>gb|AC153385.3| Mus musculus 6 BAC RP23-64D14 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 226269

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 82    aaccaatgactgttcttttc 101
             ||||||||||||||||||||
Sbjct: 83440 aaccaatgactgttcttttc 83421

>gb|AC122821.4| Mus musculus BAC clone RP23-201I4 from chromosome 17, complete sequence
          Length = 220013

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 60     ccccaaaataaaaccaccccgaaaccaa 87
              |||||||| ||||||||||| |||||||
Sbjct: 205067 ccccaaaaaaaaaccacccccaaaccaa 205094

>gb|AC154766.2| Mus musculus BAC clone RP24-440G8 from chromosome 17, complete sequence
          Length = 166224

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 60    ccccaaaataaaaccaccccgaaaccaa 87
             |||||||| ||||||||||| |||||||
Sbjct: 34675 ccccaaaaaaaaaccacccccaaaccaa 34702

>emb|CR387396.1| Gallus gallus finished cDNA, clone ChEST281h15
          Length = 848

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 64  aaaataaaaccaccccgaaaccaa 87
           |||| |||||||||||||||||||
Sbjct: 408 aaaaaaaaaccaccccgaaaccaa 385

>ref|XM_663340.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.10147)
           partial mRNA
          Length = 858

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 37  taacaaatccaactcgaca 55
           |||||||||||||||||||
Sbjct: 456 taacaaatccaactcgaca 474

>gb|AC105487.6| Rattus norvegicus 1 BAC CH230-229J7 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 221396

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 64     aaaataaaaccaccccgaa 82
              |||||||||||||||||||
Sbjct: 101712 aaaataaaaccaccccgaa 101694

>gb|AC024375.13| Homo sapiens chromosome 15, clone RP11-572A8, complete sequence
          Length = 163775

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 33    taaataacaaatccaactc 51
             |||||||||||||||||||
Sbjct: 87282 taaataacaaatccaactc 87264

>gb|AC163708.3| Gallus gallus BAC clone CH261-58P10 from chromosome ul, complete sequence
          Length = 226873

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 54     caactgccccaaaataaaa 72
              |||||||||||||||||||
Sbjct: 126272 caactgccccaaaataaaa 126290

>gb|AC154542.2| Mus musculus BAC clone RP23-458O22 from chromosome 17, complete
             sequence
          Length = 191836

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 80    gaaaccaatgactgttcttttca 102
             |||||||||||||||| ||||||
Sbjct: 50904 gaaaccaatgactgtttttttca 50882

>gb|AC135628.8| Homo sapiens chromosome 15, clone RP11-883G10, complete sequence
          Length = 137088

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 33     taaataacaaatccaactc 51
              |||||||||||||||||||
Sbjct: 100790 taaataacaaatccaactc 100772

>gb|AF509569.1| Rattus norvegicus strain F344 stearoyl-coenzyme A desaturase 1 (Scd1)
            mRNA, complete cds
          Length = 4475

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 64   aaaataaaaccaccccgaa 82
            |||||||||||||||||||
Sbjct: 3421 aaaataaaaccaccccgaa 3403

>gb|AF509568.1| Rattus norvegicus strain BN stearoyl-coenzyme A desaturase 1 (Scd1)
            mRNA, complete cds
          Length = 4475

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 64   aaaataaaaccaccccgaa 82
            |||||||||||||||||||
Sbjct: 3421 aaaataaaaccaccccgaa 3403

>dbj|BS000109.1| Pan troglodytes chromosome 22 clone:RP43-150L08, map 22, complete
           sequences
          Length = 157620

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 64  aaaataaaaccaccccgaa 82
           |||||||||||||||||||
Sbjct: 413 aaaataaaaccaccccgaa 395

>dbj|BS000108.1| Pan troglodytes chromosome 22 clone:PTB-237C02, map 22, complete
              sequences
          Length = 106901

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 64     aaaataaaaccaccccgaa 82
              |||||||||||||||||||
Sbjct: 100769 aaaataaaaccaccccgaa 100751

>dbj|AP001709.1| Homo sapiens genomic DNA, chromosome 21q, section 53/105
          Length = 340000

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 64     aaaataaaaccaccccgaa 82
              |||||||||||||||||||
Sbjct: 238077 aaaataaaaccaccccgaa 238059

>dbj|AP000245.3| Homo sapiens genomic DNA, chromosome 21 clone:RP11-14B21, complete
            sequence
          Length = 159903

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 64   aaaataaaaccaccccgaa 82
            |||||||||||||||||||
Sbjct: 6653 aaaataaaaccaccccgaa 6635

>gb|AC171008.2| Gallus gallus BAC clone CH261-169D8 from chromosome ul, complete
             sequence
          Length = 170270

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 54    caactgccccaaaataaaa 72
             |||||||||||||||||||
Sbjct: 23184 caactgccccaaaataaaa 23166

>dbj|AP000205.1| Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region, clone
             f43D11-119B8, segment 3/12, complete sequence
          Length = 100000

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 64    aaaataaaaccaccccgaa 82
             |||||||||||||||||||
Sbjct: 73065 aaaataaaaccaccccgaa 73047


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 998,376
Number of Sequences: 3902068
Number of extensions: 998376
Number of successful extensions: 61812
Number of sequences better than 10.0: 18
Number of HSP's better than 10.0 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 61782
Number of HSP's gapped (non-prelim): 30
length of query: 104
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 83
effective length of database: 17,151,101,840
effective search space: 1423541452720
effective search space used: 1423541452720
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)