||||||||
Sbjct: 3306778 caccactgctcttgcagaag 3306759
to top
>emb|BX832341.1|CNS09ZKD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH66ZF08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 645

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 249 aacagcaccactgctcttgcagaa 272
           |||| |||||||||||||||||||
Sbjct: 359 aacaccaccactgctcttgcagaa 336
to top
>emb|BX664619.13| Mouse DNA sequence from clone RP23-349B9 on chromosome 11, complete
             sequence
          Length = 154608

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 29    cataacaaacacagggaggg 48
             ||||||||||||||||||||
Sbjct: 27471 cataacaaacacagggaggg 27452
to top
>dbj|AP002536.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0015I14
          Length = 150650

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   caccactgctcttgcagaag 273
             ||||||||||||||||||||
Sbjct: 94141 caccactgctcttgcagaag 94122
to top
>dbj|AK175989.1| Arabidopsis thaliana mRNA for 40S ribosomal protein S19 - like,
           complete cds, clone: RAFL22-68-D20
          Length = 737

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 249 aacagcaccactgctcttgcagaa 272
           |||| |||||||||||||||||||
Sbjct: 370 aacaccaccactgctcttgcagaa 347
to top
>dbj|AP005411.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OSJNBa0044E16
          Length = 153296

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 29     cataacaaacacagggaggg 48
              ||||||||||||||||||||
Sbjct: 129342 cataacaaacacagggaggg 129361
to top
>dbj|AP006848.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8,
            fosmid clone:OSJNOa199K18
          Length = 39582

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 29   cataacaaacacagggaggg 48
            ||||||||||||||||||||
Sbjct: 5338 cataacaaacacagggaggg 5357
to top
>dbj|AB006696.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAF19
          Length = 78379

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 249   aacagcaccactgctcttgcagaa 272
             |||| |||||||||||||||||||
Sbjct: 60721 aacaccaccactgctcttgcagaa 60698
to top
>gb|AC117684.10| Mus musculus chromosome 9, clone RP23-438A6, complete sequence
          Length = 196053

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 166    ccctgggaggtgatgagcct 185
              ||||||||||||||||||||
Sbjct: 127161 ccctgggaggtgatgagcct 127180
to top
>gb|AC168063.3| Mus musculus BAC clone RP23-197G3 from chromosome 17, complete sequence
          Length = 213263

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 252   agcaccactgctcttgcaga 271
             ||||||||||||||||||||
Sbjct: 85787 agcaccactgctcttgcaga 85768
to top
>emb|CT009627.9| Mouse DNA sequence from clone RP23-71E4 on chromosome 16, complete
              sequence
          Length = 257276

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 252    agcaccactgctcttgcaga 271
              ||||||||||||||||||||
Sbjct: 168365 agcaccactgctcttgcaga 168384
to top
>gb|DQ104685.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7206b allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 220 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 275
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104684.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7206a allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 220 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 275
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104683.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7205b allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 220 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 275
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104682.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7205a allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 220 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 275
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104681.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7204b allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 220 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 275
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104680.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7204a allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 220 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 275
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104679.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7203b allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 220 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 275
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104678.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7203a allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 220 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 275
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104677.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7201b allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 220 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 275
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104676.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7201a allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 220 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 275
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,683,148
Number of Sequences: 3902068
Number of extensions: 2683148
Number of successful extensions: 49885
Number of sequences better than 10.0: 83
Number of HSP's better than 10.0 without gapping: 83
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 49730
Number of HSP's gapped (non-prelim): 153
length of query: 298
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 276
effective length of database: 17,147,199,772
effective search space: 4732627137072
effective search space used: 4732627137072
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top