ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl26h12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL132641.3|CNS01DT6 Human chromosome 14 DNA sequence BAC C-3... 44 0.12
2gb|AC161241.18| Medicago truncatula clone mth2-193c3, complete s... 40 1.9
3gb|AC135409.3| Rattus norvegicus 8 BAC CH230-416D7 (Children's H... 38 7.5
4ref|NM_153223.2| Homo sapiens coiled-coil domain containing 100 ... 38 7.5
5gb|AC126431.3| Mus musculus BAC clone RP24-407P8 from chromosome... 38 7.5
6gb|AY197700.1| Trichoplusia ni ascovirus 2a putative major capsi... 38 7.5
7emb|BX648687.1|HSM808838 Homo sapiens mRNA; cDNA DKFZp686H2338 (... 38 7.5
8emb|AL590392.5| Human DNA sequence from clone RP11-453D21 on chr... 38 7.5
9dbj|AK093409.1| Homo sapiens cDNA FLJ36090 fis, clone TESTI2020510 38 7.5
10gb|AC087847.6| Homo sapiens chromosome 8, clone RP11-353D5, comp... 38 7.5
11gb|AC084250.6| Homo sapiens chromosome 8, clone RP11-89F14, comp... 38 7.5
12gb|AC010369.7| Homo sapiens chromosome 5 clone CTD-2048F20, comp... 38 7.5
13emb|AL844591.6| Mouse DNA sequence from clone RP23-414J11 on chr... 38 7.5
14gb|AC011897.10| Homo sapiens BAC clone RP11-314E10 from 2, compl... 38 7.5
15gb|AC011545.4|AC011545 Homo sapiens chromosome 19, cosmid R30477... 38 7.5
16gb|AF235093.1|AF235093 Homo sapiens chromosome 21 map 21q21 clon... 38 7.5
17dbj|BS000022.1| Pan troglodytes chromosome 22 clone:PTB-131J13, ... 38 7.5
18emb|AL163210.2|HS21C010 Homo sapiens chromosome 21 segment HS21C010 38 7.5
19gb|AC154174.2| Ornithorhynchus anatinus chromosome UNK clone OAB... 38 7.5
20gb|AC173482.1| Mus musculus BAC clone RP23-383F20 from chromosom... 38 7.5
21emb|AL109762.3|HSM24152 Homo sapiens chromosome 21 sequence from... 38 7.5

>emb|AL132641.3|CNS01DT6 Human chromosome 14 DNA sequence BAC C-3175A2 of library CalTech-D from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 136603

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 6     aattcatgtaatatacagtcta 27
             ||||||||||||||||||||||
Sbjct: 49539 aattcatgtaatatacagtcta 49560



to top

>gb|AC161241.18| Medicago truncatula clone mth2-193c3, complete sequence
          Length = 125129

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 75    tcctcacttttgaggttttc 94
             ||||||||||||||||||||
Sbjct: 90566 tcctcacttttgaggttttc 90547



to top

>gb|AC135409.3| Rattus norvegicus 8 BAC CH230-416D7 (Children's Hospital Oakland
            Research Institute Rat (BN/SsNHsd/MCW) BAC library)
            complete sequence
          Length = 231716

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 67   aagttccatcctcacttttgagg 89
            ||||||||||| |||||||||||
Sbjct: 8771 aagttccatccacacttttgagg 8793



to top

>ref|NM_153223.2| Homo sapiens coiled-coil domain containing 100 (CCDC100), mRNA
          Length = 4677

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 75   tcctcacttttgaggtttt 93
            |||||||||||||||||||
Sbjct: 3117 tcctcacttttgaggtttt 3099



to top

>gb|AC126431.3| Mus musculus BAC clone RP24-407P8 from chromosome 6, complete sequence
          Length = 144924

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 77     ctcacttttgaggttttca 95
              |||||||||||||||||||
Sbjct: 119072 ctcacttttgaggttttca 119054



to top

>gb|AY197700.1| Trichoplusia ni ascovirus 2a putative major capsid protein gene,
            complete cds
          Length = 3808

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 32   tcgacaaaggtatagctag 50
            |||||||||||||||||||
Sbjct: 2625 tcgacaaaggtatagctag 2607



to top

>emb|BX648687.1|HSM808838 Homo sapiens mRNA; cDNA DKFZp686H2338 (from clone DKFZp686H2338)
          Length = 3040

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 75   tcctcacttttgaggtttt 93
            |||||||||||||||||||
Sbjct: 1544 tcctcacttttgaggtttt 1526



to top

>emb|AL590392.5| Human DNA sequence from clone RP11-453D21 on chromosome 6, complete
             sequence
          Length = 104011

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 74    atcctcacttttgaggttt 92
             |||||||||||||||||||
Sbjct: 72578 atcctcacttttgaggttt 72560



to top

>dbj|AK093409.1| Homo sapiens cDNA FLJ36090 fis, clone TESTI2020510
          Length = 2341

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 75   tcctcacttttgaggtttt 93
            |||||||||||||||||||
Sbjct: 1837 tcctcacttttgaggtttt 1819



to top

>gb|AC087847.6| Homo sapiens chromosome 8, clone RP11-353D5, complete sequence
          Length = 170722

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 81    cttttgaggttttcaacca 99
             |||||||||||||||||||
Sbjct: 45610 cttttgaggttttcaacca 45592



to top

>gb|AC084250.6| Homo sapiens chromosome 8, clone RP11-89F14, complete sequence
          Length = 151889

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 81    cttttgaggttttcaacca 99
             |||||||||||||||||||
Sbjct: 66272 cttttgaggttttcaacca 66290



to top

>gb|AC010369.7| Homo sapiens chromosome 5 clone CTD-2048F20, complete sequence
          Length = 160459

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 75    tcctcacttttgaggtttt 93
             |||||||||||||||||||
Sbjct: 93162 tcctcacttttgaggtttt 93180



to top

>emb|AL844591.6| Mouse DNA sequence from clone RP23-414J11 on chromosome 2, complete
              sequence
          Length = 215003

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 4      agaattcatgtaatataca 22
              |||||||||||||||||||
Sbjct: 177766 agaattcatgtaatataca 177784



to top

>gb|AC011897.10| Homo sapiens BAC clone RP11-314E10 from 2, complete sequence
          Length = 200223

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 75    tcctcacttttgaggtttt 93
             |||||||||||||||||||
Sbjct: 91472 tcctcacttttgaggtttt 91454



to top

>gb|AC011545.4|AC011545 Homo sapiens chromosome 19, cosmid R30477 (LLNL-R_266D1), complete
             sequence
          Length = 38611

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 64    ttcaagttccatcctcact 82
             |||||||||||||||||||
Sbjct: 15764 ttcaagttccatcctcact 15782



to top

>gb|AF235093.1|AF235093 Homo sapiens chromosome 21 map 21q21 clone PAC P704-39J11, complete
             sequence
          Length = 161121

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 6     aattcatgtaatatacagt 24
             |||||||||||||||||||
Sbjct: 76649 aattcatgtaatatacagt 76667



to top

>dbj|BS000022.1| Pan troglodytes chromosome 22 clone:PTB-131J13, map 22, complete
              sequences
          Length = 214189

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 6      aattcatgtaatatacagt 24
              |||||||||||||||||||
Sbjct: 104954 aattcatgtaatatacagt 104972



to top

>emb|AL163210.2|HS21C010 Homo sapiens chromosome 21 segment HS21C010
          Length = 340000

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 6      aattcatgtaatatacagt 24
              |||||||||||||||||||
Sbjct: 280406 aattcatgtaatatacagt 280424



to top

>gb|AC154174.2| Ornithorhynchus anatinus chromosome UNK clone OABb-224A1, complete
              sequence
          Length = 125740

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 72     ccatcctcacttttgaggt 90
              |||||||||||||||||||
Sbjct: 104205 ccatcctcacttttgaggt 104187



to top

>gb|AC173482.1| Mus musculus BAC clone RP23-383F20 from chromosome 14, complete sequence
          Length = 216037

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 84     ttgaggttttcaaccagca 102
              |||||||||||||||||||
Sbjct: 108591 ttgaggttttcaaccagca 108609



to top

>emb|AL109762.3|HSM24152 Homo sapiens chromosome 21 sequence from PAC RPCI-1 152M24 map 21q21
             region D21S189-LA297, complete sequence
          Length = 116137

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 6     aattcatgtaatatacagt 24
             |||||||||||||||||||
Sbjct: 38241 aattcatgtaatatacagt 38259


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,103,112
Number of Sequences: 3902068
Number of extensions: 1103112
Number of successful extensions: 74022
Number of sequences better than 10.0: 22
Number of HSP's better than 10.0 without gapping: 22
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 73990
Number of HSP's gapped (non-prelim): 32
length of query: 156
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 134
effective length of database: 17,147,199,772
effective search space: 2297724769448
effective search space used: 2297724769448
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top