Clone Name | rbastl26g10 |
---|---|
Clone Library Name | barley_pub |
>gb|AC102454.7| Mus musculus chromosome 5, clone RP24-296L13, complete sequence Length = 149588 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 gaatgcattccaatccatcc 170 |||||||||||||||||||| Sbjct: 2571 gaatgcattccaatccatcc 2552
>gb|AC144522.12| Homo sapiens 12 BAC RP11-481J8 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 163515 Score = 40.1 bits (20), Expect = 5.4 Identities = 26/28 (92%) Strand = Plus / Plus Query: 372 ctgagcctgcaagatgccccagacccag 399 ||||||||||||||| ||||| |||||| Sbjct: 74477 ctgagcctgcaagatcccccacacccag 74504
>gb|AC117206.3| Mus musculus BAC clone RP23-260L17 from 5, complete sequence Length = 183385 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 gaatgcattccaatccatcc 170 |||||||||||||||||||| Sbjct: 156496 gaatgcattccaatccatcc 156477
>gb|BC032672.2| Homo sapiens hydrogen voltage-gated channel 1, mRNA (cDNA clone MGC:44899 IMAGE:5577070), complete cds Length = 2196 Score = 40.1 bits (20), Expect = 5.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 372 ctgagcctgcaagatgccccagacccag 399 ||||||||||||||| ||||| |||||| Sbjct: 431 ctgagcctgcaagatcccccacacccag 404
>emb|Z98743.1|HS181C9 Human DNA sequence from clone RP1-181C9 on chromosome 22q13.2-13.33, complete sequence Length = 92472 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 382 aagatgccccagacccagag 401 |||||||||||||||||||| Sbjct: 76670 aagatgccccagacccagag 76689
>emb|Z97989.1|HS66H14 Human DNA sequence from clone RP1-66H14 on chromosome 6q21-22 Contains the 3' end of the FYN gene for the FYN oncogene related to SRC, FGR, YES and the 5' end of the C6orf5 gene for chromosome 6 open reading frame 5 (NFkB-activating protein ACT1, connection to IKK and SAPK/JNK, chromosome 6 open reading frame 6) (C6orf5)(ACT1, CIKS, C6ORF6, DKFZP586G0522)(contains FLJ22949), complete sequence Length = 155937 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 66 cctgttgttgaaaaccatac 85 |||||||||||||||||||| Sbjct: 74644 cctgttgttgaaaaccatac 74663
>emb|BX571708.4| Zebrafish DNA sequence from clone DKEYP-74B2, complete sequence Length = 193197 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 249 gtagagtatatgcatgcatc 268 |||||||||||||||||||| Sbjct: 146680 gtagagtatatgcatgcatc 146661
>dbj|AB204937.1| Gryllus bimaculatus satellite DNA, clone: pUGBH-95 Length = 535 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 365 tatttttctgagcctgcaagatgc 388 ||||||||||||| |||||||||| Sbjct: 502 tatttttctgagcttgcaagatgc 525
>dbj|AB204920.1| Gryllus bimaculatus satellite DNA, clone: pUGBH-24 Length = 535 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 365 tatttttctgagcctgcaagatgc 388 ||||||||||||| |||||||||| Sbjct: 502 tatttttctgagcttgcaagatgc 525
>gb|AC073427.7| Homo sapiens BAC clone RP11-746K19 from 4, complete sequence Length = 157152 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 244 gcaaagtagagtatatgcat 263 |||||||||||||||||||| Sbjct: 62713 gcaaagtagagtatatgcat 62694
>dbj|AK042265.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A630076K24 product:retinoblastoma binding protein 7, full insert sequence Length = 1801 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 368 ttttctgagcctgcaagatg 387 |||||||||||||||||||| Sbjct: 1578 ttttctgagcctgcaagatg 1559
>emb|BX247887.6| Zebrafish DNA sequence from clone CH211-142L10, complete sequence Length = 143903 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 73 ttgaaaaccatacaaaattc 92 |||||||||||||||||||| Sbjct: 77084 ttgaaaaccatacaaaattc 77065
>emb|AL929457.12| Zebrafish DNA sequence from clone CH211-153I8 in linkage group 14, complete sequence Length = 164299 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 249 gtagagtatatgcatgcatc 268 |||||||||||||||||||| Sbjct: 64354 gtagagtatatgcatgcatc 64335
>emb|AL672123.16| Mouse DNA sequence from clone RP23-436I3 on chromosome X, complete sequence Length = 219385 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 368 ttttctgagcctgcaagatg 387 |||||||||||||||||||| Sbjct: 162191 ttttctgagcctgcaagatg 162210 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,823,569 Number of Sequences: 3902068 Number of extensions: 3823569 Number of successful extensions: 72523 Number of sequences better than 10.0: 14 Number of HSP's better than 10.0 without gapping: 14 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 72504 Number of HSP's gapped (non-prelim): 19 length of query: 401 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 379 effective length of database: 17,147,199,772 effective search space: 6498788713588 effective search space used: 6498788713588 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)