ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl27b10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AE017263.1| Mesoplasma florum L1 complete genome 42 0.94
2gb|AC163338.5| Mus musculus BAC clone RP24-574A13 from chromosom... 40 3.7
3gb|AC104645.8| Homo sapiens chromosome 3 clone CTD-2011M13, comp... 40 3.7
4ref|XM_755998.1| Ustilago maydis 521 hypothetical protein (UM049... 40 3.7
5ref|XM_724386.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 3.7
6ref|XM_675227.1| Plasmodium berghei strain ANKA hypothetical pro... 40 3.7
7gb|AC164426.5| Mus musculus BAC clone RP24-320I19 from chromosom... 40 3.7
8dbj|AK052044.1| Mus musculus 12 days embryo eyeball cDNA, RIKEN ... 40 3.7

>gb|AE017263.1| Mesoplasma florum L1 complete genome
          Length = 793224

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 16   aattaacaaacgatcaaaaca 36
            |||||||||||||||||||||
Sbjct: 2383 aattaacaaacgatcaaaaca 2403



to top

>gb|AC163338.5| Mus musculus BAC clone RP24-574A13 from chromosome 13, complete
            sequence
          Length = 149507

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 56   ttttcattgactgaagagca 75
            ||||||||||||||||||||
Sbjct: 7119 ttttcattgactgaagagca 7138



to top

>gb|AC104645.8| Homo sapiens chromosome 3 clone CTD-2011M13, complete sequence
          Length = 153595

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 189   caatgatttccctctcacat 208
             ||||||||||||||||||||
Sbjct: 89092 caatgatttccctctcacat 89073



to top

>ref|XM_755998.1| Ustilago maydis 521 hypothetical protein (UM04944.1) partial mRNA
          Length = 4794

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 74   cagcacaacacgctcgcttg 93
            ||||||||||||||||||||
Sbjct: 3152 cagcacaacacgctcgcttg 3133



to top

>ref|XM_724386.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY01684)
            partial mRNA
          Length = 2322

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 15   aaattaacaaacgatcaaaa 34
            ||||||||||||||||||||
Sbjct: 1510 aaattaacaaacgatcaaaa 1529



to top

>ref|XM_675227.1| Plasmodium berghei strain ANKA hypothetical protein
          (PB001205.00.0) partial mRNA
          Length = 333

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 14 caaattaacaaacgatcaaa 33
          ||||||||||||||||||||
Sbjct: 27 caaattaacaaacgatcaaa 46



to top

>gb|AC164426.5| Mus musculus BAC clone RP24-320I19 from chromosome 13, complete
             sequence
          Length = 160268

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 56    ttttcattgactgaagagca 75
             ||||||||||||||||||||
Sbjct: 47250 ttttcattgactgaagagca 47231



to top

>dbj|AK052044.1| Mus musculus 12 days embryo eyeball cDNA, RIKEN full-length enriched
            library, clone:D230039H11 product:unclassifiable, full
            insert sequence
          Length = 3938

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 56   ttttcattgactgaagagca 75
            ||||||||||||||||||||
Sbjct: 2860 ttttcattgactgaagagca 2879


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,034,914
Number of Sequences: 3902068
Number of extensions: 2034914
Number of successful extensions: 33795
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 33783
Number of HSP's gapped (non-prelim): 12
length of query: 285
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 263
effective length of database: 17,147,199,772
effective search space: 4509713540036
effective search space used: 4509713540036
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top