ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbastl26c01 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC023722.4| Drosophila melanogaster X BAC RP98-48O24 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 191590 Score = 52.0 bits (26), Expect = 0.001 Identities = 26/26 (100%) Strand = Plus / Plus Query: 280 ccccatagatccatccatccatccat 305 |||||||||||||||||||||||||| Sbjct: 54573 ccccatagatccatccatccatccat 54598
>gb|AC023699.4| Drosophila melanogaster X BAC RP98-11K20 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 177941 Score = 52.0 bits (26), Expect = 0.001 Identities = 26/26 (100%) Strand = Plus / Plus Query: 280 ccccatagatccatccatccatccat 305 |||||||||||||||||||||||||| Sbjct: 158677 ccccatagatccatccatccatccat 158702
>gb|AE003438.3| Drosophila melanogaster chromosome X, section 22 of 74 of the complete sequence Length = 299943 Score = 52.0 bits (26), Expect = 0.001 Identities = 26/26 (100%) Strand = Plus / Plus Query: 280 ccccatagatccatccatccatccat 305 |||||||||||||||||||||||||| Sbjct: 200564 ccccatagatccatccatccatccat 200589
>emb|BX571698.15| Zebrafish DNA sequence from clone DKEYP-121E10 in linkage group 24, complete sequence Length = 168886 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||||||||||||||||||||||| Sbjct: 87320 ccatagatccatccatccatccatc 87296 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 87110 atccatccatccatccatca 87091 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 86185 atccatccatccatccatca 86166
>emb|BX005161.6| Zebrafish DNA sequence from clone CH211-168N16 in linkage group 20, complete sequence Length = 150884 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatc 306 ||||||||||||||||||||||||| Sbjct: 5421 ccatagatccatccatccatccatc 5445
>gb|AC102381.12| Mus musculus chromosome 8, clone RP24-180I19, complete sequence Length = 190298 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcactac 311 |||||||||||||||||||||||| Sbjct: 46320 atccatccatccatccatcactac 46297
>gb|AC123818.4| Mus musculus BAC clone RP24-266A12 from chromosome 18, complete sequence Length = 169506 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcactac 311 |||||||||||||||||||||||| Sbjct: 11104 atccatccatccatccatcactac 11081
>gb|AC120736.4| Rattus norvegicus 11 BAC CH230-252B13 (Children's Hospital Oakland Research Institute) complete sequence Length = 82009 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 283 catagatccatccatccatccatc 306 |||||||||||||||||||||||| Sbjct: 69776 catagatccatccatccatccatc 69799
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence Length = 23952694 Score = 48.1 bits (24), Expect = 0.023 Identities = 27/28 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatcact 309 |||| ||||||||||||||||||||||| Sbjct: 7323085 ccattgatccatccatccatccatcact 7323058 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 19821646 atccatccatccatccatcac 19821666 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 21300397 atccatccatccatccatca 21300378
>gb|AC104077.2| Homo sapiens BAC clone RP11-413P19 from 4, complete sequence Length = 122108 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 230 aaacagaaacaacttcactaataa 253 |||||||||||||||||||||||| Sbjct: 105580 aaacagaaacaacttcactaataa 105603
>gb|AC150908.6| Pan troglodytes BAC clone CH251-513A23 from chromosome y, complete sequence Length = 195906 Score = 48.1 bits (24), Expect = 0.023 Identities = 27/28 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatcact 309 |||| ||||||||||||||||||||||| Sbjct: 134479 ccattgatccatccatccatccatcact 134506
>gb|AC149054.3| Mus musculus BAC clone RP23-443H21 from 18, complete sequence Length = 210613 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcactac 311 |||||||||||||||||||||||| Sbjct: 111477 atccatccatccatccatcactac 111454
>gb|AC123761.17| Mus musculus chromosome 3, clone RP24-331E24, complete sequence Length = 192157 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcacta 310 ||||||||||||||||||||||| Sbjct: 113800 atccatccatccatccatcacta 113778
>gb|AC099741.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-92M3, complete sequence Length = 249636 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcacta 310 ||||||||||||||||||||||| Sbjct: 32844 atccatccatccatccatcacta 32822
>emb|CR925737.7| Zebrafish DNA sequence from clone DKEY-263O8 in linkage group 10, complete sequence Length = 176107 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcacta 310 ||||||||||||||||||||||| Sbjct: 98068 atccatccatccatccatcacta 98090
>emb|CR382284.13| Zebrafish DNA sequence from clone DKEY-95H16 in linkage group 8, complete sequence Length = 205882 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcacta 310 ||||||||||||||||||||||| Sbjct: 94300 atccatccatccatccatcacta 94278
>gb|AC121977.3| Mus musculus BAC clone RP24-287A16 from chromosome 6, complete sequence Length = 186279 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcacta 310 ||||||||||||||||||||||| Sbjct: 137243 atccatccatccatccatcacta 137221
>gb|AC125174.3| Mus musculus BAC clone RP24-544G11 from chromosome 16, complete sequence Length = 196646 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 284 atagatccatccatccatccatc 306 ||||||||||||||||||||||| Sbjct: 20566 atagatccatccatccatccatc 20588
>gb|AC138605.1| Mus musculus BAC clone RP23-392L23 from chromosome 16, complete sequence Length = 172684 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 284 atagatccatccatccatccatc 306 ||||||||||||||||||||||| Sbjct: 149711 atagatccatccatccatccatc 149733
>emb|AL591386.19| Human DNA sequence from clone RP11-349K21 on chromosome 9, complete sequence Length = 69657 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcacta 310 ||||||||||||||||||||||| Sbjct: 44397 atccatccatccatccatcacta 44419 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 44214 atccatccatccatccatcac 44234 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 44058 atccatccatccatccatcac 44078 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 44356 atccatccatccatccatca 44375
>emb|AL354696.11| Human DNA sequence from clone RP11-74J13 on chromosome 13 Contains a novel gene (FLJ30271, FLJ13413, DKFZp547M073), a calmodulin pseudogene, a novel gene (DKFZP434E2318), the MTFR1 gene for mitochondrial translational release factor 1 (RF1, MTTRF1), a ras homolog gene family, member G (rho G) (ARHG) pseudogene, the 5' end of the gene for a novel TPR domain containing protein and 3 CpG islands, complete sequence Length = 202565 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcacta 310 ||||||||||||||||||||||| Sbjct: 132103 atccatccatccatccatcacta 132125
>emb|CR388171.5| Zebrafish DNA sequence from clone CH211-261O7, complete sequence Length = 145218 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 284 atagatccatccatccatccatc 306 ||||||||||||||||||||||| Sbjct: 84122 atagatccatccatccatccatc 84144
>emb|AL845326.5| Zebrafish DNA sequence from clone CH211-191D15 in linkage group 5 Contains a novel gene similar to mouse and Xenopus laevis CORO1A (coronin, actin binding protein 1A), three novel genes, a novel gene similar to human and mouse NIFU (nitrogen fixation cluster-like) and a CpG island, complete sequence Length = 143528 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 284 atagatccatccatccatccatc 306 ||||||||||||||||||||||| Sbjct: 3252 atagatccatccatccatccatc 3230 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 2990 atccatccatccatccatca 2971
>gb|AC164626.6| Mus musculus 6 BAC RP23-472D18 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 190308 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcacta 310 ||||||||||||||||||||||| Sbjct: 42168 atccatccatccatccatcacta 42190
>gb|AF239143.1| Acropora prolifera isolate Apr-Red5.4 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 491 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 284 atagatccatccatccatccatc 306 ||||||||||||||||||||||| Sbjct: 59 atagatccatccatccatccatc 81
>gb|AF239142.1| Acropora prolifera isolate Apr-Red5.3 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 491 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 284 atagatccatccatccatccatc 306 ||||||||||||||||||||||| Sbjct: 59 atagatccatccatccatccatc 81
>emb|BX957309.6| Zebrafish DNA sequence from clone CH211-113P19 in linkage group 13, complete sequence Length = 169630 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 284 atagatccatccatccatccatc 306 ||||||||||||||||||||||| Sbjct: 42164 atagatccatccatccatccatc 42186 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 283 catagatccatccatccatccatc 306 ||||||||||||||||||| |||| Sbjct: 134872 catagatccatccatccattcatc 134849 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 134445 atccatccatccatccatca 134426 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 42176 atccatccatccatccatca 42195
>emb|BX323809.14| Zebrafish DNA sequence from clone DKEY-42J10 in linkage group 10, complete sequence Length = 194108 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 284 atagatccatccatccatccatc 306 ||||||||||||||||||||||| Sbjct: 161262 atagatccatccatccatccatc 161284
>emb|BX510333.14| Zebrafish DNA sequence from clone DKEYP-82D1 in linkage group 2, complete sequence Length = 198845 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcacta 310 ||||||||||||||||||||||| Sbjct: 56969 atccatccatccatccatcacta 56991 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 72498 atccatccatccatccatca 72479 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 72449 atccatccatccatccatca 72430 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 51142 atccatccatccatccatca 51161
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 286 agatccatccatccatccatcac 308 ||||||||||||||||||||||| Sbjct: 17111693 agatccatccatccatccatcac 17111715 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 29017307 atccatccatccatccatca 29017288 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 26039245 atccatccatccatccatca 26039264 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 287 gatccatccatccatccatc 306 |||||||||||||||||||| Sbjct: 21992547 gatccatccatccatccatc 21992566 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 16983677 atccatccatccatccatca 16983696
>gb|AC138080.4| Homo sapiens chromosome 8, clone RP11-1147M13, complete sequence Length = 164872 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcacta 310 ||||||||||||||||||||||| Sbjct: 72682 atccatccatccatccatcacta 72704
>dbj|AP004315.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0571D04 Length = 149302 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 286 agatccatccatccatccatcac 308 ||||||||||||||||||||||| Sbjct: 64819 agatccatccatccatccatcac 64841
>emb|AL833789.20| Zebrafish DNA sequence from clone DKEY-69O7 in linkage group 12, complete sequence Length = 175664 Score = 46.1 bits (23), Expect = 0.089 Identities = 26/27 (96%) Strand = Plus / Plus Query: 281 cccatagatccatccatccatccatca 307 |||||| |||||||||||||||||||| Sbjct: 167533 cccatacatccatccatccatccatca 167559 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 167653 atccatccatccatccatca 167672
>emb|CR381582.9| Zebrafish DNA sequence from clone DKEY-28M3 in linkage group 18, complete sequence Length = 215124 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcacta 310 ||||||||||||||||||||||| Sbjct: 21770 atccatccatccatccatcacta 21748
>emb|AL954312.16| Zebrafish DNA sequence from clone CH211-220P9 in linkage group 15, complete sequence Length = 231100 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 284 atagatccatccatccatccatc 306 ||||||||||||||||||||||| Sbjct: 213741 atagatccatccatccatccatc 213763 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 12864 atccatccatccatccatca 12845
>emb|BX321885.11| Zebrafish DNA sequence from clone CH211-240L19 in linkage group 4, complete sequence Length = 155649 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 284 atagatccatccatccatccatc 306 ||||||||||||||||||||||| Sbjct: 146598 atagatccatccatccatccatc 146620 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatc 306 |||| |||||||||||||||||||| Sbjct: 146880 ccattgatccatccatccatccatc 146904 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 146202 atccatccatccatccatca 146221
>dbj|AP006250.1| Homo sapiens genomic DNA, chromosome 8, clone:RP11-632H17, complete sequence Length = 197556 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcacta 310 ||||||||||||||||||||||| Sbjct: 9911 atccatccatccatccatcacta 9933
>dbj|AP006245.1| Homo sapiens genomic DNA, chromosome 8, clone:RP11-139F9, complete sequence Length = 155586 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcacta 310 ||||||||||||||||||||||| Sbjct: 143440 atccatccatccatccatcacta 143462
>emb|AL935323.6| Mouse DNA sequence from clone RP23-302M17 on chromosome 2, complete sequence Length = 133296 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcacta 310 ||||||||||||||||||||||| Sbjct: 18535 atccatccatccatccatcacta 18557
>dbj|AP000079.1| Homo sapiens genomic DNA, chromosome 8p11.2, senescence gene region, section 15/19, complete sequence Length = 100000 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcacta 310 ||||||||||||||||||||||| Sbjct: 12250 atccatccatccatccatcacta 12228
>emb|AL645535.16| Mouse DNA sequence from clone RP23-145G23 on chromosome 11, complete sequence Length = 161363 Score = 46.1 bits (23), Expect = 0.089 Identities = 26/27 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatcac 308 ||||| ||||||||||||||||||||| Sbjct: 27494 ccatacatccatccatccatccatcac 27520
>gb|AC114666.31| Mus musculus chromosome 5, clone RP24-175N6, complete sequence Length = 193158 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 187307 atccatccatccatccatcact 187328
>gb|AC168056.3| Mus musculus BAC clone RP24-189B1 from chromosome 13, complete sequence Length = 179458 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 285 tagatccatccatccatccatc 306 |||||||||||||||||||||| Sbjct: 101392 tagatccatccatccatccatc 101371
>gb|AC108768.14| Mus musculus chromosome 8, clone RP23-398L15, complete sequence Length = 209808 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatca 307 ||||| |||||||||||||||||||| Sbjct: 83452 ccatatatccatccatccatccatca 83427
>gb|AC138265.9| Mus musculus chromosome 5, clone RP23-41J13, complete sequence Length = 172279 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 114736 atccatccatccatccatcact 114757
>gb|AC163684.5| Mus musculus BAC clone RP23-8N10 from chromosome 13, complete sequence Length = 234717 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 285 tagatccatccatccatccatc 306 |||||||||||||||||||||| Sbjct: 39920 tagatccatccatccatccatc 39899
>gb|AC169501.2| Mus musculus BAC clone RP24-445O18 from chromosome 17, complete sequence Length = 202078 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 178399 atccatccatccatccatcact 178378
>ref|XM_519464.1| PREDICTED: Pan troglodytes protein disulfide isomerase related protein (calcium-binding protein, intestinal-related) (LOC463822), mRNA Length = 2829 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Plus Query: 320 gggagggcctacgacggcggagccga 345 ||||||||||||| |||||||||||| Sbjct: 39 gggagggcctacggcggcggagccga 64
>gb|AC169506.1| Mus musculus BAC clone RP23-417L6 from chromosome 17, complete sequence Length = 202033 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 62805 atccatccatccatccatcact 62784
>gb|AC165151.2| Mus musculus BAC clone RP24-77O15 from chromosome 16, complete sequence Length = 177446 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 287 gatccatccatccatccatcac 308 |||||||||||||||||||||| Sbjct: 75403 gatccatccatccatccatcac 75424
>gb|AC121309.10| Mus musculus chromosome 3, clone RP24-303N8, complete sequence Length = 179337 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 132372 atccatccatccatccatcact 132351
>gb|AC109305.6| Mus musculus chromosome 1, clone RP24-350F5, complete sequence Length = 184088 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 110114 atccatccatccatccatcact 110135
>gb|AC124106.10| Mus musculus chromosome 5, clone RP24-299A7, complete sequence Length = 167372 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 58937 atccatccatccatccatcact 58958
>gb|AC138654.4| Mus musculus BAC clone RP23-344O11 from chromosome 5, complete sequence Length = 198036 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 133483 atccatccatccatccatcact 133462
>gb|AC073162.9| Homo sapiens chromosome 10 clone RP11-536J24, complete sequence Length = 185754 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 119216 atccatccatccatccatcact 119195
>gb|AC140302.2| Mus musculus BAC clone RP24-321I14 from chromosome 5, complete sequence Length = 174372 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 72857 atccatccatccatccatcact 72836
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 287 gatccatccatccatccatcac 308 |||||||||||||||||||||| Sbjct: 4560780 gatccatccatccatccatcac 4560801 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 287 gatccatccatccatccatc 306 |||||||||||||||||||| Sbjct: 26437161 gatccatccatccatccatc 26437180 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 16675317 atccatccatccatccatca 16675298 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 287 gatccatccatccatccatc 306 |||||||||||||||||||| Sbjct: 11622932 gatccatccatccatccatc 11622951 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 287 gatccatccatccatccatc 306 |||||||||||||||||||| Sbjct: 5147976 gatccatccatccatccatc 5147995
>gb|AC164103.5| Mus musculus BAC clone RP23-427D2 from chromosome 5, complete sequence Length = 188588 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Plus Query: 281 cccatagatccatccatccatccatc 306 ||||| |||||||||||||||||||| Sbjct: 123543 cccattgatccatccatccatccatc 123568 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 123447 atccatccatccatccatca 123466 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 123279 atccatccatccatccatca 123298 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 74230 atccatccatccatccatca 74211 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 39642 atccatccatccatccatca 39661 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 39475 atccatccatccatccatca 39494
>gb|AC183833.2| Pan troglodytes BAC clone CH251-141C5 from chromosome 7, complete sequence Length = 155911 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Plus Query: 281 cccatagatccatccatccatccatc 306 |||||| ||||||||||||||||||| Sbjct: 60141 cccatatatccatccatccatccatc 60166 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 59898 atccatccatccatccatca 59917 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 59848 atccatccatccatccatca 59867
>gb|AC093168.3| Homo sapiens BAC clone RP11-148M21 from 7, complete sequence Length = 148689 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Plus Query: 281 cccatagatccatccatccatccatc 306 |||||| ||||||||||||||||||| Sbjct: 101904 cccatatatccatccatccatccatc 101929 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 101645 atccatccatccatccatca 101664
>gb|AC005056.2| Homo sapiens BAC clone CTB-51J22 from 7, complete sequence Length = 98188 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 285 tagatccatccatccatccatc 306 |||||||||||||||||||||| Sbjct: 22973 tagatccatccatccatccatc 22952 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 43739 atccatccatccatccatca 43720
>emb|CR762443.6| Zebrafish DNA sequence from clone DKEY-3A5 in linkage group 10, complete sequence Length = 213185 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 148978 atccatccatccatccatcact 148999 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 149714 atccatccatccatccatca 149733 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 148812 atccatccatccatccatca 148831
>emb|CR936849.22| Mouse DNA sequence from clone DN-250A21 on chromosome 3, complete sequence Length = 153083 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Plus Query: 281 cccatagatccatccatccatccatc 306 ||||| |||||||||||||||||||| Sbjct: 129684 cccattgatccatccatccatccatc 129709
>emb|CR589948.8| Zebrafish DNA sequence from clone CH211-160P12 in linkage group 15, complete sequence Length = 162791 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 285 tagatccatccatccatccatc 306 |||||||||||||||||||||| Sbjct: 82867 tagatccatccatccatccatc 82846 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 82384 atccatccatccatccatca 82365
>gb|AC109364.6| Mus musculus BAC clone RP23-127N24 from chromosome 17, complete sequence Length = 198838 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 91272 atccatccatccatccatcact 91251
>gb|AC091250.2| Mus musculus strain C57BL6/J chromosome 5 clone RP23-315E2, complete sequence Length = 201395 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 67274 atccatccatccatccatcact 67253
>gb|AC091092.3| Papio anubis clone RP41-191D8, complete sequence Length = 167732 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatca 307 ||||| |||||||||||||||||||| Sbjct: 19749 ccatatatccatccatccatccatca 19774 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 19514 atccatccatccatccatcact 19535
>gb|AC121575.4| Mus musculus BAC clone RP23-241P4 from 1, complete sequence Length = 193725 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 139200 atccatccatccatccatcact 139221
>ref|NG_000839.1| Homo sapiens cystatin locus (CST@) on chromosome 20 Length = 477159 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Minus Query: 281 cccatagatccatccatccatccatc 306 ||||| |||||||||||||||||||| Sbjct: 436316 cccatcgatccatccatccatccatc 436291
>emb|CR352342.9| Zebrafish DNA sequence from clone CH211-134H7 in linkage group 12, complete sequence Length = 186937 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 121211 atccatccatccatccatcact 121190
>emb|AL390209.1| Human DNA sequence from clone CTA-437G10 on chromosome 22q11.2-12.3, complete sequence Length = 71200 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 31260 atccatccatccatccatcact 31239
>emb|AL356282.13| Human DNA sequence from clone RP11-303E19 on chromosome 9 Contains part of the GPR51 gene for G protein-coupled receptor 51 (HG20, GABBR2, GPRC3B, GABABR2), complete sequence Length = 48103 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Plus Query: 281 cccatagatccatccatccatccatc 306 |||||| ||||||||||||||||||| Sbjct: 43413 cccatatatccatccatccatccatc 43438
>gb|AC098563.6| Rattus norvegicus 1 BAC CH230-123A15 (Children's Hospital Oakland Research Institute) complete sequence Length = 250414 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatca 307 |||| ||||||||||||||||||||| Sbjct: 70940 ccattgatccatccatccatccatca 70965
>gb|AC091537.2| Rattus norvegicus strain Brown Norway clone RP31-78C13, complete sequence Length = 119664 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 58343 atccatccatccatccatcact 58322
>gb|AC132805.3| Homo sapiens chromosome 16 clone LA16c-356B12, complete sequence Length = 35019 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Minus Query: 281 cccatagatccatccatccatccatc 306 |||||| ||||||||||||||||||| Sbjct: 22513 cccatatatccatccatccatccatc 22488
>emb|AL137003.12| Human DNA sequence from clone RP1-151F17 on chromosome 6 Contains the 3' end of the SCA1 gene for spinocerebellar ataxia 1n(olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1), complete sequence Length = 113802 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Minus Query: 281 cccatagatccatccatccatccatc 306 |||||| ||||||||||||||||||| Sbjct: 4502 cccatatatccatccatccatccatc 4477
>emb|AL109811.40|HSJ635E18 Human DNA sequence from clone RP4-635E18 on chromosome 1p36.11-36.31 Contains the TARDBP gene for TAR DNA binding protein, the MASP2 gene for mannan-binding lectin serine protease 2, the SRM gene for spermidine synthase, the PMSCL2 gene for 100kDa polymyositis/scleroderma autoantigen 2 (FLJ41371, FLJ36636, two novel genes (FLJ30609), the 3' end of the FRAP1 gene for FK506 binding protein 12-rapamycin associated protein 1 and a CpG island, complete sequence Length = 112769 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Minus Query: 281 cccatagatccatccatccatccatc 306 |||||| ||||||||||||||||||| Sbjct: 35975 cccatatatccatccatccatccatc 35950 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 35964 atccatccatccatccatca 35945
>emb|AL109954.15|HSJ333B15 Human DNA sequence from clone RP3-333B15 on chromosome 20 Contains the CST8 gene for cystatin 8 (cystatin-related epididymal specific protein), a novel gene and the 5' end of a novel gene, complete sequence Length = 73666 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Plus Query: 281 cccatagatccatccatccatccatc 306 ||||| |||||||||||||||||||| Sbjct: 23266 cccatcgatccatccatccatccatc 23291
>emb|CR376835.6| Zebrafish DNA sequence from clone CH211-59E4 in linkage group 23, complete sequence Length = 23743 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 285 tagatccatccatccatccatc 306 |||||||||||||||||||||| Sbjct: 17178 tagatccatccatccatccatc 17199 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 17053 atccatccatccatccatca 17072 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 287 gatccatccatccatccatc 306 |||||||||||||||||||| Sbjct: 17044 gatccatccatccatccatc 17063
>emb|X84418.1|CCNR13 C.coturnix NR-13 gene Length = 1475 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 286 agatccatccatccatccatca 307 |||||||||||||||||||||| Sbjct: 592 agatccatccatccatccatca 571
>emb|BX908798.1| Parachlamydia-related symbiont UWE25, complete genome Length = 2414465 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Plus Query: 121 ataaagctaaagctaaggcaacagca 146 |||||||||||||||| ||||||||| Sbjct: 953154 ataaagctaaagctaaagcaacagca 953179
>emb|CR759968.6| Zebrafish DNA sequence from clone CH211-198N5 in linkage group 8, complete sequence Length = 182233 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 284 atagatccatccatccatccat 305 |||||||||||||||||||||| Sbjct: 61754 atagatccatccatccatccat 61733
>emb|CR933018.9| Zebrafish DNA sequence from clone CH211-224H1 in linkage group 4, complete sequence Length = 181431 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 122163 atccatccatccatccatcact 122142
>emb|CR293530.22| Zebrafish DNA sequence from clone CH211-129C13 in linkage group 1, complete sequence Length = 179015 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 143916 atccatccatccatccatcact 143937
>gb|AC007834.40| Homo sapiens 12 BAC RP11-7G5 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 210578 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 91149 atccatccatccatccatcact 91128 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 90866 atccatccatccatccatcact 90845 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 90452 atccatccatccatccatcact 90431 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 90310 atccatccatccatccatcact 90289 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 ccatccatccatccatcact 309 |||||||||||||||||||| Sbjct: 90919 ccatccatccatccatcact 90900
>emb|AL935187.13| Zebrafish DNA sequence from clone DKEY-97C7 in linkage group 4 Contains part of the gene for a novel protein similar to vertebrate atrophin-1 interacting protein (AIP1) and a CpG island, complete sequence Length = 263517 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 152342 atccatccatccatccatcact 152363 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 151900 atccatccatccatccatca 151919
>emb|BX465851.5| Zebrafish DNA sequence from clone CH211-215H21 in linkage group 6, complete sequence Length = 145469 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatca 307 ||||| |||||||||||||||||||| Sbjct: 98588 ccatacatccatccatccatccatca 98613 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 109809 atccatccatccatccatca 109790 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 98644 atccatccatccatccatca 98663
>emb|BX323073.12| Zebrafish DNA sequence from clone DKEY-117J3 in linkage group 21, complete sequence Length = 118703 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 7192 atccatccatccatccatcact 7171
>gb|AC079331.11| Homo sapiens chromosome 17, clone RP11-360N9, complete sequence Length = 182535 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Plus Query: 281 cccatagatccatccatccatccatc 306 ||||| |||||||||||||||||||| Sbjct: 104814 cccattgatccatccatccatccatc 104839
>emb|BX649501.24| Zebrafish DNA sequence from clone DKEY-123F20 in linkage group 5, complete sequence Length = 194220 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 57061 atccatccatccatccatcact 57082
>emb|CR361558.6| Zebrafish DNA sequence from clone DKEY-22K11 in linkage group 13, complete sequence Length = 204631 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatca 307 ||||| |||||||||||||||||||| Sbjct: 80038 ccataaatccatccatccatccatca 80063
>emb|BX649498.5| Zebrafish DNA sequence from clone DKEY-172F5 in linkage group 6, complete sequence Length = 91141 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 58311 atccatccatccatccatcact 58332
>gb|AC118207.13| Mus musculus chromosome 8, clone RP24-215A12, complete sequence Length = 187453 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 162637 atccatccatccatccatcact 162616
>gb|AC156994.8| Mus musculus chromosome 5, clone RP23-312N12, complete sequence Length = 166581 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 61043 atccatccatccatccatcact 61064 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 287 gatccatccatccatccatc 306 |||||||||||||||||||| Sbjct: 66918 gatccatccatccatccatc 66899
>emb|BX530409.7| Zebrafish DNA sequence from clone DKEY-69K9 in linkage group 15, complete sequence Length = 245494 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 285 tagatccatccatccatccatc 306 |||||||||||||||||||||| Sbjct: 136884 tagatccatccatccatccatc 136863
>emb|BX276108.6| Zebrafish DNA sequence from clone CH211-265M17 in linkage group 24, complete sequence Length = 144165 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 100678 atccatccatccatccatcact 100657 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 114242 atccatccatccatccatca 114223 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 113934 atccatccatccatccatca 113915 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 113851 atccatccatccatccatca 113832 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 111068 atccatccatccatccatca 111049 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 100318 atccatccatccatccatca 100299
>dbj|AK123864.1| Homo sapiens cDNA FLJ41870 fis, clone OCBBF2007428 Length = 2538 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Minus Query: 281 cccatagatccatccatccatccatc 306 ||||| |||||||||||||||||||| Sbjct: 1451 cccattgatccatccatccatccatc 1426
>gb|AC091691.7| Homo sapiens chromosome 18, clone RP11-47G4, complete sequence Length = 164314 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Plus Query: 281 cccatagatccatccatccatccatc 306 |||||| ||||||||||||||||||| Sbjct: 120143 cccatacatccatccatccatccatc 120168
>gb|AC104524.2| Homo sapiens chromosome 19 clone LLNLF-185G1, complete sequence Length = 17083 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 8089 atccatccatccatccatcact 8068
>emb|BX511230.4| Zebrafish DNA sequence from clone DKEY-14H23 in linkage group 17, complete sequence Length = 156048 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 75785 atccatccatccatccatcact 75806
>gb|AC153363.4| Mus musculus BAC clone RP23-5I6 from chromosome 9, complete sequence Length = 185444 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 151448 atccatccatccatccatcact 151469
>gb|AC020916.8| Homo sapiens chromosome 19 clone CTD-3252C9, complete sequence Length = 214530 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 83556 atccatccatccatccatcact 83577
>emb|BX296552.9| Zebrafish DNA sequence from clone CH211-247P22, complete sequence Length = 171208 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 95098 atccatccatccatccatcact 95119
>emb|BX294171.10| Zebrafish DNA sequence from clone DKEY-263M10 in linkage group 1, complete sequence Length = 121187 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 80186 atccatccatccatccatcact 80207
>gb|AC123753.7| Mus musculus chromosome 5, clone RP24-200E3, complete sequence Length = 167457 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 58937 atccatccatccatccatcact 58958
>gb|AC004032.7| Homo sapiens Chromosome 22q11.2 BAC Clone b437g10 In BCRL2-GGT Region, complete sequence Length = 200685 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 31254 atccatccatccatccatcact 31233
>gb|AC155651.4| Mus musculus 6 BAC RP24-111E13 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 175599 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 66555 atccatccatccatccatcact 66534
>gb|AC158664.5| Mus musculus 6 BAC RP23-24F17 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 232894 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 200469 atccatccatccatccatcact 200490
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 287 gatccatccatccatccatcac 308 |||||||||||||||||||||| Sbjct: 4560895 gatccatccatccatccatcac 4560916 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 287 gatccatccatccatccatc 306 |||||||||||||||||||| Sbjct: 26528470 gatccatccatccatccatc 26528489 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 16668950 atccatccatccatccatca 16668931 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 287 gatccatccatccatccatc 306 |||||||||||||||||||| Sbjct: 11619695 gatccatccatccatccatc 11619714 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 287 gatccatccatccatccatc 306 |||||||||||||||||||| Sbjct: 5147193 gatccatccatccatccatc 5147212
>gb|AC073916.41| Homo sapiens 12 BAC RP11-408I18 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 205283 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Minus Query: 281 cccatagatccatccatccatccatc 306 ||||| |||||||||||||||||||| Sbjct: 15915 cccatcgatccatccatccatccatc 15890
>gb|AC125471.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0042J17, complete sequence Length = 171442 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 287 gatccatccatccatccatcac 308 |||||||||||||||||||||| Sbjct: 166072 gatccatccatccatccatcac 166093
>gb|U63721.1|HSU63721 Human elastin (ELN) gene, partial cds, and LIM-kinase (LIMK1) gene, complete cds Length = 67046 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 285 tagatccatccatccatccatc 306 |||||||||||||||||||||| Sbjct: 11303 tagatccatccatccatccatc 11324
>gb|AF289665.1|AF289665 Mus musculus EIF4H gene, partial cds; LIMK1 gene, complete cds; and ELN gene, partial cds Length = 107257 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 91374 atccatccatccatccatcact 91353
>emb|BX247944.6| Zebrafish DNA sequence from clone CH211-227L2 in linkage group 24, complete sequence Length = 155665 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 18909 atccatccatccatccatcact 18930
>emb|BX247945.6| Zebrafish DNA sequence from clone CH211-209L14 in linkage group 24, complete sequence Length = 199345 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 285 tagatccatccatccatccatc 306 |||||||||||||||||||||| Sbjct: 166914 tagatccatccatccatccatc 166893 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 287 gatccatccatccatccatc 306 |||||||||||||||||||| Sbjct: 167053 gatccatccatccatccatc 167034
>emb|BX004992.13| Zebrafish DNA sequence from clone CH211-120E13 in linkage group 16, complete sequence Length = 195432 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatca 307 ||||| |||||||||||||||||||| Sbjct: 16890 ccatacatccatccatccatccatca 16865 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 84856 ccataaatccatccatccatccatc 84832 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 85313 atccatccatccatccatca 85294 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 287 gatccatccatccatccatc 306 |||||||||||||||||||| Sbjct: 85194 gatccatccatccatccatc 85175 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 84846 atccatccatccatccatca 84827 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 84659 atccatccatccatccatca 84640 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 18179 atccatccatccatccatca 18160 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 17562 atccatccatccatccatca 17543
>emb|AL953880.11| Zebrafish DNA sequence from clone CH211-236O11 in linkage group 16, complete sequence Length = 161603 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 133186 atccatccatccatccatcact 133165 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 10405 ccatacatccatccatccatccatc 10381 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 134020 atccatccatccatccatca 134001 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 287 gatccatccatccatccatc 306 |||||||||||||||||||| Sbjct: 133483 gatccatccatccatccatc 133464 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 10781 atccatccatccatccatca 10762 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 10544 atccatccatccatccatca 10525
>emb|AL672058.5| Zebrafish DNA sequence from clone BUSM1-47J20 in linkage group 1, complete sequence Length = 130339 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 12053 atccatccatccatccatcact 12032
>emb|AL391153.3|CNS06C7Z Human chromosome 14 DNA sequence BAC C-2576L4 of library CalTech-D from chromosome 14 of Homo sapiens (Human), complete sequence Length = 172336 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 163517 atccatccatccatccatcact 163538
>emb|CR293523.11| Zebrafish DNA sequence from clone DKEY-104J7 in linkage group 7, complete sequence Length = 214581 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 149814 atccatccatccatccatcact 149793 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 143920 atccatccatccatccatca 143901 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 143849 atccatccatccatccatca 143830
>emb|BX901876.11| Zebrafish DNA sequence from clone CH211-140G2 in linkage group 18, complete sequence Length = 155813 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 102225 atccatccatccatccatcact 102204 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 102153 atccatccatccatccatca 102134
>emb|CR293524.10| Zebrafish DNA sequence from clone DKEY-57M7 in linkage group 18, complete sequence Length = 190196 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 173533 atccatccatccatccatcact 173554
>emb|CR381614.10| Zebrafish DNA sequence from clone DKEY-72G4 in linkage group 20, complete sequence Length = 153083 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 6532 atccatccatccatccatcact 6553 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 6272 atccatccatccatccatca 6291
>emb|BX897671.5| Zebrafish DNA sequence from clone CH211-214K5 in linkage group 4, complete sequence Length = 201108 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 88239 atccatccatccatccatcact 88260
>emb|BX469895.7| Zebrafish DNA sequence from clone DKEY-152C18 in linkage group 19, complete sequence Length = 179493 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 130624 atccatccatccatccatcact 130645 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 287 gatccatccatccatccatc 306 |||||||||||||||||||| Sbjct: 130685 gatccatccatccatccatc 130704
>emb|BX005185.5| Zebrafish DNA sequence from clone CH211-132N11 in linkage group 24, complete sequence Length = 164521 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 285 tagatccatccatccatccatc 306 |||||||||||||||||||||| Sbjct: 24738 tagatccatccatccatccatc 24717 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 83767 ccatatatccatccatccatccatc 83743 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 83101 atccatccatccatccatca 83082 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 287 gatccatccatccatccatc 306 |||||||||||||||||||| Sbjct: 24877 gatccatccatccatccatc 24858
>gb|AF083221.1|AF083221 Fugu rubripes putative neurotransmitter receptors, YDR140w homolog, and glycinamide ribonucleotide transformylase (GART) genes, complete cds Length = 43373 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 285 tagatccatccatccatccatc 306 |||||||||||||||||||||| Sbjct: 7776 tagatccatccatccatccatc 7797
>emb|CT010445.12| Mouse DNA sequence from clone RP23-285G1 on chromosome 17, complete sequence Length = 123987 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 38785 atccatccatccatccatcact 38806
>emb|AL163932.5|CNS05TBO Human chromosome 14 DNA sequence BAC R-61O1 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 170535 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 43134 atccatccatccatccatcact 43155
>emb|CR753888.14| Zebrafish DNA sequence from clone CH211-154E10 in linkage group 5, complete sequence Length = 161155 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 78876 atccatccatccatccatcact 78855 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 79332 atccatccatccatccatca 79313 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 78944 atccatccatccatccatca 78925 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 38949 atccatccatccatccatca 38968
>emb|AL929286.13| Zebrafish DNA sequence from clone CH211-117K10 in linkage group 11, complete sequence Length = 168222 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 152453 atccatccatccatccatcact 152474 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 154161 atccatccatccatccatca 154180
>emb|BX088726.13| Zebrafish DNA sequence from clone DKEY-149G13 in linkage group 20, complete sequence Length = 190374 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 284 atagatccatccatccatccat 305 |||||||||||||||||||||| Sbjct: 137079 atagatccatccatccatccat 137058
>emb|BX005449.4| Zebrafish DNA sequence from clone CH211-174A15 in linkage group 10, complete sequence Length = 142054 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 70599 atccatccatccatccatcact 70578
>gb|AC133576.10| Mus musculus chromosome 19, clone RP23-204H15, complete sequence Length = 213096 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 112793 atccatccatccatccatcact 112814
>gb|AF022959.1|AF022959 Ameiurus natalis beta-2 microglobulin precursor (B2m) gene, partial cds Length = 1446 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Plus Query: 281 cccatagatccatccatccatccatc 306 |||||| ||||||||||||||||||| Sbjct: 662 cccatatatccatccatccatccatc 687
>emb|AL929284.12| Zebrafish DNA sequence from clone CH211-160H23 in linkage group 15, complete sequence Length = 179458 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 43562 atccatccatccatccatcact 43541 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 158258 ccatatatccatccatccatccatc 158282 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 43631 atccatccatccatccatca 43612 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 43457 atccatccatccatccatca 43438
>emb|AL953903.8| Zebrafish DNA sequence from clone CH211-249G19, complete sequence Length = 180436 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 152732 atccatccatccatccatcact 152711 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 173889 atccatccatccatccatca 173908 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 153028 atccatccatccatccatca 153009 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 152604 atccatccatccatccatca 152585
>emb|CR456684.10| Zebrafish DNA sequence from clone DKEY-46I8 in linkage group 12, complete sequence Length = 262809 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 87502 atccatccatccatccatcact 87481 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 208180 atccatccatccatccatca 208199
>gb|AC133949.4| Mus musculus BAC clone RP24-242E1 from 12, complete sequence Length = 143042 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 20745 atccatccatccatccatcact 20766
>gb|AC126669.4| Mus musculus BAC clone RP24-457D15 from 9, complete sequence Length = 180081 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 72528 atccatccatccatccatcact 72549
>gb|AC134862.4| Mus musculus BAC clone RP24-91P2 from 5, complete sequence Length = 205726 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Plus Query: 281 cccatagatccatccatccatccatc 306 ||||| |||||||||||||||||||| Sbjct: 32993 cccattgatccatccatccatccatc 33018 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 32897 atccatccatccatccatca 32916 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 32729 atccatccatccatccatca 32748
>emb|CR388001.36| Zebrafish DNA sequence from clone CH211-279I17 in linkage group 22, complete sequence Length = 123028 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 285 tagatccatccatccatccatc 306 |||||||||||||||||||||| Sbjct: 21110 tagatccatccatccatccatc 21089 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 21789 atccatccatccatccatca 21770
>gb|AC154374.1| Mus musculus BAC clone RP23-81F24 from 9, complete sequence Length = 169272 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 112413 atccatccatccatccatcact 112434
>gb|AC141560.4| Mus musculus BAC clone RP23-425A5 from 12, complete sequence Length = 196665 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 3243 atccatccatccatccatcact 3222 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 93611 atccatccatccatccatca 93592 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 93556 atccatccatccatccatca 93537
>gb|U62292.1|HSU62292 Human elastin (ELN) gene, partial cds Length = 20866 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 285 tagatccatccatccatccatc 306 |||||||||||||||||||||| Sbjct: 8324 tagatccatccatccatccatc 8345
>gb|AC166328.4| Mus musculus BAC clone RP23-31H5 from chromosome 5, complete sequence Length = 215189 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 54767 atccatccatccatccatcact 54788
>emb|AL671857.16| Mouse DNA sequence from clone RP23-176A21 on chromosome 3, complete sequence Length = 207354 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Plus Query: 281 cccatagatccatccatccatccatc 306 ||||| |||||||||||||||||||| Sbjct: 72360 cccattgatccatccatccatccatc 72385
>emb|AL731674.9| Mouse DNA sequence from clone RP23-340M18 on chromosome X, complete sequence Length = 193870 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcact 309 |||||||||||||||||||||| Sbjct: 17977 atccatccatccatccatcact 17998 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 193273 atccatccatccatccatca 193254
>gb|AC121489.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1217B09, complete sequence Length = 148894 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 287 gatccatccatccatccatcac 308 |||||||||||||||||||||| Sbjct: 1735 gatccatccatccatccatcac 1756
>gb|AC132804.2| Homo sapiens chromosome 16 clone LA16c-336H4, complete sequence Length = 36331 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Minus Query: 281 cccatagatccatccatccatccatc 306 |||||| ||||||||||||||||||| Sbjct: 28736 cccatatatccatccatccatccatc 28711
>gb|AC108429.11| Mus musculus chromosome 7, clone RP23-161B5, complete sequence Length = 186903 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 160335 atccatccatccatccatcac 160355
>gb|AC153786.1| Homo sapiens chromosome 2 clone fa0650, complete sequence Length = 41123 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 286 agatccatccatccatccatc 306 ||||||||||||||||||||| Sbjct: 20635 agatccatccatccatccatc 20615
>gb|AC161271.2| Mus musculus BAC clone RP23-59D8 from chromosome 14, complete sequence Length = 206083 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 226 acccaaacagaaacaacttca 246 ||||||||||||||||||||| Sbjct: 92623 acccaaacagaaacaacttca 92603
>ref|XM_633799.1| Dictyostelium discoideum hypothetical protein (DDB0218538), partial mRNA Length = 3306 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 3 atgatgatgatgacaaaataa 23 ||||||||||||||||||||| Sbjct: 2041 atgatgatgatgacaaaataa 2021
>gb|AC132396.6| Mus musculus BAC clone RP23-394F17 from chromosome 6, complete sequence Length = 190146 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatc 306 |||| |||||||||||||||||||| Sbjct: 164045 ccatcgatccatccatccatccatc 164069
>gb|AC154650.2| Mus musculus BAC clone RP23-162K2 from chromosome 17, complete sequence Length = 210417 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 286 agatccatccatccatccatc 306 ||||||||||||||||||||| Sbjct: 144283 agatccatccatccatccatc 144263 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 144273 atccatccatccatccatca 144254
>ref|XM_468422.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1095 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 287 gatccatccatccatccatca 307 ||||||||||||||||||||| Sbjct: 103 gatccatccatccatccatca 123
>gb|AC165317.8| Mus musculus chromosome 5, clone RP23-265O20, complete sequence Length = 190857 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 134528 atccatccatccatccatcac 134508 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 287 gatccatccatccatccatc 306 |||||||||||||||||||| Sbjct: 147112 gatccatccatccatccatc 147093
>gb|AC115898.22| Mus musculus chromosome 7, clone RP24-444C13, complete sequence Length = 177754 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 278 agccccatagatccatccatccatccatc 306 |||||||| ||||||||||||||||||| Sbjct: 2167 agccccatccatccatccatccatccatc 2139
>gb|AC166573.2| Mus musculus BAC clone RP23-153H18 from chromosome 17, complete sequence Length = 193004 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 86394 atccatccatccatccatcac 86374 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 86079 atccatccatccatccatcac 86059 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 86032 atccatccatccatccatcac 86012 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 85782 atccatccatccatccatcac 85762 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 85492 atccatccatccatccatcac 85472 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 85471 atccatccatccatccatcac 85451 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 85437 atccatccatccatccatcac 85417 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 85359 atccatccatccatccatcac 85339 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 85338 atccatccatccatccatcac 85318
>gb|AC078977.6| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0496H07, complete sequence Length = 164477 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 1479 ccatacatccatccatccatccatc 1455
>gb|AC136221.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0077J17, complete sequence Length = 141598 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 107057 atccatccatccatccatcac 107037
>gb|AC107702.12| Mus musculus chromosome 3, clone RP23-391G19, complete sequence Length = 219296 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 17323 ccataaatccatccatccatccatc 17299
>gb|AF541257.1| Panopea abrupta microsatellite Pab8 sequence Length = 447 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 145 ccatacatccatccatccatccatc 121
>gb|AY024018.1| Oryza sativa microsatellite MRG6343 containing (CCAT)X6, closest to marker C1720, genomic sequence Length = 224 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 107 atccatccatccatccatcac 127
>gb|AY023918.1| Oryza sativa microsatellite MRG6243 containing (ATCC)X7, closest to marker L655, genomic sequence Length = 228 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatc 306 |||| |||||||||||||||||||| Sbjct: 95 ccatcgatccatccatccatccatc 119
>gb|AY258894.1| Xiphophorus maculatus microsatellite Msc021 sequence Length = 529 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 285 ccatacatccatccatccatccatc 261
>gb|DQ198488.1| Elephas maximus clone LaT26 microsatellite sequence Length = 286 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 |||| |||||||||||||||||||| Sbjct: 212 ccatcgatccatccatccatccatc 188 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 287 gatccatccatccatccatc 306 |||||||||||||||||||| Sbjct: 255 gatccatccatccatccatc 236
>gb|DQ198486.1| Elephas maximus clone LaT24 microsatellite sequence Length = 232 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 286 agatccatccatccatccatc 306 ||||||||||||||||||||| Sbjct: 206 agatccatccatccatccatc 186
>gb|AC079356.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0016H04, complete sequence Length = 176678 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 287 gatccatccatccatccatca 307 ||||||||||||||||||||| Sbjct: 28719 gatccatccatccatccatca 28739
>gb|AC108504.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1654_B10, complete sequence Length = 140282 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 69498 ccatacatccatccatccatccatc 69474
>gb|AC101852.7| Mus musculus chromosome 1, clone RP23-279P3, complete sequence Length = 185975 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 |||| |||||||||||||||||||| Sbjct: 7202 ccatcgatccatccatccatccatc 7178
>gb|AC150386.2| Branchiostoma floridae clone CH302-103G16, complete sequence Length = 195926 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 |||| |||||||||||||||||||| Sbjct: 69478 ccattgatccatccatccatccatc 69454
>gb|AC123746.20| Mus musculus chromosome 1, clone RP24-122E21, complete sequence Length = 160429 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 101207 ccatatatccatccatccatccatc 101231
>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome Length = 2584158 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 330 acgacggcggagccgagcccg 350 ||||||||||||||||||||| Sbjct: 582008 acgacggcggagccgagcccg 582028
>gb|AC091453.2| Mus musculus chromosome X clones RP21-19N11, RP21-667A15, RP21-395M8 complete sequence Length = 350000 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatc 306 |||| |||||||||||||||||||| Sbjct: 342836 ccatcgatccatccatccatccatc 342860
>gb|AC129931.19| Mus musculus chromosome 15, clone RP23-136I22, complete sequence Length = 186914 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 286 agatccatccatccatccatc 306 ||||||||||||||||||||| Sbjct: 182761 agatccatccatccatccatc 182781 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 182887 atccatccatccatccatca 182906
>gb|AC108753.2| Oryza sativa (japonica cultivar-group) chromosome 9 BAC clone OSJNBa0010B06, complete sequence Length = 129310 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 9303 atccatccatccatccatcac 9283
>gb|AC144542.4| Mus musculus BAC clone RP24-177K17 from chromosome 6, complete sequence Length = 177339 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 3 atgatgatgatgacaaaataa 23 ||||||||||||||||||||| Sbjct: 45401 atgatgatgatgacaaaataa 45381
>gb|AC137113.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0006N14, complete sequence Length = 155730 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 129143 atccatccatccatccatcac 129163
>gb|AC132003.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0091D07, complete sequence Length = 144652 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 15701 atccatccatccatccatcac 15721
>gb|AC126453.5| Mus musculus BAC clone RP23-244A6 from chromosome 6, complete sequence Length = 172616 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatc 306 |||| |||||||||||||||||||| Sbjct: 60673 ccatcgatccatccatccatccatc 60697
>gb|AC144621.3| Mus musculus BAC clone RP24-335I14 from chromosome 17, complete sequence Length = 207330 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 62347 atccatccatccatccatcac 62367 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 62267 atccatccatccatccatcac 62287 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 62177 atccatccatccatccatcac 62197 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 62108 atccatccatccatccatcac 62128 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 62000 atccatccatccatccatcac 62020 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 61861 atccatccatccatccatca 61880
>gb|AC126023.3| Mus musculus BAC clone RP24-422I18 from chromosome 16, complete sequence Length = 198296 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 286 agatccatccatccatccatc 306 ||||||||||||||||||||| Sbjct: 107149 agatccatccatccatccatc 107129
>gb|AC134908.5| Mus musculus BAC clone RP23-377L13 from chromosome 17, complete sequence Length = 189458 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 3817 atccatccatccatccatcac 3797 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 3762 atccatccatccatccatcac 3742 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 3627 atccatccatccatccatcac 3607 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 3509 atccatccatccatccatcac 3489 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 3428 atccatccatccatccatcac 3408 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 3232 atccatccatccatccatcac 3212 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 3019 atccatccatccatccatcac 2999 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 2989 atccatccatccatccatcac 2969 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 3576 atccatccatccatccatca 3557
>gb|AY574378.1| Nitzschia laevis internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence Length = 768 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 732 atccatccatccatccatcac 712
>gb|AC144702.2| Danio rerio clone CH211-138D14, complete sequence Length = 192101 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 183431 ccatacatccatccatccatccatc 183455
>gb|AC016814.14| Mus musculus chromosome 1, clone RP23-2M16, complete sequence Length = 247961 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 149888 atccatccatccatccatcac 149908
>gb|AC091324.10| Mus musculus chromosome 7, clone RP23-7G1, complete sequence Length = 225556 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 188652 ccatatatccatccatccatccatc 188628 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 188464 ccatatatccatccatccatccatc 188440 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 287 gatccatccatccatccatc 306 |||||||||||||||||||| Sbjct: 188723 gatccatccatccatccatc 188704
>gb|AC113001.9| Mus musculus chromosome 7, clone RP23-184M4, complete sequence Length = 206940 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 278 agccccatagatccatccatccatccatc 306 |||||||| ||||||||||||||||||| Sbjct: 135744 agccccatccatccatccatccatccatc 135716
>gb|AC099934.14| Mus musculus chromosome 12, clone RP23-17K9, complete sequence Length = 234795 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 137164 atccatccatccatccatcac 137184
>gb|AC162527.5| Mus musculus BAC clone RP23-30M17 from chromosome 14, complete sequence Length = 200348 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 |||| |||||||||||||||||||| Sbjct: 62670 ccatcgatccatccatccatccatc 62646
>gb|AC158549.8| Mus musculus chromosome 19, clone RP24-216K4, complete sequence Length = 195500 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 85911 ccatacatccatccatccatccatc 85935
>gb|BC049201.1| Homo sapiens ankyrin repeat domain 25, mRNA (cDNA clone IMAGE:3923697), partial cds Length = 2017 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 1562 ccatacatccatccatccatccatc 1538
>gb|BC032745.1| Homo sapiens ankyrin repeat domain 25, mRNA (cDNA clone IMAGE:5574690), with apparent retained intron Length = 2310 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 1848 ccatacatccatccatccatccatc 1824
>gb|BC030030.2| Homo sapiens ankyrin repeat domain 25, mRNA (cDNA clone IMAGE:3605290), partial cds Length = 1548 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 1075 ccatacatccatccatccatccatc 1051
>gb|AC138615.3| Mus musculus BAC clone RP24-67A12 from chromosome 3, complete sequence Length = 150847 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 124075 ccataaatccatccatccatccatc 124051
>emb|BX677675.9| Zebrafish DNA sequence from clone DKEYP-90G12 in linkage group 2, complete sequence Length = 124301 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 74282 ccatacatccatccatccatccatc 74258 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 75509 atccatccatccatccatca 75490
>emb|CR450788.7| Zebrafish DNA sequence from clone DKEY-15P23 in linkage group 12, complete sequence Length = 115480 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 69141 atccatccatccatccatcac 69161
>emb|CR376775.7| Zebrafish DNA sequence from clone CH211-197C5 in linkage group 23, complete sequence Length = 196846 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 |||| |||||||||||||||||||| Sbjct: 178412 ccatcgatccatccatccatccatc 178388
>emb|CR788230.7| Zebrafish DNA sequence from clone DKEY-57I11 in linkage group 2, complete sequence Length = 223248 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 12651 ccatacatccatccatccatccatc 12675
>emb|BX005426.16| Zebrafish DNA sequence from clone DKEY-1H24 in linkage group 1, complete sequence Length = 202018 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 286 agatccatccatccatccatc 306 ||||||||||||||||||||| Sbjct: 82704 agatccatccatccatccatc 82684
>emb|BX890591.12| Zebrafish DNA sequence from clone DKEY-184J23 in linkage group 19, complete sequence Length = 171079 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 159793 ccatatatccatccatccatccatc 159769 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 160452 atccatccatccatccatca 160433 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 283 catagatccatccatccatccatc 306 |||| ||||||||||||||||||| Sbjct: 160330 catatatccatccatccatccatc 160307 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 160214 atccatccatccatccatca 160195 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 160174 atccatccatccatccatca 160155 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 159903 atccatccatccatccatca 159884 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 159760 atccatccatccatccatca 159741 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 283 catagatccatccatccatccatc 306 |||| ||||||||||||||||||| Sbjct: 159717 catatatccatccatccatccatc 159694 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 159708 atccatccatccatccatca 159689
>emb|CR762485.16| Zebrafish DNA sequence from clone DKEY-269K12 in linkage group 19, complete sequence Length = 171225 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 96752 ccatatatccatccatccatccatc 96728 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 98443 atccatccatccatccatca 98424 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 96522 atccatccatccatccatca 96503 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 74669 atccatccatccatccatca 74650
>gb|AC122395.4| Mus musculus BAC clone RP24-86H17 from chromosome 9, complete sequence Length = 203891 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 |||| |||||||||||||||||||| Sbjct: 86175 ccattgatccatccatccatccatc 86151 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 86153 atccatccatccatccatca 86134
>emb|CR626875.10| Zebrafish DNA sequence from clone DKEY-31J4 in linkage group 15, complete sequence Length = 212742 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 287 gatccatccatccatccatca 307 ||||||||||||||||||||| Sbjct: 34425 gatccatccatccatccatca 34445 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 141594 atccatccatccatccatca 141575 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 90141 atccatccatccatccatca 90160
>emb|CT009719.10| Mouse DNA sequence from clone RP23-65P17 on chromosome 17, complete sequence Length = 205369 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 173120 ccataaatccatccatccatccatc 173096 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 173041 ccataaatccatccatccatccatc 173017 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 172929 ccataaatccatccatccatccatc 172905
>emb|BX927362.10| Zebrafish DNA sequence from clone CH211-170N20 in linkage group 6, complete sequence Length = 131893 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 |||| |||||||||||||||||||| Sbjct: 83931 ccatcgatccatccatccatccatc 83907
>emb|CR450841.7| Zebrafish DNA sequence from clone DKEY-16N9 in linkage group 11, complete sequence Length = 263287 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 59827 ccataaatccatccatccatccatc 59803
>gb|AC146214.2| Pan troglodytes BAC clone CH251-295K11 from Y, complete sequence Length = 172148 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 37033 atccatccatccatccatcac 37053
>emb|CR628334.9| Zebrafish DNA sequence from clone CH211-175F11 in linkage group 17, complete sequence Length = 147890 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 47285 atccatccatccatccatcac 47265
>emb|CR392002.14| Zebrafish DNA sequence from clone DKEY-61D19 in linkage group 2, complete sequence Length = 52053 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 23873 ccataaatccatccatccatccatc 23897 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 23979 atccatccatccatccatca 23998
>emb|CR339052.6| Zebrafish DNA sequence from clone CH211-218E6 in linkage group 10, complete sequence Length = 127879 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 57261 ccatacatccatccatccatccatc 57237 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 56236 ccatacatccatccatccatccatc 56212
>emb|CR931792.9| Zebrafish DNA sequence from clone DKEY-180L1 in linkage group 13, complete sequence Length = 163673 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 118521 ccatatatccatccatccatccatc 118497 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 118447 atccatccatccatccatca 118428
>emb|BX927339.16| Zebrafish DNA sequence from clone CH211-251A10 in linkage group 17, complete sequence Length = 66778 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 10006 ccatatatccatccatccatccatc 10030
>gb|AC139183.4| Mus musculus BAC clone RP24-114C21 from chromosome 18, complete sequence Length = 147109 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 134327 ccatatatccatccatccatccatc 134303
>gb|AC122188.4| Mus musculus BAC clone RP23-33B7 from chromosome 10, complete sequence Length = 217173 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 67308 ccatacatccatccatccatccatc 67284
>gb|AC122252.4| Mus musculus BAC clone RP23-170E7 from chromosome 17, complete sequence Length = 219695 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 56629 ccatacatccatccatccatccatc 56605
>gb|AC124171.3| Mus musculus BAC clone RP23-167E23 from chromosome 13, complete sequence Length = 198242 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 286 agatccatccatccatccatc 306 ||||||||||||||||||||| Sbjct: 180935 agatccatccatccatccatc 180955
>gb|AC126262.4| Mus musculus BAC clone RP23-359F12 from chromosome 12, complete sequence Length = 208710 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 185704 atccatccatccatccatcac 185724 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 189039 atccatccatccatccatca 189058 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 185636 atccatccatccatccatca 185655 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 185455 atccatccatccatccatca 185474 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 185436 atccatccatccatccatca 185455
>emb|CR536619.20| Zebrafish DNA sequence from clone CH211-194H19 in linkage group 16, complete sequence Length = 179375 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 175678 ccatacatccatccatccatccatc 175654 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 175612 atccatccatccatccatca 175593 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 287 gatccatccatccatccatc 306 |||||||||||||||||||| Sbjct: 133981 gatccatccatccatccatc 134000
>gb|AF335246.1| Homo sapiens cone rod homeobox protein (CRX) gene, promoter region and exon 1A Length = 2080 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 124 atccatccatccatccatcac 144 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 54 atccatccatccatccatcac 74 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 213 atccatccatccatccatca 232 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 186 atccatccatccatccatca 205
>gb|AC127250.3| Mus musculus BAC clone RP24-482H23 from chromosome 3, complete sequence Length = 136942 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 |||| |||||||||||||||||||| Sbjct: 98318 ccatcgatccatccatccatccatc 98294
>gb|AC124703.3| Mus musculus BAC clone RP24-261G23 from chromosome 5, complete sequence Length = 183906 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 10180 atccatccatccatccatcac 10200
>gb|AC124489.2| Mus musculus BAC clone RP23-453H5 from chromosome 14, complete sequence Length = 167067 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 286 agatccatccatccatccatc 306 ||||||||||||||||||||| Sbjct: 121002 agatccatccatccatccatc 121022
>gb|AC121853.3| Mus musculus BAC clone RP24-96P15 from chromosome 17, complete sequence Length = 144510 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatc 306 |||| |||||||||||||||||||| Sbjct: 50689 ccatcgatccatccatccatccatc 50713
>emb|BX899180.11| Zebrafish DNA sequence from clone DKEY-287G19 in linkage group 21, complete sequence Length = 182150 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 49297 ccatatatccatccatccatccatc 49273 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 49457 atccatccatccatccatca 49438 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 49283 atccatccatccatccatca 49264
>gb|AC124202.3| Mus musculus BAC clone RP23-337F21 from chromosome 14, complete sequence Length = 189556 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 286 agatccatccatccatccatc 306 ||||||||||||||||||||| Sbjct: 167107 agatccatccatccatccatc 167087
>gb|AC124465.6| Mus musculus BAC clone RP24-156M16 from chromosome 13, complete sequence Length = 169973 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 286 agatccatccatccatccatc 306 ||||||||||||||||||||| Sbjct: 123344 agatccatccatccatccatc 123324
>gb|AC126055.4| Mus musculus BAC clone RP23-368O6 from chromosome 16, complete sequence Length = 197096 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Plus Query: 278 agccccatagatccatccatccatccatc 306 |||||||| ||||||||||||||||||| Sbjct: 124254 agccccatccatccatccatccatccatc 124282 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 124280 atccatccatccatccatca 124299
>emb|CR450724.10| Zebrafish DNA sequence from clone DKEY-168I4 in linkage group 18, complete sequence Length = 197565 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 75783 ccatacatccatccatccatccatc 75807 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 76629 atccatccatccatccatca 76648 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 75913 atccatccatccatccatca 75932 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 75797 atccatccatccatccatca 75816
>gb|AC124765.2| Mus musculus BAC clone RP23-197D9 from 2, complete sequence Length = 191781 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 27603 ccatatatccatccatccatccatc 27627 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 27550 ccatatatccatccatccatccatc 27574
>gb|AC122300.3| Mus musculus BAC clone RP23-275E20 from 7, complete sequence Length = 182032 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 286 agatccatccatccatccatc 306 ||||||||||||||||||||| Sbjct: 147726 agatccatccatccatccatc 147706
>emb|CR407547.14| Zebrafish DNA sequence from clone DKEY-62A12 in linkage group 9, complete sequence Length = 204067 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 132150 ccatatatccatccatccatccatc 132174 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 132503 atccatccatccatccatca 132522 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 283 catagatccatccatccatccatc 306 |||| ||||||||||||||||||| Sbjct: 69855 cataaatccatccatccatccatc 69878
>emb|CR848676.7| Zebrafish DNA sequence from clone DKEY-265I7 in linkage group 9, complete sequence Length = 96536 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 286 agatccatccatccatccatc 306 ||||||||||||||||||||| Sbjct: 72750 agatccatccatccatccatc 72730
>emb|BX936420.9| Zebrafish DNA sequence from clone DKEY-7F16 in linkage group 3, complete sequence Length = 168285 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 38332 ccatacatccatccatccatccatc 38356
>gb|AC121869.2| Mus musculus BAC clone RP24-121C10 from 17, complete sequence Length = 182237 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 |||| |||||||||||||||||||| Sbjct: 167112 ccatcgatccatccatccatccatc 167088
>emb|CR734555.2|CNS0GTKA Tetraodon nigroviridis full-length cDNA Length = 866 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 458 atccatccatccatccatcac 438
>gb|AC136628.2| Homo sapiens chromosome 5 clone RP11-798K23, complete sequence Length = 137132 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 286 agatccatccatccatccatc 306 ||||||||||||||||||||| Sbjct: 107651 agatccatccatccatccatc 107671 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 286 agatccatccatccatccatc 306 ||||||||||||||||||||| Sbjct: 107461 agatccatccatccatccatc 107481
>gb|AC002069.2| Homo sapiens BAC clone CTA-326K9 from 7, complete sequence Length = 158537 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 283 catagatccatccatccatccatca 307 |||| |||||||||||||||||||| Sbjct: 47998 catatatccatccatccatccatca 48022
>gb|AC017000.5| Homo sapiens BAC clone RP11-42B7 from 7, complete sequence Length = 154844 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 4905 atccatccatccatccatcac 4885 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 5205 atccatccatccatccatca 5186
>gb|AC005048.2| Homo sapiens BAC clone CTB-15P3 from 7, complete sequence Length = 125290 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatc 306 |||| |||||||||||||||||||| Sbjct: 18756 ccattgatccatccatccatccatc 18780
>emb|CR653148.2|CNS0F2XU Tetraodon nigroviridis full-length cDNA Length = 1030 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 286 agatccatccatccatccatc 306 ||||||||||||||||||||| Sbjct: 203 agatccatccatccatccatc 223
>gb|AC116458.9| Mus musculus chromosome 16, clone RP23-11L14, complete sequence Length = 219241 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 |||| |||||||||||||||||||| Sbjct: 161803 ccatcgatccatccatccatccatc 161779
>gb|AC069564.34| Mus musculus strain C57BL/6J chromosome 17 clone rp23-435n13, complete sequence Length = 185784 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 63243 ccatacatccatccatccatccatc 63267
>gb|AC166057.2| Mus musculus BAC clone RP23-385D11 from chromosome 14, complete sequence Length = 198165 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 184864 atccatccatccatccatcac 184844
>emb|BX928756.13| Zebrafish DNA sequence from clone CH211-113K9 in linkage group 21, complete sequence Length = 157210 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 282 ccatagatccatccatccatccatc 306 |||| |||||||||||||||||||| Sbjct: 72178 ccatcgatccatccatccatccatc 72202 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 11852 atccatccatccatccatca 11833 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 11694 atccatccatccatccatca 11675 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 atccatccatccatccatca 307 |||||||||||||||||||| Sbjct: 11516 atccatccatccatccatca 11497
>emb|CR450828.5| Zebrafish DNA sequence from clone CH211-199A5 in linkage group 2, complete sequence Length = 90546 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 3 atgatgatgatgacaaaataa 23 ||||||||||||||||||||| Sbjct: 22294 atgatgatgatgacaaaataa 22274
>emb|CR339051.6| Zebrafish DNA sequence from clone DKEY-223N8 in linkage group 7, complete sequence Length = 176851 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 282 ccatagatccatccatccatccatc 306 ||||| ||||||||||||||||||| Sbjct: 23289 ccatacatccatccatccatccatc 23265
>emb|BX927158.14| Zebrafish DNA sequence from clone DKEY-106K1 in linkage group 5, complete sequence Length = 144909 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 atccatccatccatccatcac 308 ||||||||||||||||||||| Sbjct: 142811 atccatccatccatccatcac 142831 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 287 gatccatccatccatccatc 306 |||||||||||||||||||| Sbjct: 142882 gatccatccatccatccatc 142901 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 287 gatccatccatccatccatc 306 |||||||||||||||||||| Sbjct: 142802 gatccatccatccatccatc 142821 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,612,237 Number of Sequences: 3902068 Number of extensions: 5612237 Number of successful extensions: 475281 Number of sequences better than 10.0: 2849 Number of HSP's better than 10.0 without gapping: 2881 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 347247 Number of HSP's gapped (non-prelim): 111480 length of query: 411 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 389 effective length of database: 17,147,199,772 effective search space: 6670260711308 effective search space used: 6670260711308 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
