ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl27b03
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_470521.1| Oryza sativa (japonica cultivar-group), mRNA 117 3e-23
2gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 117 3e-23
3gb|AC092263.7| Oryza sativa chromosome 3 BAC OSJNBa0033P04 genom... 117 3e-23
4dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 117 3e-23
5dbj|AK066909.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 3e-23
6gb|BT016860.1| Zea mays clone Contig693 mRNA sequence 66 1e-07
7gb|AY106183.1| Zea mays PCO125954 mRNA sequence 66 1e-07
8dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 44 0.40
9emb|AL591784.1|SME591784 Sinorhizobium meliloti 1021 complete ch... 42 1.6
10gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome 42 1.6
11gb|AC092490.10| Homo sapiens 12 BAC RP11-20D14 (Roswell Park Can... 42 1.6
12gb|AC099645.11| Mus musculus chromosome 15, clone RP23-426G4, co... 40 6.2
13gb|AC159404.1| Trypanosoma brucei chromosome 8 clone RPCI93-10K1... 40 6.2
14gb|DQ232586.1| Rhodobacter sphaeroides 2.4.1 plasmid A, partial ... 40 6.2
15gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 40 6.2
16gb|CP000071.1| Trypanosoma brucei chromosome 8, complete sequence 40 6.2
17gb|AC163008.9| Mus musculus chromosome 15, clone RP23-105P11, co... 40 6.2
18gb|AC156249.2| Xenopus tropicalis clone ISB1-238C22, complete se... 40 6.2
19emb|AL353900.14| Human DNA sequence from clone RP11-202C2 on chr... 40 6.2
20emb|CR626927.1| Bacteroides fragilis NCTC 9343, complete genome 40 6.2
21gb|AC074011.5| Homo sapiens BAC clone RP11-780J6 from 2, complet... 40 6.2
22dbj|AP006841.1| Bacteroides fragilis YCH46 DNA, complete genome 40 6.2
23emb|BX248985.6| Zebrafish DNA sequence from clone CH211-192N18 i... 40 6.2
24emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 40 6.2
25gb|L03778.1|TRBNRKAI Trypanosoma brucei protein kinase (nrkA) al... 40 6.2 
>ref|XM_470521.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 3145

 Score =  117 bits (59), Expect = 3e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                        
Query: 107  gctagtctgtcttgaatctgtgcacaaacttctccaggccgtctttgcagtcctccacta 166
            |||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
Sbjct: 2809 gctagtctgtcttgaatctgtgtacaaacttctccaggccctctttgcagtcctccacca 2750

                               
Query: 167  ccttcttcgacttgtcccc 185
            || |||||||||| |||||
Sbjct: 2749 ccctcttcgacttatcccc 2731



 Score =  111 bits (56), Expect = 2e-21
 Identities = 143/172 (83%)
 Strand = Plus / Minus

                                                                        
Query: 290  ttgagatcaaggacctcacatactgcattactctctccagggcatggctggatcggactt 349
            ||||||| || |||||||||| ||| |||||||||||||||| |||||  || |||||||
Sbjct: 2605 ttgagatgaaagacctcacatgctgtattactctctccagggaatggcaagaccggactt 2546

                                                                        
Query: 350  tcatctcaccagcaaacgacttgagcttctccagcagggactccgcccggttgattgcct 409
            | |||||| |||  |  ||||| |||||||||||||  ||| | || ||||| ||||| |
Sbjct: 2545 ttatctcagcagacattgacttcagcttctccagcaaagacccagctcggttaattgctt 2486

                                                                
Query: 410  cgtcagctgggtgttctttgccagcattagcccatgtcactccggccgatgc 461
            ||||| || | ||||||||||||||||| |||||||| ||||| || |||||
Sbjct: 2485 cgtcaacttgatgttctttgccagcattggcccatgtgactccagctgatgc 2434



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                
Query: 208  gcttctgatgacagcttctttgcctttgaggctgcagcagccccaagatctg 259
            ||||| ||||||| ||||||||||||  | |||||||||||||| |||||||
Sbjct: 2696 gcttcggatgacaacttctttgccttcaaagctgcagcagcccctagatctg 2645
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  117 bits (59), Expect = 3e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                            
Query: 107      gctagtctgtcttgaatctgtgcacaaacttctccaggccgtctttgcagtcctccacta 166
                |||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
Sbjct: 36097454 gctagtctgtcttgaatctgtgtacaaacttctccaggccctctttgcagtcctccacca 36097395

                                   
Query: 167      ccttcttcgacttgtcccc 185
                || |||||||||| |||||
Sbjct: 36097394 ccctcttcgacttatcccc 36097376



 Score =  111 bits (56), Expect = 2e-21
 Identities = 143/172 (83%)
 Strand = Plus / Minus

                                                                            
Query: 290      ttgagatcaaggacctcacatactgcattactctctccagggcatggctggatcggactt 349
                ||||||| || |||||||||| ||| |||||||||||||||| |||||  || |||||||
Sbjct: 36097250 ttgagatgaaagacctcacatgctgtattactctctccagggaatggcaagaccggactt 36097191

                                                                            
Query: 350      tcatctcaccagcaaacgacttgagcttctccagcagggactccgcccggttgattgcct 409
                | |||||| |||  |  ||||| |||||||||||||  ||| | || ||||| ||||| |
Sbjct: 36097190 ttatctcagcagacattgacttcagcttctccagcaaagacccagctcggttaattgctt 36097131

                                                                    
Query: 410      cgtcagctgggtgttctttgccagcattagcccatgtcactccggccgatgc 461
                ||||| || | ||||||||||||||||| |||||||| ||||| || |||||
Sbjct: 36097130 cgtcaacttgatgttctttgccagcattggcccatgtgactccagctgatgc 36097079



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                    
Query: 208      gcttctgatgacagcttctttgcctttgaggctgcagcagccccaagatctg 259
                ||||| ||||||| ||||||||||||  | |||||||||||||| |||||||
Sbjct: 36097341 gcttcggatgacaacttctttgccttcaaagctgcagcagcccctagatctg 36097290
to top
>gb|AC092263.7| Oryza sativa chromosome 3 BAC OSJNBa0033P04 genomic sequence, complete
              sequence
          Length = 164179

 Score =  117 bits (59), Expect = 3e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                          
Query: 107    gctagtctgtcttgaatctgtgcacaaacttctccaggccgtctttgcagtcctccacta 166
              |||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
Sbjct: 158965 gctagtctgtcttgaatctgtgtacaaacttctccaggccctctttgcagtcctccacca 158906

                                 
Query: 167    ccttcttcgacttgtcccc 185
              || |||||||||| |||||
Sbjct: 158905 ccctcttcgacttatcccc 158887



 Score =  111 bits (56), Expect = 2e-21
 Identities = 143/172 (83%)
 Strand = Plus / Minus

                                                                          
Query: 290    ttgagatcaaggacctcacatactgcattactctctccagggcatggctggatcggactt 349
              ||||||| || |||||||||| ||| |||||||||||||||| |||||  || |||||||
Sbjct: 158761 ttgagatgaaagacctcacatgctgtattactctctccagggaatggcaagaccggactt 158702

                                                                          
Query: 350    tcatctcaccagcaaacgacttgagcttctccagcagggactccgcccggttgattgcct 409
              | |||||| |||  |  ||||| |||||||||||||  ||| | || ||||| ||||| |
Sbjct: 158701 ttatctcagcagacattgacttcagcttctccagcaaagacccagctcggttaattgctt 158642

                                                                  
Query: 410    cgtcagctgggtgttctttgccagcattagcccatgtcactccggccgatgc 461
              ||||| || | ||||||||||||||||| |||||||| ||||| || |||||
Sbjct: 158641 cgtcaacttgatgttctttgccagcattggcccatgtgactccagctgatgc 158590



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                  
Query: 208    gcttctgatgacagcttctttgcctttgaggctgcagcagccccaagatctg 259
              ||||| ||||||| ||||||||||||  | |||||||||||||| |||||||
Sbjct: 158852 gcttcggatgacaacttctttgccttcaaagctgcagcagcccctagatctg 158801
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  117 bits (59), Expect = 3e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                            
Query: 107      gctagtctgtcttgaatctgtgcacaaacttctccaggccgtctttgcagtcctccacta 166
                |||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
Sbjct: 36187528 gctagtctgtcttgaatctgtgtacaaacttctccaggccctctttgcagtcctccacca 36187469

                                   
Query: 167      ccttcttcgacttgtcccc 185
                || |||||||||| |||||
Sbjct: 36187468 ccctcttcgacttatcccc 36187450



 Score =  111 bits (56), Expect = 2e-21
 Identities = 143/172 (83%)
 Strand = Plus / Minus

                                                                            
Query: 290      ttgagatcaaggacctcacatactgcattactctctccagggcatggctggatcggactt 349
                ||||||| || |||||||||| ||| |||||||||||||||| |||||  || |||||||
Sbjct: 36187324 ttgagatgaaagacctcacatgctgtattactctctccagggaatggcaagaccggactt 36187265

                                                                            
Query: 350      tcatctcaccagcaaacgacttgagcttctccagcagggactccgcccggttgattgcct 409
                | |||||| |||  |  ||||| |||||||||||||  ||| | || ||||| ||||| |
Sbjct: 36187264 ttatctcagcagacattgacttcagcttctccagcaaagacccagctcggttaattgctt 36187205

                                                                    
Query: 410      cgtcagctgggtgttctttgccagcattagcccatgtcactccggccgatgc 461
                ||||| || | ||||||||||||||||| |||||||| ||||| || |||||
Sbjct: 36187204 cgtcaacttgatgttctttgccagcattggcccatgtgactccagctgatgc 36187153



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                    
Query: 208      gcttctgatgacagcttctttgcctttgaggctgcagcagccccaagatctg 259
                ||||| ||||||| ||||||||||||  | |||||||||||||| |||||||
Sbjct: 36187415 gcttcggatgacaacttctttgccttcaaagctgcagcagcccctagatctg 36187364
to top
>dbj|AK066909.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091E19, full
            insert sequence
          Length = 3145

 Score =  117 bits (59), Expect = 3e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                        
Query: 107  gctagtctgtcttgaatctgtgcacaaacttctccaggccgtctttgcagtcctccacta 166
            |||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
Sbjct: 2896 gctagtctgtcttgaatctgtgtacaaacttctccaggccctctttgcagtcctccacca 2837

                               
Query: 167  ccttcttcgacttgtcccc 185
            || |||||||||| |||||
Sbjct: 2836 ccctcttcgacttatcccc 2818



 Score =  111 bits (56), Expect = 2e-21
 Identities = 143/172 (83%)
 Strand = Plus / Minus

                                                                        
Query: 290  ttgagatcaaggacctcacatactgcattactctctccagggcatggctggatcggactt 349
            ||||||| || |||||||||| ||| |||||||||||||||| |||||  || |||||||
Sbjct: 2692 ttgagatgaaagacctcacatgctgtattactctctccagggaatggcaagaccggactt 2633

                                                                        
Query: 350  tcatctcaccagcaaacgacttgagcttctccagcagggactccgcccggttgattgcct 409
            | |||||| |||  |  ||||| |||||||||||||  ||| | || ||||| ||||| |
Sbjct: 2632 ttatctcagcagacattgacttcagcttctccagcaaagacccagctcggttaattgctt 2573

                                                                
Query: 410  cgtcagctgggtgttctttgccagcattagcccatgtcactccggccgatgc 461
            ||||| || | ||||||||||||||||| |||||||| ||||| || |||||
Sbjct: 2572 cgtcaacttgatgttctttgccagcattggcccatgtgactccagctgatgc 2521



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                
Query: 208  gcttctgatgacagcttctttgcctttgaggctgcagcagccccaagatctg 259
            ||||| ||||||| ||||||||||||  | |||||||||||||| |||||||
Sbjct: 2783 gcttcggatgacaacttctttgccttcaaagctgcagcagcccctagatctg 2732
to top
>gb|BT016860.1| Zea mays clone Contig693 mRNA sequence
          Length = 1508

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 69/81 (85%)
 Strand = Plus / Plus

                                                                       
Query: 369 cttgagcttctccagcagggactccgcccggttgattgcctcgtcagctgggtgttcttt 428
           |||||||||||||||||| |  || ||| ||||||| | ||||||  ||| || ||||||
Sbjct: 525 cttgagcttctccagcagagcttctgcctggttgatagactcgtcgactgcgttttcttt 584

                                
Query: 429 gccagcattagcccatgtcac 449
           |||||| ||||||||||||||
Sbjct: 585 gccagcgttagcccatgtcac 605



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 64/75 (85%)
 Strand = Plus / Plus

                                                                       
Query: 108 ctagtctgtcttgaatctgtgcacaaacttctccaggccgtctttgcagtcctccactac 167
           |||||||||||||||||||||   || | ||||||||||||| ||||| || |||| | |
Sbjct: 243 ctagtctgtcttgaatctgtgtgaaatcctctccaggccgtccttgcactcttccattgc 302

                          
Query: 168 cttcttcgacttgtc 182
           | |||||||||||||
Sbjct: 303 cctcttcgacttgtc 317



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 298 aaggacctcacatactgcattactctctcca 328
           ||||||||||||| |||||| ||||||||||
Sbjct: 454 aaggacctcacatgctgcatcactctctcca 484
to top
>gb|AY106183.1| Zea mays PCO125954 mRNA sequence
          Length = 663

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 369 cttgagcttctccagcagggactccgcccggttgattgcctcgtcagctgggtgttcttt 428
           |||||||||||||||||| |  || ||| ||||||| | ||||||  ||| || ||||||
Sbjct: 183 cttgagcttctccagcagagcttctgcctggttgatagactcgtcgactgcgttttcttt 124

                                
Query: 429 gccagcattagcccatgtcac 449
           |||||| ||||||||||||||
Sbjct: 123 gccagcgttagcccatgtcac 103



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 64/75 (85%)
 Strand = Plus / Minus

                                                                       
Query: 108 ctagtctgtcttgaatctgtgcacaaacttctccaggccgtctttgcagtcctccactac 167
           |||||||||||||||||||||   || | ||||||||||||| ||||| || |||| | |
Sbjct: 465 ctagtctgtcttgaatctgtgtgaaatcctctccaggccgtccttgcactcttccattgc 406

                          
Query: 168 cttcttcgacttgtc 182
           | |||||||||||||
Sbjct: 405 cctcttcgacttgtc 391



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 298 aaggacctcacatactgcattactctctcca 328
           ||||||||||||| |||||| ||||||||||
Sbjct: 254 aaggacctcacatgctgcatcactctctcca 224
to top
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 189    gcttgaacccaacgccttcgct 210
              ||||||||||||||||||||||
Sbjct: 299531 gcttgaacccaacgccttcgct 299552
to top
>emb|AL591784.1|SME591784 Sinorhizobium meliloti 1021 complete chromosome; segment 3/12
          Length = 300000

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 369   cttgagcttctccagcaggga 389
             |||||||||||||||||||||
Sbjct: 98186 cttgagcttctccagcaggga 98206
to top
>gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome
          Length = 3304561

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 366   cgacttgagcttctccagcag 386
             |||||||||||||||||||||
Sbjct: 14213 cgacttgagcttctccagcag 14193
to top
>gb|AC092490.10| Homo sapiens 12 BAC RP11-20D14 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 173911

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 263   acccttgcgccgctccctcct 283
             |||||||||||||||||||||
Sbjct: 95093 acccttgcgccgctccctcct 95073
to top
>gb|AC099645.11| Mus musculus chromosome 15, clone RP23-426G4, complete sequence
          Length = 208095

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 368    acttgagcttctccagcagg 387
              ||||||||||||||||||||
Sbjct: 102618 acttgagcttctccagcagg 102599
to top
>gb|AC159404.1| Trypanosoma brucei chromosome 8 clone RPCI93-10K10, complete sequence
          Length = 182660

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      tagcacaagctgccacaaaa 21
              ||||||||||||||||||||
Sbjct: 157464 tagcacaagctgccacaaaa 157483
to top
>gb|DQ232586.1| Rhodobacter sphaeroides 2.4.1 plasmid A, partial sequence
          Length = 114045

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggcttgagatcaaggacctc 306
             ||||||||||||||||||||
Sbjct: 63789 ggcttgagatcaaggacctc 63770
to top
>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome
          Length = 6438405

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 367     gacttgagcttctccagcag 386
               ||||||||||||||||||||
Sbjct: 6418428 gacttgagcttctccagcag 6418447
to top
>gb|CP000071.1| Trypanosoma brucei chromosome 8, complete sequence
          Length = 2481190

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 2       tagcacaagctgccacaaaa 21
               ||||||||||||||||||||
Sbjct: 2000721 tagcacaagctgccacaaaa 2000702
to top
>gb|AC163008.9| Mus musculus chromosome 15, clone RP23-105P11, complete sequence
          Length = 211071

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 368    acttgagcttctccagcagg 387
              ||||||||||||||||||||
Sbjct: 186237 acttgagcttctccagcagg 186256
to top
>gb|AC156249.2| Xenopus tropicalis clone ISB1-238C22, complete sequence
          Length = 75318

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 116   tcttgaatctgtgcacaaac 135
             ||||||||||||||||||||
Sbjct: 67355 tcttgaatctgtgcacaaac 67336
to top
>emb|AL353900.14| Human DNA sequence from clone RP11-202C2 on chromosome 10 Contains part
             of the gene for VPS10 domain receptor protein SORCS 3
             (SORCS3), complete sequence
          Length = 158737

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 81    aaggcatgaaaagctcccta 100
             ||||||||||||||||||||
Sbjct: 63751 aaggcatgaaaagctcccta 63770
to top
>emb|CR626927.1| Bacteroides fragilis NCTC 9343, complete genome
          Length = 5205140

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 33      gtttcttgtctctttggctg 52
               ||||||||||||||||||||
Sbjct: 4623273 gtttcttgtctctttggctg 4623292
to top
>gb|AC074011.5| Homo sapiens BAC clone RP11-780J6 from 2, complete sequence
          Length = 180465

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 138   ctccaggccgtctttgcagt 157
             ||||||||||||||||||||
Sbjct: 74089 ctccaggccgtctttgcagt 74070
to top
>dbj|AP006841.1| Bacteroides fragilis YCH46 DNA, complete genome
          Length = 5277274

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 33      gtttcttgtctctttggctg 52
               ||||||||||||||||||||
Sbjct: 4700754 gtttcttgtctctttggctg 4700773
to top
>emb|BX248985.6| Zebrafish DNA sequence from clone CH211-192N18 in linkage group 12,
             complete sequence
          Length = 167140

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 32    ggtttcttgtctctttggct 51
             ||||||||||||||||||||
Sbjct: 70308 ggtttcttgtctctttggct 70289
to top
>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence
          Length = 3716413

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 367    gacttgagcttctccagcag 386
              ||||||||||||||||||||
Sbjct: 202438 gacttgagcttctccagcag 202419
to top
>gb|L03778.1|TRBNRKAI Trypanosoma brucei protein kinase (nrkA) alleles nrkA-1 and nrkA-2
            mRNAs, complete cds
          Length = 2364

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    tagcacaagctgccacaaaa 21
            ||||||||||||||||||||
Sbjct: 2102 tagcacaagctgccacaaaa 2083


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,199,707
Number of Sequences: 3902068
Number of extensions: 4199707
Number of successful extensions: 114282
Number of sequences better than 10.0: 25
Number of HSP's better than 10.0 without gapping: 25
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 114126
Number of HSP's gapped (non-prelim): 154
length of query: 461
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 439
effective length of database: 17,147,199,772
effective search space: 7527620699908
effective search space used: 7527620699908
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top