>gb|AC102454.7| Mus musculus chromosome 5, clone RP24-296L13, complete sequence
          Length = 149588

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 123  gaatgcattccaatccatcc 142
            ||||||||||||||||||||
Sbjct: 2571 gaatgcattccaatccatcc 2552

>gb|AC117206.3| Mus musculus BAC clone RP23-260L17 from 5, complete sequence
          Length = 183385

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 123    gaatgcattccaatccatcc 142
              ||||||||||||||||||||
Sbjct: 156496 gaatgcattccaatccatcc 156477

>emb|Z97989.1|HS66H14 Human DNA sequence from clone RP1-66H14 on chromosome 6q21-22 Contains
             the 3' end of the FYN gene for the FYN oncogene related to
             SRC, FGR, YES and the 5' end of the C6orf5 gene for
             chromosome 6 open reading frame 5 (NFkB-activating protein
             ACT1, connection to IKK and SAPK/JNK, chromosome 6 open
             reading frame 6) (C6orf5)(ACT1, CIKS, C6ORF6,
             DKFZP586G0522)(contains FLJ22949), complete sequence
          Length = 155937

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 38    cctgttgttgaaaaccatac 57
             ||||||||||||||||||||
Sbjct: 74644 cctgttgttgaaaaccatac 74663

>emb|BX571708.4| Zebrafish DNA sequence from clone DKEYP-74B2, complete sequence
          Length = 193197

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 221    gtagagtatatgcatgcatc 240
              ||||||||||||||||||||
Sbjct: 146680 gtagagtatatgcatgcatc 146661

>gb|AC073427.7| Homo sapiens BAC clone RP11-746K19 from 4, complete sequence
          Length = 157152

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 216   gcaaagtagagtatatgcat 235
             ||||||||||||||||||||
Sbjct: 62713 gcaaagtagagtatatgcat 62694

>emb|BX247887.6| Zebrafish DNA sequence from clone CH211-142L10, complete sequence
          Length = 143903

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 45    ttgaaaaccatacaaaattc 64
             ||||||||||||||||||||
Sbjct: 77084 ttgaaaaccatacaaaattc 77065

>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome
          Length = 3052398

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 233     catgcatcacggggtccggcttgagctg 260
               |||||||||||||| |||||| ||||||
Sbjct: 2472283 catgcatcacggggcccggctcgagctg 2472256

>emb|AL929457.12| Zebrafish DNA sequence from clone CH211-153I8 in linkage group 14,
             complete sequence
          Length = 164299

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 221   gtagagtatatgcatgcatc 240
             ||||||||||||||||||||
Sbjct: 64354 gtagagtatatgcatgcatc 64335


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,314,296
Number of Sequences: 3902068
Number of extensions: 3314296
Number of successful extensions: 63818
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 63800
Number of HSP's gapped (non-prelim): 18
length of query: 351
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 329
effective length of database: 17,147,199,772
effective search space: 5641428724988
effective search space used: 5641428724988
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)