Clone Name | rbastl26f05 |
---|---|
Clone Library Name | barley_pub |
>gb|AC019216.9|AC019216 Homo sapiens BAC clone RP11-484N11 from 4, complete sequence Length = 160858 Score = 44.1 bits (22), Expect = 0.30 Identities = 25/26 (96%) Strand = Plus / Plus Query: 120 catcaaagaaaattacgagatcttgt 145 |||||||||||||||| ||||||||| Sbjct: 100333 catcaaagaaaattacaagatcttgt 100358
>gb|AC140845.2| Mus musculus BAC clone RP24-386C13 from chromosome 8, complete sequence Length = 153426 Score = 42.1 bits (21), Expect = 1.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 69 taaatacatggcaattgtcttgaaattgaaatc 101 |||||||||||| | |||||||||| ||||||| Sbjct: 71990 taaatacatggccaatgtcttgaaaatgaaatc 71958
>emb|AL590439.12| Human DNA sequence from clone RP11-394I23 on chromosome 10 Contains a novel gene (FLJ13397) (CARP) and a CpG island, complete sequence Length = 192044 Score = 42.1 bits (21), Expect = 1.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 85 gtcttgaaattgaaatcaatttacaacaa 113 ||||||||| ||||||||||| ||||||| Sbjct: 12215 gtcttgaaactgaaatcaattaacaacaa 12187
>emb|AL590425.10| Human DNA sequence from clone RP11-102N5 on chromosome X Contains the gene for a novel protein and three CpG islands, complete sequence Length = 63771 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 taaatacatggcaattgtctt 89 ||||||||||||||||||||| Sbjct: 44142 taaatacatggcaattgtctt 44162
>emb|BX255949.3| Zebrafish DNA sequence from clone DKEY-76F5 in linkage group 2, complete sequence Length = 214484 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 82 attgtcttgaaattgaaatca 102 ||||||||||||||||||||| Sbjct: 16556 attgtcttgaaattgaaatca 16536
>gb|AC018360.16| Homo sapiens 3 BAC RP11-67D16 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 179993 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 20 ttgaacaatttgtaacctct 39 |||||||||||||||||||| Sbjct: 90399 ttgaacaatttgtaacctct 90380
>gb|AC146683.11| Medicago truncatula clone mth2-179n10, complete sequence Length = 131133 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 88 ttgaaattgaaatcaattta 107 |||||||||||||||||||| Sbjct: 113492 ttgaaattgaaatcaattta 113511
>emb|AL358934.19| Human DNA sequence from clone RP11-459D20 on chromosome 9 Contains a transcription factor IIA small 12 kDa subunit (GTF2A2) pseudogene, complete sequence Length = 95922 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 81 aattgtcttgaaattgaaat 100 |||||||||||||||||||| Sbjct: 46012 aattgtcttgaaattgaaat 46031
>emb|AL109749.22|HSA213H19 Human DNA sequence from clone RP6-213H19 on chromosome Xq25-26.3 Contains the gene for Mst3 and SOK1-related kinase (MST4), LOC90167 gene and a CpG island, complete sequence Length = 138902 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 20 ttgaacaatttgtaacctct 39 |||||||||||||||||||| Sbjct: 88879 ttgaacaatttgtaacctct 88898
>emb|BX537296.9| Zebrafish DNA sequence from clone DKEYP-86D4 in linkage group 14, complete sequence Length = 203251 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 111 caacatttgcatcaaagaaa 130 |||||||||||||||||||| Sbjct: 12452 caacatttgcatcaaagaaa 12471
>gb|AC011031.12| Homo sapiens chromosome 8, clone RP11-345I19, complete sequence Length = 183771 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 96 gaaatcaatttacaacaaca 115 |||||||||||||||||||| Sbjct: 114785 gaaatcaatttacaacaaca 114766
>gb|AC105221.3| Homo sapiens chromosome 18, clone RP11-480N3, complete sequence Length = 165396 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 87 cttgaaattgaaatcaattt 106 |||||||||||||||||||| Sbjct: 9711 cttgaaattgaaatcaattt 9730
>gb|AC040965.8| Homo sapiens chromosome 8, clone RP11-481K20, complete sequence Length = 189188 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 112 aacatttgcatcaaagaaaa 131 |||||||||||||||||||| Sbjct: 46256 aacatttgcatcaaagaaaa 46275
>emb|BX465199.9| Zebrafish DNA sequence from clone DKEY-84I7 in linkage group 5, complete sequence Length = 218103 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 88 ttgaaattgaaatcaattta 107 |||||||||||||||||||| Sbjct: 73049 ttgaaattgaaatcaattta 73030
>dbj|AP001376.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-775E2, complete sequence Length = 181300 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 catttgcatcaaagaaaatt 133 |||||||||||||||||||| Sbjct: 87354 catttgcatcaaagaaaatt 87373
>emb|AL844212.8| Mouse DNA sequence from clone RP23-29B20 on chromosome 4, complete sequence Length = 215351 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 aaatacatggcaattgtctt 89 |||||||||||||||||||| Sbjct: 202199 aaatacatggcaattgtctt 202180 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,619,955 Number of Sequences: 3902068 Number of extensions: 3619955 Number of successful extensions: 67815 Number of sequences better than 10.0: 16 Number of HSP's better than 10.0 without gapping: 16 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 67782 Number of HSP's gapped (non-prelim): 33 length of query: 350 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 328 effective length of database: 17,147,199,772 effective search space: 5624281525216 effective search space used: 5624281525216 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)