ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl26f05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC019216.9|AC019216 Homo sapiens BAC clone RP11-484N11 from 4... 44 0.30
2gb|AC140845.2| Mus musculus BAC clone RP24-386C13 from chromosom... 42 1.2
3emb|AL590439.12| Human DNA sequence from clone RP11-394I23 on ch... 42 1.2
4emb|AL590425.10| Human DNA sequence from clone RP11-102N5 on chr... 42 1.2
5emb|BX255949.3| Zebrafish DNA sequence from clone DKEY-76F5 in l... 42 1.2
6gb|AC018360.16| Homo sapiens 3 BAC RP11-67D16 (Roswell Park Canc... 40 4.6
7gb|AC146683.11| Medicago truncatula clone mth2-179n10, complete ... 40 4.6
8emb|AL358934.19| Human DNA sequence from clone RP11-459D20 on ch... 40 4.6
9emb|AL109749.22|HSA213H19 Human DNA sequence from clone RP6-213H... 40 4.6
10emb|BX537296.9| Zebrafish DNA sequence from clone DKEYP-86D4 in ... 40 4.6
11gb|AC011031.12| Homo sapiens chromosome 8, clone RP11-345I19, co... 40 4.6
12gb|AC105221.3| Homo sapiens chromosome 18, clone RP11-480N3, com... 40 4.6
13gb|AC040965.8| Homo sapiens chromosome 8, clone RP11-481K20, com... 40 4.6
14emb|BX465199.9| Zebrafish DNA sequence from clone DKEY-84I7 in l... 40 4.6
15dbj|AP001376.5| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 4.6
16emb|AL844212.8| Mouse DNA sequence from clone RP23-29B20 on chro... 40 4.6

>gb|AC019216.9|AC019216 Homo sapiens BAC clone RP11-484N11 from 4, complete sequence
          Length = 160858

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 120    catcaaagaaaattacgagatcttgt 145
              |||||||||||||||| |||||||||
Sbjct: 100333 catcaaagaaaattacaagatcttgt 100358



to top

>gb|AC140845.2| Mus musculus BAC clone RP24-386C13 from chromosome 8, complete sequence
          Length = 153426

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 69    taaatacatggcaattgtcttgaaattgaaatc 101
             |||||||||||| | |||||||||| |||||||
Sbjct: 71990 taaatacatggccaatgtcttgaaaatgaaatc 71958



to top

>emb|AL590439.12| Human DNA sequence from clone RP11-394I23 on chromosome 10 Contains a
             novel gene (FLJ13397) (CARP) and a CpG island, complete
             sequence
          Length = 192044

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 85    gtcttgaaattgaaatcaatttacaacaa 113
             ||||||||| ||||||||||| |||||||
Sbjct: 12215 gtcttgaaactgaaatcaattaacaacaa 12187



to top

>emb|AL590425.10| Human DNA sequence from clone RP11-102N5 on chromosome X Contains the
             gene for a novel protein and three CpG islands, complete
             sequence
          Length = 63771

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 69    taaatacatggcaattgtctt 89
             |||||||||||||||||||||
Sbjct: 44142 taaatacatggcaattgtctt 44162



to top

>emb|BX255949.3| Zebrafish DNA sequence from clone DKEY-76F5 in linkage group 2,
             complete sequence
          Length = 214484

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 82    attgtcttgaaattgaaatca 102
             |||||||||||||||||||||
Sbjct: 16556 attgtcttgaaattgaaatca 16536



to top

>gb|AC018360.16| Homo sapiens 3 BAC RP11-67D16 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 179993

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 20    ttgaacaatttgtaacctct 39
             ||||||||||||||||||||
Sbjct: 90399 ttgaacaatttgtaacctct 90380



to top

>gb|AC146683.11| Medicago truncatula clone mth2-179n10, complete sequence
          Length = 131133

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 88     ttgaaattgaaatcaattta 107
              ||||||||||||||||||||
Sbjct: 113492 ttgaaattgaaatcaattta 113511



to top

>emb|AL358934.19| Human DNA sequence from clone RP11-459D20 on chromosome 9 Contains a
             transcription factor IIA small 12 kDa subunit (GTF2A2)
             pseudogene, complete sequence
          Length = 95922

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 81    aattgtcttgaaattgaaat 100
             ||||||||||||||||||||
Sbjct: 46012 aattgtcttgaaattgaaat 46031



to top

>emb|AL109749.22|HSA213H19 Human DNA sequence from clone RP6-213H19 on chromosome Xq25-26.3
             Contains the gene for Mst3 and SOK1-related kinase (MST4),
             LOC90167 gene and a CpG island, complete sequence
          Length = 138902

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 20    ttgaacaatttgtaacctct 39
             ||||||||||||||||||||
Sbjct: 88879 ttgaacaatttgtaacctct 88898



to top

>emb|BX537296.9| Zebrafish DNA sequence from clone DKEYP-86D4 in linkage group 14,
             complete sequence
          Length = 203251

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 111   caacatttgcatcaaagaaa 130
             ||||||||||||||||||||
Sbjct: 12452 caacatttgcatcaaagaaa 12471



to top

>gb|AC011031.12| Homo sapiens chromosome 8, clone RP11-345I19, complete sequence
          Length = 183771

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 96     gaaatcaatttacaacaaca 115
              ||||||||||||||||||||
Sbjct: 114785 gaaatcaatttacaacaaca 114766



to top

>gb|AC105221.3| Homo sapiens chromosome 18, clone RP11-480N3, complete sequence
          Length = 165396

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 87   cttgaaattgaaatcaattt 106
            ||||||||||||||||||||
Sbjct: 9711 cttgaaattgaaatcaattt 9730



to top

>gb|AC040965.8| Homo sapiens chromosome 8, clone RP11-481K20, complete sequence
          Length = 189188

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 112   aacatttgcatcaaagaaaa 131
             ||||||||||||||||||||
Sbjct: 46256 aacatttgcatcaaagaaaa 46275



to top

>emb|BX465199.9| Zebrafish DNA sequence from clone DKEY-84I7 in linkage group 5,
             complete sequence
          Length = 218103

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    ttgaaattgaaatcaattta 107
             ||||||||||||||||||||
Sbjct: 73049 ttgaaattgaaatcaattta 73030



to top

>dbj|AP001376.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-775E2, complete
             sequence
          Length = 181300

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 114   catttgcatcaaagaaaatt 133
             ||||||||||||||||||||
Sbjct: 87354 catttgcatcaaagaaaatt 87373



to top

>emb|AL844212.8| Mouse DNA sequence from clone RP23-29B20 on chromosome 4, complete
              sequence
          Length = 215351

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 70     aaatacatggcaattgtctt 89
              ||||||||||||||||||||
Sbjct: 202199 aaatacatggcaattgtctt 202180


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,619,955
Number of Sequences: 3902068
Number of extensions: 3619955
Number of successful extensions: 67815
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 67782
Number of HSP's gapped (non-prelim): 33
length of query: 350
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 328
effective length of database: 17,147,199,772
effective search space: 5624281525216
effective search space used: 5624281525216
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top