>gb|AC128644.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0009F15,
              complete sequence
          Length = 142289

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 312    tttcacctgctccaagcttct 332
              |||||||||||||||||||||
Sbjct: 130210 tttcacctgctccaagcttct 130190

>gb|AC138006.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0066O12, complete sequence
          Length = 22258

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 312   tttcacctgctccaagcttct 332
             |||||||||||||||||||||
Sbjct: 21608 tttcacctgctccaagcttct 21628

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 312     tttcacctgctccaagcttct 332
               |||||||||||||||||||||
Sbjct: 4478847 tttcacctgctccaagcttct 4478827

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 312     tttcacctgctccaagcttct 332
               |||||||||||||||||||||
Sbjct: 4487541 tttcacctgctccaagcttct 4487521

>gb|BC116614.1| Danio rerio opsin 4 (melanopsin), mRNA (cDNA clone MGC:136728
            IMAGE:7043557), complete cds
          Length = 3218

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 348  gggaaggctttgcttggagg 367
            ||||||||||||||||||||
Sbjct: 1594 gggaaggctttgcttggagg 1613

>emb|Z73102.1|CEB0035 Caenorhabditis elegans Cosmid B0035, complete sequence
          Length = 39483

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 164   gatgactgaatgaaattgtatagt 187
             ||||||||||||||||||| ||||
Sbjct: 22593 gatgactgaatgaaattgtgtagt 22570

>ref|NM_178289.2| Danio rerio opsin 4 (melanopsin) (opn4), mRNA
          Length = 1668

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 348  gggaaggctttgcttggagg 367
            ||||||||||||||||||||
Sbjct: 1507 gggaaggctttgcttggagg 1526

>emb|CR354549.7| Zebrafish DNA sequence from clone CH211-151O16 in linkage group 25,
             complete sequence
          Length = 136578

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 180   tgtatagtaatgtacagtgc 199
             ||||||||||||||||||||
Sbjct: 68728 tgtatagtaatgtacagtgc 68709

>gb|AC105123.4| Homo sapiens chromosome 15, clone RP11-94B17, complete sequence
          Length = 134569

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 209   cacccaccaaaagaaatccc 228
             ||||||||||||||||||||
Sbjct: 63819 cacccaccaaaagaaatccc 63838

>emb|BX323807.8| Zebrafish DNA sequence from clone DKEY-154P10 in linkage group 2,
              complete sequence
          Length = 194313

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 348    gggaaggctttgcttggagg 367
              ||||||||||||||||||||
Sbjct: 168120 gggaaggctttgcttggagg 168101

>gb|AC092156.2| Homo sapiens BAC clone RP11-326J14 from 2, complete sequence
          Length = 168610

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 35     ctgctaataaattacagatg 54
              ||||||||||||||||||||
Sbjct: 106362 ctgctaataaattacagatg 106343

>gb|AY078161.1| Danio rerio melanopsin mRNA, complete cds
          Length = 1668

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 348  gggaaggctttgcttggagg 367
            ||||||||||||||||||||
Sbjct: 1507 gggaaggctttgcttggagg 1526


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,329,439
Number of Sequences: 3902068
Number of extensions: 3329439
Number of successful extensions: 57682
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 57621
Number of HSP's gapped (non-prelim): 61
length of query: 392
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 370
effective length of database: 17,147,199,772
effective search space: 6344463915640
effective search space used: 6344463915640
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)